Application of Itm2a positive skeletal stem cells in treatment of bone injury

Abstract

The present invention provides a pharmaceutical composition comprising: i) isolated skeletal stem cells wherein the skeletal stem cells are Itm2a positive; and ii) a pharmaceutically acceptable carrier. The invention also provides methods of isolating Itm2a-positive skeletal stem cells and methods of treating skeletal injuries or defects with Itm2a-positive skeletal stem cells.

Description

Technical Field

[0001] The present invention relates to cell biology and stem cell therapy. In particular, the present invention relates to a method for enriching skeletal stem cells by using Itm2a protein, and a method for treating bone fractures using Itm2a-positive skeletal stem cells. Background Art

[0002] Skeletal injuries are a frequent occurrence, particularly among adolescents, athletes, and the elderly, placing a strain on social security. Current clinical approaches to autologous bone transplantation for skeletal injuries have several limitations, including variability in graft quality (particularly in patients with osteoporosis) and limited donor bone availability. Harvesting autologous grafts often increases operative time, and complications of varying severity occur at the graft donor site in 10% to 35% of patients.

[0003] Cell therapy strategies can also be adopted, in which the search and separation of seed cells for cell therapy is particularly important.

[0004] The fracture repair process includes two classic bone formation methods: intramembranous ossification and endochondral ossification. When the bone fixation at the wound site is very strong, the body will quickly carry out early repair through intramembranous ossification, and then initiate endochondral ossification for subsequent repair (Einhorn & Gerstenfeld, Fracture healing: mechanisms and interventions. Nat Rev Rheumatol. 2015 Jan; 11(1): 45-54). In addition to the degree of fixation, the source of the stem cells involved in the repair also determines the repair method. Endosteal stem cells will directly form osteoblasts in the bone marrow cavity through intramembranous ossification and cross-link the broken bone. Periosteal stem cells will form intramembranous ossification on the cortical bone surface without moving stress, and endochondral ossification in the fracture gap (Claes et al., Fracture healing under healthy and inflammatory conditions. Nat Rev Rheumatol, 2012, 8, 133–143).

[0005] The stem cells involved in fracture repair mainly come from mesenchymal stem cells (MSCs) in the periosteum, bone marrow and endosteum (Raggatt et al., Cellular and molecular mechanisms of bone remodeling. J Biol Chem. 2010; 285(33): 25103-8). SDF1 is an important factor that can recruit MSCs to the fracture injury site. MSCs have a CXCR4 receptor on their surface that can bind to SDF1. Knocking out CXCR4 in MSCs will affect their cell migration, thereby delaying fracture repair (Kawakami et al., Calf circumference as a surrogate marker of muscle mass for diagnosing sarcopenia in Japanese men and women. Geriatr Gerontol Int. 2015 Aug; 15(8): 969-76; Kawanami et al., Effects of adecrease in mechanical stress on femoral regional bone mineral density and osteoblast microstructure: Comparison in a model of freely mobile and castimmobilized rats. Japanese Journal of Physical Fitness and Sports Medicine, 2009; 58: 305-316).MSCs begin to proliferate immediately after migrating to the fracture injury area. PDGF secreted by platelets in the fracture injury area can further promote angiogenesis and MSC proliferation (Caplan & Correa, PDGF in bone formation and regeneration: new insights into a novel mechanism involving MSCs. J Orthop Res. 2011 Dec; 29(12): 1795-803; Caverzasio et al., The p38α MAPK positively regulates osteoblast function and postnatal bone acquisition. Cell Mol Life Sci. 2012 Sep; 69(18): 3115-25).

[0006] In the early stages of fracture repair, platelet-derived lectins (TSPs) from platelets and MSCs can inhibit angiogenesis (Taylor et al., Developing ADHD. J Child Psychol Psychiatry. 2009 Jan;50(1-2):126-32). When cartilage is formed, the cartilage callus is essentially filled with dense collagen and matrix, in an avascular state. As chondrocytes hypertrophy, they gradually begin to secrete VEGF, PEG-1α, and PDGF to promote the formation and invasion of blood vessels. The blood vessels then feed back to promote cartilage calcification and bone formation. With the migration and expansion of MSCs, a new vascular network begins to form in the fracture area. This new vascular network brings oxygen, nutrients, and precursor cells to the damaged tissue, accelerating the repair process.

[0007] Skeletal stem cells (SSCs) are tissue-specific stem cells that can self-renew and are located at the top of the bone differentiation hierarchy, generating mature skeletal cell types required for bone growth, maintenance and repair. Bone development, homeostasis and repair require the self-renewal and differentiation of skeletal stem cells to function. SSCs are able to self-renew in vitro to form clones and have the ability to differentiate into osteoblasts, intramedullary fat, cartilage and hematopoietic support matrix, playing an important role in bone development, homeostasis and injury repair. The dysfunction of SSCs is caused by stress conditions such as aging and inflammation, and is becoming a cause of bone pathology (such as the pathogenesis of fracture nonunion). Recent lineage tracing experiments have shown that SSCs are present in the bone marrow, periosteum and resting areas of the growth plate.

[0008] The growth plate plays a major role in longitudinal bone extension, while the periosteum is crucial for bone thickening and repair. The identity of periosteal stem cells has only begun to be slowly unraveled in recent years. During development, periosteal stem cells originate from mesenchymal cells and have multipotency. Prrx1-Cre widely marks mesenchymal cells in the limbs and other parts of the body. The expression of a group of marker molecules related to bone marrow mesenchymal stem cells (BMSCs), including Pdgfrα, Grem1, Cxcl12 and Nestin, associated with Prrx1-Cre-labeled periosteal cells, is co-localized in the periosteum (Bianco et al., Osteoprogenitors and the hematopoietic microenvironment. Best Pract Res Clin Haematol. 2011 Mar; 24(1): 37-47; and Worthley et al., Skeletal stem cells in space and time. Cell. 2015 Jan 15; 160(1-2): 17-9). Prrx1-Cre-labeled periosteal cells transplanted into the fracture site can generate chondrocytes and osteoblasts, demonstrating their multipotency.Osx-CreER, Gli1-CreER, Lepr-Cre, Sox9-CreER and Hoxa11-CreER also mark periosteal stem cells, which will form osteoblasts and chondrocytes to participate in repair after fracture (Bianco et al., Osteoprogenitors and the hematopoietic microenvironment. Best Pract Res Clin Haematol. 2011 Mar; 24(1): 37-47; Duchamp de Lageneste et al., Periosteum contains skeletal stem cells with high bone regenerative potential controlled by Periostin. Nat Commun. 2018 Feb 22; 9(1): 773; Mo et al., Single-cell transcriptomics of LepR-positive skeletal cells reveals heterogeneous stress-dependent stem and progenitor pools. EMBO J. 2022 Feb 15; 41(4): e108415; Pineault ... al., Hox11-expressing regional skeletal stem cells are progenitors for osteoblasts, chondrocytes, and adipocytes throughout life. Nat Commun. 2019 Jul 18; 10(1): 3168; Sacchetti et al., Self-renewing osteoprogenitors in bone marrow sinusoids can organize a hematopoietic microenvironment. Cell. 2007 Oct 19; 131(2): 324-36). However, since these Cre markers mark a wide range of mesoderm-derived cell populations, it has not yet been determined which population within the periosteum has stronger skeletal stem cell properties.Surprisingly, cathepsin K (Ctsk), which was previously used as a marker for bone-resorbing osteoclasts, was found to mark periosteal stem cells (Debnath et al., Discovery of a periosteal stem cell mediating intramembranous bone formation. Nature 562(2018): 133-139; Han et al., Lkb1 deletion in periosteal mesenchymal progenitors induces osteogenic tumors through mTORC1 activation. J Clin Invest. 2019 May 1; 129(5): 1895-1909; Yang et al., Ptpn11 deletion in a novel progenitor causes metachondromatosis by inducing hedgehog signalling. Nature. 2013 July). 25; 499(7459):491-5), Ctsk+ cells were isolated from the femoral periosteum of young mice and found to exhibit self-renewal properties, with monoclonal formation (CFU-F) ability and multi-lineage differentiation potential (bone, cartilage and fat cells, but no stromal cells). The absence of the osteogenic differentiation transcription factor Osx in Ctsk-Cre-marked animals leads to poor fracture repair and severe damage to the bone cortex. However, it should be noted that, similar to Prrx1, Gli1, etc., Ctsk-Cre marks a wide range of periosteal cells, only some of which are skeletal stem cells. In 2019, Park et al. identified a group of long-term Mx1+αSMA+ periosteal stem cells in vivo by constructing Mx1-Cre&αSMA-GFP mice. Combined with dynamic imaging technology, it was tracked in vivo that Mx1+αSMA+periosteal stem cells were involved in fracture and bone injury repair, and the migration of these periosteal stem cells was regulated by CCR5. It also suggested that the combination of different markers may separate skeletal stem cell subpopulations with different characteristics (Ortinau et al., Identification of Functionally Distinct Mx1+αSMA+Periosteal Skeletal Stem Cells. Cell Stem Cell. 2019 Dec 5; 25(6): 784-796.e5).

[0009] Therefore, there is a need to provide skeletal stem cells with high osteogenic capacity and to identify new molecular markers to isolate skeletal stem cells with high osteogenic capacity from bone tissue such as periosteum. Summary of the Invention

[0010] In a first aspect, the present invention provides a pharmaceutical composition comprising:

[0011] i) isolated skeletal stem cells, wherein the skeletal stem cells are Itm2a positive; and

[0012] ii) a pharmaceutically acceptable carrier.

[0013] In some embodiments, the skeletal stem cells are human skeletal stem cells, and the skeletal stem cells are CD45-CD31-TER119-CD235-CD146-PDPN+CD73+CD164+ cells. In some embodiments, the skeletal stem cell population has the ability to differentiate into osteoblasts. In some embodiments, the skeletal stem cell population is self-renewing and clonogenic. In some embodiments, the skeletal stem cells are enriched from bone tissue samples. In some embodiments, the skeletal stem cell population is expanded in vitro. In some embodiments, the pharmaceutical composition is formulated for local administration, such as local administration at a fracture site.

[0014] In a second aspect, the present invention provides a method for preparing an isolated skeletal stem cell population, wherein the skeletal stem cells are Itm2a positive, the method comprising:

[0015] a) providing a cell pool from bone tissue;

[0016] b) selecting Itm2a-positive cells from the cell pool derived from bone tissue; and

[0017] c) optionally expanding the cells selected in step b) in culture.

[0018] In some embodiments, step b) comprises selecting with a binding molecule against Itm2a. In some embodiments, the binding molecule is an anti-Itm2a antibody. In some embodiments, step b) comprises selecting by flow cytometry.

[0019] In some embodiments, the skeletal stem cells are human skeletal stem cells, and the method further comprises selecting CD45-CD31-TER119-CD235-CD146-PDPN+CD73+CD164+ cells from the cell pool from bone tissue.

[0020] In a third aspect, the present invention provides a method of treating a bone injury or defect in a subject in need thereof, the method comprising

[0021] a) providing a cell pool from bone tissue;

[0022] b) selecting Itm2a-positive cells from the cell pool derived from bone tissue;

[0023] c) expanding the cells selected in step b) in culture; and

[0024] d) administering the cells expanded in step c) to the subject in need thereof.

[0025] In some embodiments, the bone tissue is autologous bone tissue of the subject in need. In some embodiments, the bone tissue is allogeneic bone tissue. In some embodiments, step b) comprises selecting using a binding molecule against Itm2a. In some embodiments, the binding molecule is an anti-Itm2a antibody. In some embodiments, step b) comprises selecting by flow cytometry. In some embodiments, the expanded cells are administered locally at the site of bone injury or defect.

[0026] In some embodiments, the skeletal stem cells are human skeletal stem cells, and the method further comprises selecting CD45-CD31-TER119-CD235-CD146-PDPN+CD73+CD164+ cells from the cell pool from bone tissue.

[0027] The present invention also provides a method of treating bone damage or defect in a subject in need thereof, comprising administering to the subject in need thereof a pharmaceutical composition of the present invention.

[0028] In some embodiments, the pharmaceutical composition is administered locally at the bone fracture site. In some embodiments, the skeletal stem cells are autologous or allogeneic to the subject in need thereof.

[0029] The present invention also provides a pharmaceutical composition of the present invention for use in treating bone damage or defects in a subject in need thereof.

[0030] The present invention also provides the use of the pharmaceutical composition of the present invention or the isolated skeletal stem cell population prepared by the method of the present invention in the preparation of a medicament for treating bone damage or defect in a subject in need.

[0031] In some embodiments, the bone injury or defect is a bone fracture. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Single-cell sequencing of Prrx1-Cre-positive periosteum in 4-week-old mice is shown.

[0033] A: Prrx1-Cre+ periosteal cell single-cell sequencing process. After wrapping the two ends of the femur with low-melting point agarose and digesting with collagenase, Prrx1-Ai9-positive periosteal cells were obtained by flow cytometry sorting for single-cell sequencing; B: t-SNE dimensionality reduction shows 13 cell subpopulations in single-cell sequencing: stem / progenitor cells (cell subpopulations 0 to 3, 7 and 10), osteoblasts (cell subpopulations 4 and 12), endothelial cells (cell subpopulations 5, 6 and 8), muscle cells (cell subpopulations 9 and 11); C to F: Feature maps show the difference between the two groups. Genes specifically expressed in the same cell cluster, with two representative genes selected for each cell cluster: periosteal stem / progenitor cells (C) (Col3a1 and Itgbl1), osteoblasts (D) (Sp7 and Bglap), muscle cells (E) (Pax7 and Myob5), and endothelial cells (F) (Emcn and Pecam1); and G: Pseudo-chronic analysis of Prrx1-Ai9-positive periosteal cells, showing that the cells can be divided into three states; (H) Distribution of cells in the three states on the pseudo-chronic timeline.

[0034] Figure 2 It was shown that Itm2a molecules were used to enrich skeletal stem cells in Prrx1-positive periosteal cells.

[0035] A: Feature plot showing the expression distribution of skeletal stem cell markers CD105 and CD200 in Prrx1-Cre positive cells; B: t-SNE dimensionality reduction showing the distribution of periosteal stem / progenitor cell populations (cell state 2, cell subpopulations 0, 1, 2, 3, 7 and 10); C: Feature plot showing the expression distribution of Itm2a molecules in periosteal skeletal stem cells; D: Flow cytometric analysis of the expression of Itm2a and skeletal stem cell marker molecules CD105 and CD200 in the periosteum; and E: Statistics of the proportion of skeletal stem cells in Itm2a negative / positive cells.

[0036] Figure 3 Shown is the in vitro functional characterization of Itm2a-positive cells.

[0037] A: Confocal microscopy imaging shows the distribution of ITM2A protein in 293 cells after overexpression of mItm2a and hITM2A plasmids; B: Crystal violet staining was used to compare the differences in the in vitro clonogenic ability of Lin-Itm2a- and Lin-Itm2a+ periosteal cells; C: Statistics of the in vitro clonogenic ability of Lin-Itm2a- and Lin-Itm2a+ periosteal cells, data represent mean ± SD, n = 3, ***P < 0.001; and D: Comparison of the in vitro chondrogenic (left, Alcian blue staining), adipogenic (middle, Oil Red O staining), and osteogenic (right, Alizarin Red staining) abilities of Lin-Itm2a- and Lin-Itm2a+ periosteal cell-derived monoclonal cells.

[0038] Figure 4 In vivo functional characterization of Itm2a-positive periosteal skeletal stem cells was demonstrated.

[0039] A: Schematic diagram of the process of functional verification experiments in which Actin-GFP-positive Itm2a-SSC and Itm2a+SSC were transplanted into bone defects and under the renal capsule in vitro; B: μ-CT results showed the repair of bone defects by Actin-GFP-positive Itm2a-SSC and Itm2a+SSC; C: Statistics of new bone formation at the bone defect site 7 days after Actin-GFP-positive Itm2a-SSC and Itm2a+SSC transplantation, data are mean ± SD, n = 3, ***P < 0.001; D: Confocal microscopy imaging showed that Actin-GFP-positive Itm2a-SSC and Itm2a+SSC periosteal cells were transplanted into bone defects. A: Co-localization of GFP and bone marker (OPN) in the newly formed bone after injury; E: μ-CT results showing the ability of Actin-GFP-positive Itm2a-SSC and Itm2a+SSC to form bone organoids under the renal capsule; F: Statistics of bone organoids under the renal capsule 2 months after Actin-GFP-positive Itm2a-SSC and Itm2a+SSC transplantation, data represent mean ± SD, n = 3, ***P < 0.001; and G: Confocal microscopy imaging shows the co-localization of GFP and bone marker (OPN) in bone organoids after Actin-GFP-positive Itm2a-SSC and Itm2a+SSC periosteal cells were transplanted into the renal capsule.

[0040] Figure 5 Itm2a-positive periosteal skeletal stem cells showed the ability to self-renew and differentiate into the entire skeletal stem cell lineage.

[0041] A: Flow cytometric analysis showing the distribution of Itm2a and skeletal stem cell markers in bone organoids derived from Itm2a-positive SSCs; and B: Flow cytometric analysis showing the distribution of Itm2a and skeletal stem cell markers in bone organoids derived from Itm2a-negative SSCs.

[0042] Figure 6 Showing the distribution of ITM2A cells in human periosteum samples

[0043] A: Photograph of human periosteum samples; B: Confocal microscopy imaging showing the distribution of ITM2A-positive cells in human periosteum samples; and C: Flow cytometry analysis of the proportion of skeletal stem cells and ITM2A-positive cells in human periosteal cells.

[0044] Figure 7 Functional characterization of ITM2A cells in human periosteum samples is shown.

[0045] A: Comparison of the in vitro chondrogenic (left, Alcian blue staining), adipogenic (middle, Oil Red O staining) and osteogenic (right, Alizarin Red staining) abilities of ITM2A-negative and ITM2A-positive human periosteal cells; B: Comparison of the in vitro clonogenic abilities of ITM2A-negative and ITM2A-positive human periosteal cells by crystal violet staining; C: Quantitative analysis of the in vitro clonogenic abilities of ITM2A-negative and ITM2A-positive human periosteal cells, data are expressed as mean ± SD, n = 5, ***P < 0.001; D: μ-CT results showing the ability of ITM2A-negative and ITM2A-positive human periosteal cells to form bone organoids transplanted into the subrenal capsule; and E: Quantitative analysis of subrenal bone organoids 2 months after transplantation of ITM2A-negative and ITM2A-positive human periosteal cells, data are expressed as mean ± SD, n = 4, ***P < 0.001.

[0046] Figure 8 Showing lineage tracing of periosteal skeletal stem cells in Itm2a-CreER mice.

[0047] A: Construction strategy of Itm2a-CreER mice; B: Confocal microscopy imaging shows the distribution of Itm2a-positive cells in the periosteum of mice 2 days after induction at 4 weeks of age; C: Confocal microscopy imaging shows the co-localization of Itm2a-positive cells and the osteoblast marker OPN in the periosteum; D: Confocal microscopy imaging shows the co-localization of Itm2a-positive cells and the stem cell marker CD200 in the periosteum; and E: Flow cytometric analysis of the proportion of skeletal stem cells in Itm2a-negative and -positive periosteal cells.

[0048] Figure 9 It shows that Itm2a-positive periosteal stem cells are involved in fracture repair.

[0049] A: Flowchart of tamoxifen injection, fracture injury modeling and sampling in Itm2a-CreER; Ai6 mice; B: Confocal microscopy imaging showing the distribution of Itm2a-positive cell populations (ZsGreen signal positive) in the periosteum 3 days after fracture injury; C: Confocal microscopy imaging showing the colocalization of Itm2a-positive cells and the chondrocyte marker COL2A1 protein in the soft callus 7 days after fracture injury; D: Confocal microscopy imaging showing the colocalization of Itm2a-positive cells and the osteoblast marker OPN protein in the hard callus 14 days after fracture injury; E: Confocal microscopy imaging showing the colocalization of Itm2a-positive cells and the bone marrow stromal cell marker LEPR protein in the medullary cavity of the callus after fracture injury; and F: Quantitative analysis of the proportion of Itm2a-positive cells in the cartilage, osteoblasts and bone marrow stromal cells formed during the fracture injury repair process, data are expressed as mean ± SD, n = 3.

[0050] Figure 10 showed that knockout of Bmp2 in Itm2a lineage cells resulted in impaired fracture repair.

[0051] A: Bar graph showing the signaling pathways enriched in upregulated genes in Itm2a-positive skeletal stem cells; B: Heat map showing the expression of BMP signaling pathway-related genes in Itm2a-negative and -positive periosteal skeletal stem cells; C: Schematic diagram of the tamoxifen-induced, fracture, and sample collection process in control mice and Bmp2 conditional knockout mice; D: X-ray results showing callus formation in control mice and Bmp2 conditional knockout mice 7 days, 14 days, and 21 days after fracture; E: Statistics of callus parameters in control mice and Bmp2 conditional knockout mice 7 days, 14 days, and 21 days after fracture, data are expressed as mean ± SD, n = 4; F: μ-CT and safranin fast green staining results in control mice and Bmp2 conditional knockout mice 14 days after fracture; and G: Quantitative analysis of new bone mass in callus in control mice and Bmp2 conditional knockout mice 14 days after fracture, data are expressed as mean ± SD, n = 4.

[0052] Figure 11 It was shown that depletion of Itm2a lineage cells resulted in impaired fracture repair.

[0053] A: Schematic diagram of the tamoxifen-induced, fracture, and sample collection process in control mice and Itm2a-CreER-DTA mice; B: Confocal microscopy imaging showing the distribution of Itm2a-positive cells in the periosteum after tamoxifen induction; C: μ-CT and safranin fast green staining results in control mice and Itm2a-CreER-DTA mice on day 28 after fracture; and D: Quantitative analysis of fracture repair in control mice and Itm2a-CreER-DTA mice on day 28 after fracture, *P = 0.025, Fisher's exact test. Detailed Description of the Invention

[0054] definition

[0055] In the present invention, unless otherwise indicated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are terms and routine procedures widely used in the corresponding fields. For example, the standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are more fully described in the following documents: Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (referred to as "Sambrook"). At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0056] As used herein, the term "and / or" encompasses all combinations of items connected by the term, and should be treated as if each combination had been individually listed herein. For example, "A and / or B" encompasses "A," "A and B," and "B." For example, "A, B, and / or C" encompasses "A," "B," "C," "A and B," "A and C," "B and C," and "A and B and C."

[0057] As used herein, the term "Itm2a" refers to integral membrane protein 2A, a type II integral membrane protein. The coding sequence of the mouse Itm2a gene is 792 base pairs (bp) long, encoding a protein of approximately 30 kilodaltons (kDa). The amino acid sequence of mouse Itm2a shares 95% homology with that of human ITM2A. Itm2a is primarily expressed in ribs, vertebrae, long bones, skeletal muscle, T cells, hair follicles, skin, and tongue. However, prior art has not reported on the relationship between Itm2a and stem cells.

[0058] Stem cells are cells that retain the ability to renew their own kind by cell mitosis, and their daughter cells can differentiate into a variety of specialized cell types. Two major types of mammalian cells are: embryonic stem cells (ESC) found in blastocysts, and adult stem cells found in adult tissues. In developing embryos, ESCs can differentiate into all specialized embryonic tissues. In adult organisms, adult stem cells and progenitor cells serve as the body's repair system, replenishing specialized cells and also maintaining the normal functioning of regenerated organs, such as blood, skin, and bone tissue. Pluripotent stem cells can differentiate into cells derived from any of the three germ layers.

[0059] As used herein, the term "stem cell" refers to an undifferentiated cell that is capable of proliferating and producing more progenitor cells that are capable of producing a large number of mother cells that can in turn produce differentiated or differentiable daughter cells known as precursor cells. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types while also retaining one or more cells with the developmental potential of the parent.

[0060] The term "stem cell" also refers to a subpopulation of progenitor cells that have the ability or potential to differentiate into a more specialized or differentiated phenotype under certain circumstances, and in certain cases also retain the ability to proliferate without substantially differentiating.

[0061] The term "skeletal stem cells" encompasses stem cells that are capable of differentiating into cells of the skeletal lineage and ultimately forming skeletal tissue. The term "lineage" is used herein to describe cells with a common ancestor or cells with a common developmental fate, for example, chondrocyte precursor cells, osteoblast precursor cells, chondrocytes, and osteoblasts. Skeletal stem cells have the ability to self-renew, have clonal multipotency, and still have the ability to differentiate into different lineages after transplantation.

[0062] As used herein, the expressions "isolated skeletal stem cell population, wherein the skeletal stem cells are Itm2a positive," and "isolated Itm2a positive skeletal stem cell population," "isolated Itm2a positive cell population" encompass heterogeneous or homogeneous populations of skeletal stem cells. A population comprising at least two different cell types is referred to herein as a "heterogeneous population." A population comprising only one cell type (e.g., Itm2a positive skeletal stem cells) is referred to herein as a "homogeneous population" of cells.

[0063] As used herein, the term "isolated cell" refers to a cell that has been removed from the organism, organ or tissue in which it was originally found, or the progeny of such a cell. Optionally, the cell has been cultured in vitro.

[0064] "Self-renewal" refers to the ability of a cell to divide and produce at least one daughter cell with the same characteristics of the parent cell. The second daughter cell can enter a specific differentiation pathway. Daughter cells that enter the differentiation pathway usually have lost their self-renewal ability and, when divided, produce two daughter cells that exhibit a more differentiated (i.e., restricted) phenotype.

[0065] As used herein, the term "isolation" refers to the process of removing a cell or cell population from a subject or biological sample in which it is initially found. As used herein, the term "isolated population" refers to a cell population removed and separated from a biological sample, or a mixed or heterogeneous population of cells found in such a sample.

[0066] As used herein, the term "enrichment" refers to an increase in the amount, concentration, density or proportion of a cell type relative to the initial biological sample, culture or preparation, for example, an increase of at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% or at least 75%, preferably an increase of at least 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more. For example, if the proportion of a cell type in the initial sample is 3%, and the proportion of the cell type in the enriched sample is 30%, then the "enrichment" increases the proportion of the cell type by 1000%.

[0067] As used herein, "marker" describes the characteristics and / or phenotype of a cell. Markers can be used to select cells containing the characteristics of interest. Markers vary with specific cells. A marker is a characteristic that is unique to a cell type, whether morphological, functional, or biochemical (enzymatic), or a molecule expressed by a cell type. Preferably, such markers are proteins, and more preferably, have epitopes of antibodies or other binding molecules available in the art. However, the marker can be composed of any molecule found in the cell, including but not limited to proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids, and steroids. Examples of morphological characteristics or proterties include but are not limited to proterties, size, appearance (e.g., smooth, translucent), and nuclear-cytoplasmic ratios. Examples of functional characteristics or proterties include but are not limited to the ability to adhere to a specific substrate, the ability to absorb or exclude specific dyes, the ability to migrate under specific conditions, and the ability to differentiate along a specific lineage. Markers can be detected by any method available to those skilled in the art.

[0068] Therefore, as used herein, "cell surface marker" refers to any molecule expressed on the cell surface. Cell surface expression generally requires that the molecule has a transmembrane domain. Some molecules that are not usually found on the cell surface can be engineered to be expressed on the cell surface by recombinant technology. Many naturally occurring cell surface markers are named "CD" or "cluster of differentiation" molecules. Cell surface markers often provide antigenic determinants that antibodies can bind to.

[0069] As used herein, the term "antibody" refers to a complete immunoglobulin or a monoclonal or polyclonal antigen-binding fragment having an Fc (fragment crystallizable) region or an FcRn-binding fragment of the Fc region. Antigen-binding fragments can be prepared by recombinant DNA technology or by enzymatic or chemical cleavage of complete antibodies. "Antigen-binding fragments" include, but are not limited to, Fab, Fab', F(ab')2, Fv, scFv, single-domain antibodies, chimeric antibodies, bispecific antibodies, and polypeptides containing at least a portion of an immunoglobulin sufficient to confer specific antigen binding to the polypeptide. Such antibodies or antigen-binding fragments are commercially available from suppliers such as R&D Systems, BD Biosciences, e-Biosciences, Merck / millipore, Invitrogen, and ABCAM, or can be produced by methods known to those skilled in the art against these cell surface markers or other intracellular markers.

[0070] The term "subject" refers to an animal, for example, a human from whom cells for use in the methods described herein can be obtained (i.e., a donor subject) and / or a human to whom treatment (including prophylactic treatment) with the cells described herein is provided, i.e., a recipient subject. For treatment of disease conditions or morbidities that are specific to a particular animal, such as a human subject, the term subject refers to that particular animal. "Non-human animals" and "non-human mammals," used interchangeably herein, include mammals such as rats, mice, rabbits, sheep, cats, dogs, cattle, pigs, and non-human primates. The term "subject" also encompasses any vertebrate, including but not limited to mammals, reptiles, amphibians, and fish. However, advantageously, the subject is a mammal such as a human, or other mammals such as domestic animals, for example, dogs, cats, horses, etc., or food-producing mammals, for example, cattle, sheep, pigs, etc.

[0071] As used herein, the term "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and generally do not produce toxic or allergic or similar untoward reactions when administered to humans.

[0072] Itm2a-positive skeletal stem cells

[0073] The present invention is based on the discovery of Itm2a-positive skeletal stem cells. The inventors discovered that Itm2a-positive skeletal stem cells possess characteristics of adult stem cells, namely self-renewal and clonogenicity. The inventors also discovered that Itm2a-positive skeletal stem cells can reconstitute the entire skeletal stem cell lineage and possess the ability to form bone, cartilage, and fat, specifically possessing a stronger osteogenesis capacity than Itm2a-negative cells.

[0074] It is well known that, because of their characteristics, stem cells produce all cells and tissues of the body. Therefore, stem cells can be used to repair or accelerate the repair of damaged and / or defective bones. If a sufficient amount of SSCs can be obtained, damaged and / or defective bones can be repaired by building new tissues in the bones. In defective and / or damaged bones, SSCs may be few or non-existent. Because adult SSCs self-renew, implanted adult SSCs will colonize at the location of bone damage or defects. Through cloning, self-renewal and differentiation, implanted SSCs will produce new bone tissue. Therefore, isolated SSC populations or compositions comprising isolated SSC populations can be used to treat bone damage or defects in a subject, such as fractures.

[0075] Thus, the present invention provides isolated skeletal stem cells, wherein the skeletal stem cells are Itm2a positive. The present invention also provides isolated skeletal stem cell populations, wherein the population is enriched for Itm2a positive skeletal stem cells, for example, the population primarily comprises SSCs (e.g., at least 60%, 70%, 80%, 90% or more). In some embodiments, the population comprises very few Itm2a negative cells, or no Itm2a negative cells.

[0076] In some embodiments, the skeletal stem cells are Lin- (ie, CD45 / CD31 / TER119 negative) cells (CD45-CD31-TER119- cells).

[0077] In some embodiments, the skeletal stem cells are mouse skeletal stem cells. In some embodiments, the skeletal stem cells are CD200 positive (CD200+) cells. In some embodiments, the skeletal stem cells are Ctsk positive (Ctsk+) cells. In some embodiments, the skeletal stem cells are CD105 negative (CD105-) cells. In some embodiments, the skeletal stem cells are 6C3 negative (6C3-) cells. In some embodiments, the skeletal stem cells are CD90.2 negative (CD90.2-) cells. In some embodiments, the mouse skeletal stem cells are CD200+CD105- cells. In some embodiments, the mouse skeletal stem cells are CD200+Ctsk+CD105- cells. In some embodiments, the mouse skeletal stem cells are 6C3-CD90.2-CD200+CD105- cells. In some embodiments, the mouse skeletal stem cells are Lin-6C3-CD90.2-CD200+CD105- cells.

[0078] In some embodiments, the skeletal stem cells are human skeletal stem cells. In some embodiments, the skeletal stem cells are CD45 negative (CD45-) cells. In some embodiments, the skeletal stem cells are CD235 negative (CD235-) cells. In some embodiments, the skeletal stem cells are CD146 negative (CD146-) cells. In some embodiments, the skeletal stem cells are PDPN positive (PDPN+) cells. In some embodiments, the skeletal stem cells are CD73 positive (CD73+) cells. In some embodiments, the skeletal stem cells are CD164 positive (CD164+) cells. In some embodiments, the human skeletal stem cells are CD45-CD235-CD146-PDPN+CD73+CD164+ cells. In some embodiments, the human skeletal stem cells are Lin-CD235-CD146-PDPN+CD73+CD164+ cells.

[0079] In some embodiments, the skeletal stem cells have the ability to differentiate into osteoblasts.

[0080] In some embodiments, the skeletal stem cell population is self-renewing and clonogenic.

[0081] In some embodiments, the skeletal stem cells are enriched from a bone tissue sample.

[0082] In some embodiments, the skeletal stem cell population is expanded ex vivo.

[0083] In some embodiments, the skeletal stem cells are modified to increase the level of BMP2 protein. The expression level of a specific protein in a cell can be increased by techniques known in the art, including but not limited to introducing a BMP2 overexpression vector (e.g., a viral vector, such as rAAV) in a cell, targeting a BMP2 regulatory sequence (e.g., a promoter) of a transcriptional activation system (e.g., a transcriptional activation domain (TAD) fused to a sequence-specific DNA binding domain such as a zinc finger domain, TALE, or dCas, or an epigenetic regulatory portion, such as a polypeptide that reduces the level of DNA methylation, such as a TET protein or its functional fragment).

[0084] Isolation, expansion, and modification of Itm2a-positive skeletal stem cells

[0085] The inventors discovered that Itm2a is expressed on the cell membrane of skeletal stem cells, providing a new molecular marker for identifying and isolating skeletal stem cells.

[0086] Therefore, the present invention provides a method for preparing an isolated skeletal stem cell population, wherein the skeletal stem cells are Itm2a positive, the method comprising:

[0087] a) providing a pool of cells from bone tissue; and

[0088] b) selecting Itm2a-positive cells from the bone tissue-derived cell pool.

[0089] In some embodiments, the method further comprises selecting Lin- (ie, CD45 / CD31 / TER119 negative) cells (CD45-CD31-TER119- cells).

[0090] In some embodiments, the skeletal stem cells are mouse cells. In some embodiments, the method further comprises selecting CD200 positive (CD200+) cells. In some embodiments, the method further comprises selecting Ctsk positive (Ctsk+) cells. In some embodiments, the method further comprises selecting CD105 negative (CD105-) cells. In some embodiments, the method further comprises selecting 6C3 negative (6C3-) cells. In some embodiments, the method further comprises selecting CD90.2 negative (CD90.2-) cells. In some embodiments, the method further comprises selecting CD200+CD105- cells. In some embodiments, the method further comprises selecting CD200+Ctsk+CD105- cells. In some embodiments, the method further comprises selecting 6C3-CD90.2-CD200+CD105- cells. In some embodiments, the method further comprises selecting Lin-6C3-CD90.2-CD200+CD105- cells.

[0091] In some embodiments, the skeletal stem cells are human skeletal stem cells. In some embodiments, the method further comprises selecting CD45 negative (CD45-) cells. In some embodiments, the method further comprises selecting CD235 negative (CD235-) cells. In some embodiments, the method further comprises selecting CD146 negative (CD146-) cells. In some embodiments, the method further comprises selecting PDPN positive (PDPN+) cells. In some embodiments, the method further comprises selecting CD73 positive (CD73+) cells. In some embodiments, the method further comprises selecting CD164 positive (CD164+) cells. In some embodiments, the method further comprises selecting CD45-CD235-CD146-PDPN+CD73+CD164+ cells. In some embodiments, the method further comprises selecting Lin-CD235-CD146-PDPN+CD73+CD164+ cells.

[0092] In some embodiments, step a) comprises obtaining bone tissue from a subject. In some embodiments, the subject is a human, including adolescents, adults, and the elderly. In some embodiments, the bone tissue is periosteum.

[0093] In some embodiments, the method further comprises enzymatically digesting the bone tissue, e.g., eliminating non-cellular structures in the tissue, to obtain a pool of cells from the bone tissue. In some embodiments, the method further comprises removing red blood cells, e.g., lysing the red blood cells. In some embodiments, the method further comprises filtering to remove cell aggregates.

[0094] In some embodiments, step b) comprises selecting with a binding molecule directed against Itm2a. In some embodiments, the binding molecule is an anti-Itm2a antibody, such as a monoclonal antibody, or an antigen-binding fragment thereof.

[0095] In some embodiments, the method further comprises selecting with a binding molecule against CD45, CD31 and / or TER119, such as an anti-CD45, anti-CD31 and / or anti-TER119 antibody or an antigen-binding fragment thereof.

[0096] In some embodiments, the skeletal stem cells are mouse cells.In some embodiments, the method further comprises selecting with a binding molecule to 6C3, CD90.2, CD200 and / or CD105, such as an anti-6C3, anti-CD90.2, anti-CD200 and / or anti-CD105 antibody or an antigen-binding fragment thereof.

[0097] In some embodiments, the skeletal stem cells are human skeletal stem cells. In some embodiments, the method further comprises selecting with a binding molecule to CD235, CD146, PDPN, CD73 and / or CD164, such as an anti-CD235, anti-CD146, anti-PDPN, anti-CD73 and / or anti-CD164 antibody or antigen-binding fragment thereof.

[0098] In some embodiments, the binding molecule is conjugated to solid particles, such as magnetic beads. In some embodiments, the binding molecule is labeled, such as with a fluorescent dye.

[0099] In some embodiments, step b) comprises selection by flow cytometry.In some embodiments, step b) comprises selection by magnetic selection.

[0100] In a specific embodiment, the method comprises: obtaining periosteum (e.g., 1 cm×1 cm) from a subject; digesting the periosteum with collagenase to obtain single cells; collecting the single cells by centrifugation and preparing a suspension containing the single cells; optionally, filtering the suspension to remove cell aggregates; incubating the cells with an anti-Itm2a antibody; and isolating cells bound to the antibody.

[0101] In some embodiments, the method further comprises c) expanding the cells selected in step b) in a culture medium. In some embodiments, the cells are cultured on a biocompatible scaffold, preferably a 3D scaffold.

[0102] In some embodiments, after expansion, the number of Itm2a-positive cells is at least 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 200-fold, 500-fold, 1000-fold, 2000-fold, 5000-fold, 10,000-fold, 20,000-fold, 50,000-fold, or more.

[0103] The number of cells in culture can be determined by any method known in the art, for example, by using a Coulter counter. Such methods are well known to those skilled in the art.

[0104] In some embodiments, the cells selected in step b) (ie, Itm2a-positive cells) are stored at low temperature (eg, -80°C).

[0105] In some embodiments, the expanded cells are stored at low temperatures (eg, -80° C.) for storage purposes. When needed, the frozen cells are thawed and then, for example, used for implantation into a subject in need thereof.

[0106] In some embodiments, before cryopreservation, the cell suspension is mixed with a cryoprotectant. Methods for cryopreserving tissues and cells at low temperatures with cryoprotectants are well known in the art. Frozen samples can be carried out in the presence of one or more different cryoprotectants to minimize cell damage during freeze-thaw. For example, dimethyl sulfoxide (DMSO), trehalose or sucrose can be used.

[0107] The invention also provides a method for expanding or proliferating Itm2a-positive skeletal stem cells, comprising incubating isolated Itm2a-positive skeletal stem cells in a culture medium. In some embodiments, the method further comprises culturing the Itm2a-positive skeletal stem cells on a biocompatible scaffold, preferably a 3D scaffold.

[0108] In some embodiments, after expansion or proliferation, the number of Itm2a-positive cells is at least 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 200-fold, 500-fold, 1000-fold, 2000-fold, 5000-fold, 10,000-fold, 20,000-fold, 50,000-fold, or more.

[0109] The present invention also provides a kit for isolating skeletal stem cells, comprising an Itm2a binding molecule. In some embodiments, the binding molecule is an anti-Itm2a antibody, such as a monoclonal antibody, or an antigen-binding fragment thereof.

[0110] In some embodiments, the kit further comprises a binding molecule against CD45, CD31 and / or TER119, such as an anti-CD45, anti-CD31 and / or anti-TER119 antibody or an antigen-binding fragment thereof.

[0111] In some embodiments, the skeletal stem cells are mouse cells.In some embodiments, the method further comprises selecting with a binding molecule to 6C3, CD90.2, CD200 and / or CD105, such as an anti-6C3, anti-CD90.2, anti-CD200 and / or anti-CD105 antibody or an antigen-binding fragment thereof.

[0112] In some embodiments, the skeletal stem cells are human skeletal stem cells. In some embodiments, the kit further comprises a binding molecule to CD235, CD146, PDPN, CD73 and / or CD164, such as an anti-CD235, anti-CD146, anti-PDPN, anti-CD73 and / or anti-CD164 antibody or an antigen-binding fragment thereof.

[0113] In some embodiments, the binding molecule is conjugated to solid particles, such as magnetic beads. In some embodiments, the binding molecule is labeled, such as with a fluorescent dye.

[0114] The present invention also provides a method for modifying isolated skeletal stem cells, comprising increasing the level of skeletal stem cell BMP2 protein. In some embodiments, the method includes introducing a BMP2 overexpression vector (e.g., a viral vector, such as rAAV) into the skeletal cells. In some embodiments, the method includes increasing the expression or activity of endogenous BMP2, such as introducing a transcriptional activation system targeting a BMP2 regulatory sequence (e.g., a promoter) (e.g., a transcriptional activation domain (TAD) fused to a sequence-specific DNA binding domain such as a zinc finger domain, TALE, or dCas, or an epigenetic regulatory portion, such as a polypeptide that reduces DNA methylation levels, such as a TET protein or a functional fragment thereof).

[0115] Pharmaceutical composition

[0116] The present invention provides a pharmaceutical composition comprising:

[0117] i) isolated skeletal stem cells, wherein the skeletal stem cells are Itm2a positive; and

[0118] ii) a pharmaceutically acceptable carrier.

[0119] In some embodiments, the pharmaceutical composition comprises a population enriched for Itm2a-positive skeletal stem cells, i.e., the population comprises primarily Itm2a-positive SSCs (e.g., at least 60%, 70%, 80%, 90% or more). In some embodiments, the population comprises few Itm2a-negative cells, or no Itm2a-negative cells.

[0120] In some embodiments, the skeletal stem cells are Lin- (ie, CD45 / CD31 / TER119 negative) cells (CD45-CD31-TER119- cells).

[0121] In some embodiments, the skeletal stem cells are mouse skeletal stem cells. In some embodiments, the skeletal stem cells are CD200 positive (CD200+) cells. In some embodiments, the skeletal stem cells are Ctsk positive (Ctsk+) cells. In some embodiments, the skeletal stem cells are CD105 negative (CD105-) cells. In some embodiments, the skeletal stem cells are 6C3 negative (6C3-) cells. In some embodiments, the skeletal stem cells are CD90.2 negative (CD90.2-) cells. In some embodiments, the mouse skeletal stem cells are CD200+CD105- cells. In some embodiments, the mouse skeletal stem cells are CD200+Ctsk+CD105- cells. In some embodiments, the mouse skeletal stem cells are 6C3-CD90.2-CD200+CD105- cells. In some embodiments, the mouse skeletal stem cells are Lin-6C3-CD90.2-CD200+CD105- cells.

[0122] In some embodiments, the skeletal stem cells are human skeletal stem cells. In some embodiments, the skeletal stem cells are CD45 negative (CD45-) cells. In some embodiments, the skeletal stem cells are CD235 negative (CD235-) cells. In some embodiments, the skeletal stem cells are CD146 negative (CD146-) cells. In some embodiments, the skeletal stem cells are PDPN positive (PDPN+) cells. In some embodiments, the skeletal stem cells are CD73 positive (CD73+) cells. In some embodiments, the skeletal stem cells are CD164 positive (CD164+) cells. In some embodiments, the human skeletal stem cells are CD45-CD235-CD146-PDPN+CD73+CD164+ cells.

[0123] In some embodiments, the skeletal stem cells have the ability to differentiate into osteoblasts.

[0124] In some embodiments, the skeletal stem cell population is self-renewing and clonogenic.

[0125] In some embodiments, the skeletal stem cells are enriched from a bone tissue sample.

[0126] In some embodiments, the skeletal stem cell population is expanded ex vivo.

[0127] In some embodiments, the pharmaceutical composition is formulated for local administration, eg, local administration at the site of a bone fracture.

[0128] In some embodiments, the pharmaceutical composition comprises a 3D culture of the skeletal stem cell population. The 3D culture can be obtained by culturing the skeletal stem cell population on a biocompatible 3D tissue scaffold.

[0129] In some embodiments, the pharmaceutical composition is formulated as a gel.

[0130] The composition may comprise additional bioactive agents, including but not limited to pharmaceutically active compounds, hormones, growth factors, enzymes, DNA, RNA, siRNA, hyaluronic acid, antibodies, antibiotics, anti-inflammatory molecules or combinations thereof. In some embodiments, the bioactive agent comprises BMP2 or an isolated polynucleotide (such as mRNA) or expression vector encoding BMP2.

[0131] In some embodiments, the bioactive agent comprises "pro-angiogenic factors" including, but not limited to, epidermal growth factor (EGF), E-cadherin, VEGF, angiogenic proteins, angiopoietin-1, fibroblast growth factor (FGF, including aFGF and bFGF), hepatocyte growth factor (HGF), angiogenin, insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), transforming growth factor-α (TGF-α), transforming growth factor-β (TGF-β), and inflammatory cytokines and chemokines (which are inducers of angiogenesis and increased blood vessel formation), for example, interleukin-3 (IL-3), interleukin-8 (IL-8), CCL2 (MCP-1), interleukin-8 (IL-8), and CCL5 (RANTES).

[0132] Treating bone injuries or defects

[0133] The present invention provides a method for treating a bone injury or defect, such as a bone fracture, in a subject in need thereof, the method comprising

[0134] a) providing a cell pool from bone tissue;

[0135] b) selecting Itm2a-positive cells from the cell pool derived from bone tissue;

[0136] c) expanding the cells selected in step b) in culture; and

[0137] d) administering the cells expanded in step c) to the subject in need thereof.

[0138] In some embodiments, the bone tissue is bone tissue from a subject in need thereof. In some embodiments, the bone tissue is allogenic bone tissue. In some embodiments, the subject in need thereof is a human, including adolescents, adults, and the elderly. In some embodiments, the bone tissue is periosteum.

[0139] In some embodiments, the method further comprises enzymatically digesting the bone tissue, e.g., eliminating non-cellular structures in the tissue, to obtain a pool of cells from the bone tissue. In some embodiments, the method further comprises removing red blood cells, e.g., lysing the red blood cells. In some embodiments, the method further comprises filtering to remove cell aggregates.

[0140] In some embodiments, the method further comprises selecting Lin- (ie, CD45 / CD31 / TER119 negative) cells (CD45-CD31-TER119- cells).

[0141] In some embodiments, the skeletal stem cells are mouse cells. In some embodiments, the method further comprises selecting CD200 positive (CD200+) cells. In some embodiments, the method further comprises selecting Ctsk positive (Ctsk+) cells. In some embodiments, the method further comprises selecting CD105 negative (CD105-) cells. In some embodiments, the method further comprises selecting 6C3 negative (6C3-) cells. In some embodiments, the method further comprises selecting CD90.2 negative (CD90.2-) cells. In some embodiments, the method further comprises selecting CD200+CD105- cells. In some embodiments, the method further comprises selecting CD200+Ctsk+CD105- cells. In some embodiments, the method further comprises selecting 6C3-CD90.2-CD200+CD105- cells. In some embodiments, the method further comprises selecting Lin-6C3-CD90.2-CD200+CD105- cells.

[0142] In some embodiments, the skeletal stem cells are human skeletal stem cells. In some embodiments, the method further comprises selecting CD45 negative (CD45-) cells. In some embodiments, the method further comprises selecting CD235 negative (CD235-) cells. In some embodiments, the method further comprises selecting CD146 negative (CD146-) cells. In some embodiments, the method further comprises selecting PDPN positive (PDPN+) cells. In some embodiments, the method further comprises selecting CD73 positive (CD73+) cells. In some embodiments, the method further comprises selecting CD164 positive (CD164+) cells. In some embodiments, the method further comprises selecting CD45-CD235-CD146-PDPN+CD73+CD164+ cells. In some embodiments, the method further comprises selecting Lin-CD235-CD146-PDPN+CD73+CD164+ cells.

[0143] In some embodiments, step b) comprises selecting with a binding molecule directed against Itm2a. In some embodiments, the binding molecule is an anti-Itm2a antibody, such as a monoclonal antibody, or an antigen-binding fragment thereof.

[0144] In some embodiments, the method further comprises selecting with a binding molecule against CD45, CD31 and / or TER119, such as an anti-CD45, anti-CD31 and / or anti-TER119 antibody or an antigen-binding fragment thereof.

[0145] In some embodiments, the skeletal stem cells are mouse cells.In some embodiments, the method further comprises selecting with a binding molecule to 6C3, CD90.2, CD200 and / or CD105, such as an anti-6C3, anti-CD90.2, anti-CD200 and / or anti-CD105 antibody or an antigen-binding fragment thereof.

[0146] In some embodiments, the skeletal stem cells are human skeletal stem cells. In some embodiments, the method further comprises selecting with a binding molecule to CD235, CD146, PDPN, CD73 and / or CD164, such as an anti-CD235, anti-CD146, anti-PDPN, anti-CD73 and / or anti-CD164 antibody or antigen-binding fragment thereof.

[0147] In some embodiments, the binding molecule is conjugated to solid particles, such as magnetic beads. In some embodiments, the binding molecule is labeled, such as with a fluorescent dye.

[0148] In some embodiments, step b) comprises selection by flow cytometry.In some embodiments, step b) comprises selection by magnetic selection.

[0149] In a specific embodiment, the method comprises: obtaining periosteum (e.g., 1 cm×1 cm) from a subject; digesting the periosteum with collagenase to obtain single cells; collecting the single cells by centrifugation and preparing a suspension containing the single cells; optionally, filtering the suspension to remove cell aggregates; incubating the cells with an anti-Itm2a antibody; and isolating cells bound to the antibody.

[0150] In some embodiments, after amplification, the number of Itm2a-positive cells is at least 5 times, 10 times, 20 times, 50 times, 100 times, 200 times, 500 times, 1000 times, 2000 times, 5000 times, 10,000 times, 20,000 times, 50,000 times or more. The number of cells in the culture can be determined by any method known in the art, for example, by utilizing a Coulter counter. These methods are well known to those skilled in the art.

[0151] In some embodiments, the cells selected in step b) (ie, Itm2a-positive cells) are stored at low temperature (eg, -80°C).

[0152] In some embodiments, step c) comprises culturing the cells on a biocompatible scaffold, preferably a 3D scaffold.

[0153] In some embodiments, the expanded cells are stored at low temperatures (eg, -80°C) for storage purposes. When needed, the frozen cells are thawed and then implanted into a subject in need.

[0154] In some embodiments, before cryopreservation, the cell suspension is mixed with a cryoprotectant. Methods for cryopreserving tissues and cells at low temperatures with cryoprotectants are well known in the art. Frozen samples can be carried out in the presence of one or more different cryoprotectants to minimize cell damage during freeze-thaw. For example, dimethyl sulfoxide (DMSO), trehalose or sucrose can be used.

[0155] In some embodiments, the expanded cells are administered locally at the site of a fracture or bone defect. In some embodiments, the cells are administered in the form of a gel. The cells can be administered in combination with additional bioactive agents, including but not limited to pharmaceutically active compounds, hormones, growth factors, enzymes, DNA, RNA, siRNA, hyaluronic acid, antibodies, antibiotics, anti-inflammatory molecules, or combinations thereof.

[0156] In some embodiments, the bioactive agent comprises "pro-angiogenic factors" including, but not limited to, epidermal growth factor (EGF), E-cadherin, VEGF, angiogenic proteins, angiopoietin-1, fibroblast growth factor (FGF, including aFGF and bFGF), hepatocyte growth factor (HGF), angiogenin, insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), transforming growth factor-α (TGF-α), transforming growth factor-β (TGF-β), and inflammatory cytokines and chemokines (which are inducers of angiogenesis and increased blood vessel formation), for example, interleukin-3 (IL-3), interleukin-8 (IL-8), CCL2 (MCP-1), interleukin-8 (IL-8), and CCL5 (RANTES).

[0157] In some embodiments, the method further comprises modifying the isolated skeletal stem cells to increase the level of BMP2 protein. In some embodiments, the method comprises introducing a BMP2 overexpression vector (e.g., a viral vector, such as rAAV) into the skeletal cells. In some embodiments, the method comprises increasing the expression or activity of endogenous BMP2, such as introducing a transcriptional activation system targeting a BMP2 regulatory sequence (e.g., a promoter) (e.g., a transcriptional activation domain (TAD) fused to a sequence-specific DNA binding domain such as a zinc finger domain, TALE, or dCas, or an epigenetic regulatory portion, such as a polypeptide that reduces DNA methylation levels, such as a TET protein or a functional fragment thereof).

[0158] The present invention also provides a method of treating bone damage or defects, such as bone fractures, in a subject in need thereof, comprising administering to the subject in need thereof a pharmaceutical composition of the present invention.

[0159] In some embodiments, the pharmaceutical composition is administered locally at the fracture site.

[0160] In some embodiments, the skeletal stem cells are autologous or allogeneic to the subject in need thereof.

[0161] The present invention also provides an enriched isolated Itm2a-positive skeletal stem cell population or a pharmaceutical composition comprising the population for treating bone injuries or defects, such as fractures, in a subject in need thereof.

[0162] The present invention also provides the use of an enriched isolated Itm2a-positive skeletal stem cell population or a pharmaceutical composition containing the population in the preparation of a medicament for treating bone injuries or defects, such as fractures, in a subject in need.

[0163] The present invention also provides a method for screening drugs for treating bone injuries or defects, such as bone fractures, comprising:

[0164] i) contacting the compound with Itm2a-positive skeletal stem cells, for example, culturing the skeletal stem cells in a culture medium containing the compound;

[0165] ii) detecting the growth and / or differentiation of the skeletal stem cells;

[0166] iii) comparing the growth and / or differentiation of skeletal stem cells to that of a control; and

[0167] iv) selecting compounds that promote the growth and / or differentiation of said skeletal stem cells.

[0168] The control skeletal stem cells are Itm2a-positive skeletal stem cells that have not been contacted with the compound. The compound can be a small molecule compound or a protein. In some embodiments, the differentiation is osteogenic differentiation. In some embodiments, the detection in step ii) includes in vitro detection and / or in vivo detection. For example, the cells can be cultured in vitro and / or induced to differentiate, and their proliferation capacity and / or osteogenic differentiation capacity can be detected; the skeletal stem cells can also be transplanted into animals to detect their proliferation capacity and / or osteogenic differentiation capacity.

[0169] The present invention also provides a method for screening drugs for treating bone injuries or defects, such as bone fractures, comprising:

[0170] i) contacting a compound with a population of skeletal stem cells, e.g., culturing the population in a culture medium comprising the compound;

[0171] ii) detecting the proportion, proliferation capacity and / or osteogenic differentiation capacity of Itm2a-positive cells in the skeletal stem cell population;

[0172] iii) comparing the proportion of Itm2a-positive cells in a control skeletal stem cell population; and

[0173] iv) Selecting compounds that increase the proportion of Itm2a-positive cells in a skeletal stem cell population.

[0174] The control skeletal stem cell population is a skeletal stem cell that has not been exposed to the compound. The compound can be a small molecule compound or a protein. In some embodiments, the detection in step ii) includes in vitro detection and / or in vivo detection. For example, the cells can be cultured in vitro and / or induced to differentiate, and their proliferation capacity and / or osteogenic differentiation capacity can be detected; the skeletal stem cells can also be transplanted into an animal and their proliferation capacity and / or osteogenic differentiation capacity can be detected.

[0175] The present invention also provides a method for screening drugs for treating bone injuries or defects, such as bone fractures, comprising:

[0176] i) administering the compound to a subject;

[0177] ii) isolating a skeletal stem cell population from the subject, and detecting the proportion, proliferation capacity, and / or osteogenic differentiation capacity of Itm2a-positive skeletal stem cells;

[0178] iii) comparing the proportion, proliferation capacity and / or osteogenic differentiation capacity of Itm2a-positive skeletal stem cells in a skeletal stem cell population isolated from a control subject; and

[0179] iv) selecting compounds that increase the proportion, proliferation capacity and / or osteogenic differentiation capacity of Itm2a-positive cells in a skeletal stem cell population isolated from a subject.

[0180] The control animal is a skeletal stem cell that has not been administered the compound. The compound can be a small molecule compound or a protein. In some embodiments, the testing in step ii) includes in vitro testing and / or in vivo testing. For example, the cells can be cultured in vitro and / or induced to differentiate, and their proliferation capacity and / or osteogenic differentiation capacity can be tested; or the skeletal stem cells can be transplanted into an animal and their proliferation capacity and / or osteogenic differentiation capacity can be tested.

[0181] Beneficial effects of the present invention

[0182] The present invention identifies Itm2a as a molecular marker for sorting and isolating skeletal stem cells. Itm2a-positive skeletal stem cells have excellent proliferation and differentiation capabilities. The molecular markers provided by the present invention enable the use of autologous skeletal stem cells obtained from a patient for transplantation, significantly reducing the risk of rejection during cell / tissue transplantation. Therefore, the present invention provides suitable seed cells for repairing defects in the skeletal system, such as bone tissue. Example

[0183] The following examples are provided for illustration only and are not intended to limit the present invention in any way.

[0184] Example 1. Materials and methods

[0185] 1.1 Experimental Animals

[0186] The mice used in the examples of this application were all of C57BL6 background.

[0187] Itm2a-CreERT-IRES-mCherry (Itm2a-CreER) mice were constructed by Jicui Pharmaceutical Co., Ltd. R26-Ai6 mice, Bmp2 fl / fl The mice and R26-DTA mice were provided by Dr. Zeng Yi from the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences. The Actin-GFP mice were provided by Dr. Zhou Bin from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences.

[0188] Prrx1-Cre mice (purchased from Jackson Lab) were crossed with Rosa26-Ai9 mice (provided by Researcher Qiu Zilong from the Institute of Neurobiology, Chinese Academy of Sciences) to breed Prrx1-Cre;Rosa26-Ai9 mice. At 4 weeks of age, mouse cortical bone cells were digested and isolated, and Ai9-positive cells were sorted for single-cell sequencing.

[0189] Itm2a-CreER mice were crossed with R26-Ai6 mice to breed Itm2a-CreER;R26-Ai6 mice, which were induced with tamoxifen at different ages. The skeletal system of the mice was collected and flow cytometry analysis and frozen sections were performed to observe the labeling of Itm2a in the skeletal system.

[0190] Four-week-old Itm2a-CreER; Rosa26-Ai6 mice were induced with tamoxifen. One week after drug withdrawal, the mice were subjected to fracture injury, and the involvement of Itm2a in endochondral ossification at different time periods after injury was collected.

[0191] Four-week-old Itm2a-CreER; Rosa26-Ai6 mice were induced with tamoxifen. One week after drug withdrawal, Ai6-positive cells in the mouse cortical bone were sorted, wrapped with matrix gel and filled into the subrenal capsule of the mouse to observe the ability of Ai6-positive cells to form heteroosteomalasty under the renal capsule.

[0192] Tamoxifen induction was performed by intraperitoneal injection of 2 mg of tamoxifen dissolved in corn oil, three times with one day intervals for a total of one week.

[0193] 1.2 Antibodies

[0194] The antibodies used in the examples of this application are shown in Tables 1 and 2.

[0195] Table 1. Primary antibodies used in the examples

[0196]

[0197] Table 2. Secondary antibodies used in the examples

[0198]

[0199] 1.3. Periosteal Cell Digestion and Analysis

[0200] C57BL6 mice aged 4-6 weeks were euthanized with CO . The articular cartilage between the pelvis and the femoral head was cut and the mouse hind limbs were isolated. The mouse foot was removed, the femur and tibia were retained, and the muscles were removed. The isolated bones were placed in PBS in a six-well plate, which was placed on ice. In a clean bench, autoclaved low-melting-point agarose (Corning, 356231) was placed in a 6 cm culture dish and wrapped around the two ends of the long bone when the agarose was semi-solid, exposing the diaphysis containing the periosteum.

[0201] The agarose-encapsulated bones were placed in a 15 ml centrifuge tube and 5 ml of digestion solution (α-MEM (Corning, 10-022-CVR) containing 1 mg / ml collagenase (Sigma, C0130), 2 mg / ml dispase II (Sigma, D4693), and 2% penicillin / streptomycin) was added. Digestion was repeated twice in a shaker at 280 rpm for 1 h at 37°C. The supernatant was mixed on ice with 10 ml of pre-chilled C3H10 medium (α-MEM (Corning, 10378-016) containing 10% fetal bovine serum (FBS) (Ausbian, VS500T) and 1% penicillin / streptomycin (Gibco, 10378-016)) to terminate the digestion. The mixture was centrifuged at 1,200 g for 4 min at 4°C, and the supernatant was discarded. Add 5 ml of red blood cell lysis buffer (Beyotime, C3702) and mix well. Lyse at room temperature for 5-10 minutes. After the solution no longer turns red, add 10 ml of C3H10 medium to neutralize the reaction. Centrifuge again at 1,200 g for 5 minutes and discard the supernatant (the white precipitate indicates complete lysis of the red blood cells). Resuspend the precipitate in C3H10 medium and count the cells. Dilute the suspension to 1×10 7 cells / ml, 3 ml of cell solution was added to each well of a 6-well plate and cultured at 37°C.

[0202] The cultured cell suspension was centrifuged at 4°C, 1,300g for 3 minutes and the supernatant was discarded. The pellet was resuspended in 2 ml of flow cytometry buffer (PBS containing 2% FBS), and the suspension was filtered through a 40 μm cell strainer, then centrifuged at 4°C, 1,300g for 3 minutes and the supernatant was discarded. The pellet was resuspended in 2 ml of red blood cell lysis buffer, the suspension was placed on ice for 25 minutes, and then mixed with 5 ml of PBS to terminate the lysis. The mixture was centrifuged at 4°C, 1,300g for 3 minutes and the supernatant was discarded. The pellet was resuspended in 1 ml of flow cytometry buffer, and the cells were counted, and the suspension was diluted to 0.1 to 1×10 7 cells / ml and aliquoted into 100 μl (each containing 0.1 to 1 × 10 6 cells).

[0203] Add antibodies according to the cell number (record the cell number, antibody concentration and volume, 10 6 Each cell was stained in a 100 μl volume (using an antibody concentration of 0.1 μg / mL) on ice for 30 minutes in the dark. Centrifuge at 1,300 g for 5 minutes at 4°C, discard the supernatant, and wash the cells with 1 ml of flow cytometry buffer. Centrifuge at 1,300 g for 5 minutes at 4°C, discard the supernatant, and resuspend the cells in 100 μl of flow cytometry buffer. If the primary antibody is biotinylated, add a streptavidin-conjugated secondary antibody and stain on ice for 20 minutes in the dark. Centrifuge at 700 g for 2 minutes at 4°C, discard the supernatant, and wash the cells with 1 ml of flow cytometry buffer. Centrifuge at 700 g for 2 minutes at 4°C, discard the supernatant, and resuspend the cells in 100 μl of flow cytometry buffer. Detect or sort the cells using a flow cytometer (Arial Sorp Cell Sorter, BD Biosciences).

[0204] 1.4. Fixed Fracture Surgery in Mice

[0205] Mice were anesthetized by intraperitoneal injection of chloral hydrate (400 mg / kg). The anesthetized mice were shaved and prepared on the outside of the right femur, and then wiped with alcohol for disinfection. The skin at the femur was incised, and the soft tissue was bluntly separated using forceps. The patella was moved to expose the femoral condyle, and an intramedullary nail was inserted from the femoral condyle into the femoral medullary cavity for fixation. The muscles in the middle of the femur were bluntly separated using forceps to expose the femur, and the femur was transected in the middle of the femur using a dental drill. The intramedullary nail was retained to fix the femur, and the muscles and femur were sutured separately. The mice were placed in a warm cage and, after waking up, transferred to an IVC cage for culture. The fracture repair status of the mice was observed weekly by X-ray (Faxtrion, USA, model MX-20, exposure 6 seconds) after surgery.

[0206] 1.5. Subrenal capsule transplantation experiment

[0207] The cell suspension was centrifuged and the supernatant was discarded. The cells were resuspended in less than 10 μl of Matrigel (Corning, 356231) on ice (Matrigel melts at about 0°C and solidifies at -20°C or room temperature 23-25°C).

[0208] The mice were weighed and anesthetized by injection of 2% chloral hydrate (20x + 50 μl for mice weighing x g). The anesthetized mice were shaved at the surgical site and transferred to a foam pad. The mice were fixed in lateral recumbency and the skin was disinfected with 70% ethanol and iodine. Using scissors and tweezers, a 1 cm incision was made in the skin parallel to the spine and the skin was separated from the abdominal wall by blunt dissection. The kidneys can be observed through the body wall adjacent to the spleen. The body wall was lifted with tweezers and an incision was made that was smaller than the kidney (5-8 mm). The kidney was gently protruded through the incision through the abdominal wall by massaging the surrounding abdominal wall. The kidneys were kept moist with warm sterile PBS. A shallow 1-2 mm incision was made on the surface of the renal capsule on the side of the kidney using the bevel of a 31-gauge sterile needle.

[0209] Use a microsyringe to draw up the Matrigel-cell mixture and inject it into the renal capsule through the cannula over the indwelling needle. Once the mixture solidifies, remove the needle. Return the kidney to the peritoneal cavity by lifting the body wall. Add 1 ml of PBS to the peritoneal cavity to prevent postoperative dehydration. Suture the muscle layer with 4-0 absorbable sutures and the skin with 4-0 silk sutures. Clean and disinfect.

[0210] Mice were kept at 37°C until awake, transferred to new cages, and inspected for wounds daily. After at least 4 weeks of maintenance, mice were sacrificed using CO2 and analyzed for grafts.

[0211] 1.6 Immunofluorescence on frozen sections

[0212] Select mouse frozen sections with equivalent section positions (sections with a thickness of 12-16 μm obtained by Leica CM3050S cryostat), place them in a sterile staining box (up to three sections per box, with the same orientation), wash them three times with PBS, each for 5 minutes, and then discard the PBS.

[0213] Perform antigen retrieval according to the following protocol:

[0214] Method 1: Place the sections in boiling antigen retrieval solution (0.01M sodium citrate buffer, pH 6.0) in a pressure cooker with the lid closed. Maintain high pressure for 10 minutes, turn off the power and keep warm for 10 minutes, then vent and allow to cool naturally.

[0215] Option 2: Place the slices in antigen retrieval solution (0.01 M sodium citrate buffer, pH 6.0) preheated at 95°C and incubate for 20 minutes, then cool naturally (suitable for antibodies that are easy to make on bone slices).

[0216] Solution 3: Proteinase K repair, 10 μg / ml proteinase K solution (50 mM Tris-HCl, 5 mM EDTA, pH 8.0), digestion at 37°C for 15 min (suitable for bone slices of older rats that are prone to detachment).

[0217] After antigen retrieval, wash the sections three times with PBS for 10 minutes each. Remove excess liquid from the slides and block the sections with approximately 50 μl of blocking solution (10% horse serum (Gibco, 16050122) in PBS) for 45 minutes at room temperature. Dilute the primary antibody in antibody diluent (5% horse serum in PBS) (select the optimal dilution for each antibody through a series of dilutions; for example, anti-SOX9 should be diluted at 1:2000) and incubate with the sections (approximately 30-50 μl per section) overnight at 4°C. Wash the sections three times with PBS for 10 minutes each. Dilute the secondary antibody in antibody diluent (for example, goat anti-rabbit Cy3 at a 1:1000 dilution) and incubate with the sections at room temperature for 1 hour in the dark. Wash the sections twice with PBS for 10 minutes each, protected from light. Stain with DAPI (1 μg / ml diluted 1:1000 in PBS) for 10 minutes in the dark. Wash the sections twice with PBS for 10 minutes each, protected from light. Each section was mounted with approximately 50 μl of Mowiol mounting medium, allowed to dry, and then sealed with nail polish. The sections were imaged using a laser confocal / fluorescence microscope (FV3000 confocal microscope and BX51 fluorescence microscope, Olympus).

[0218] 1.7 Histological staining (Safranin fast green staining)

[0219] Reagents: 0.05% fast green solution: 0.05 g fast green (Shanghai Jinsui, JS11367) dissolved in 100 ml ddH2O;

[0220] 1% acetic acid differentiation solution: 1 ml glacial acetic acid dissolved in 99 ml ddH2O; and

[0221] 0.5% Safranin O staining solution: 0.5 g Safranin O (Sigma, S2255) was dissolved in 100 ml ddH2O.

[0222] Sections were dewaxed and hydrated, then stained in 0.05% Fast Green for 1.5 minutes. Next, they were treated with acetic acid for 10 seconds and then stained in 0.5% Safranin O for 1 minute. The sections were then differentiated in 95% ethanol for several seconds, rinsed in running water, cleared with xylene, and mounted with neutral gum.

[0223] Example 2: Single-cell sequencing of mouse Prrx1-Cre+ periosteum

[0224] The purpose of this example was to identify the true SSC population among Prrx1 lineage periosteal cells.

[0225] Periosteal cells were obtained from 4-week-old Prrx1-Cre; Rosa26-Ai9 male mice, and Ai9-positive periosteal cells were sorted for single-cell RNA sequencing (scRNA-seq). Specifically, as described in Example 1, after agarose coating, collagenase digestion, and red blood cell lysis, Ai9-positive cells were sorted by flow cytometry, and then scRNA-seq analysis was performed using the 10X Genomics platform ( Figure 1 A) Code filtering was performed in R-studio software to remove cells with CD45 expression levels above 0. Data from 2169 CD45-negative single cells were obtained from the sequencing results for subsequent analysis.

[0226] The Prrx1-Cre lineage cells obtained by sequencing were comprehensively analyzed, and 13 cell subpopulations were presented using the t-SNE dimensionality reduction method ( Figure 1 B). These include periosteal stem / progenitor cells (subpopulations 0, 1, 2, 3, 7, and 10 expressing Col3a1 and Itgbl1, Figure 1 C). In addition to periosteal stem / progenitor cells, osteoblasts (cell subpopulations 4 and 12, expressing Sp7 and Bglap), muscle cells (cell subpopulations 9 and 11, expressing Pax7 and Myob5), endothelial cells (cell subpopulations 3, 6, and 8, expressing Emcn and Pecam1) were also identified. Figure 1 DF).

[0227] Next, we analyzed the heterogeneity of Prrx1-Cre lineage cells and found that there were three cell states, and pseudo-time analysis of these three states showed a trajectory from state 2 (cell subpopulations 0, 1, 2, 3, 7, and 10) to state 1 and state 3 ( Figure 1 G and H). t-SNE plots showing the distribution of SSC markers (CD105 and CD200) and other classical skeletal precursor cell markers in Prrx1-Cre lineage cells ( Figure 2 A and B), based on the consistency of surface molecular markers with SSC, cell subpopulation 1 was defined as the periosteal skeletal stem cells (P-SSC) ( Figure 2 C).

[0228] Periosteal cells were stained with anti-surface molecule antibodies and the proportion of SSC in mouse periosteum was analyzed by flow cytometry. It was found that Itm2a could greatly enrich periosteal SSC (SSC accounted for 34.24% ± 1.3% in Itm2a-positive cells and 3.56 ± 0.44% in Itm2a-negative cells) ( Figure 2 D and E).

[0229] Example 3: Membrane protein ITM2A is a good SSC sorting marker

[0230] The purpose of this example is to identify the membrane protein characteristics of ITM2A and the effect of SSC sorting.

[0231] 3.1. Using pHAGE-GFP vector (Addgene, #106281) as the backbone, expression vectors encoding mouse Itm2a (mItm2a, encoded by SEQ ID NO: 1) and human ITM2A (hITM2A, encoded by SEQ ID NO: 2) fused with EGFP (encoded by SEQ ID NO: 3) were constructed. The constructed vectors were transfected (see Suo et al., VGLL4 promotes osteoblast differentiation by antagonizing TEADs-inhibitedRunx2 transcription, Sci Adv. 2020 Oct 23; 6(43): eaba4147) into 293 cells. Immunofluorescence analysis of the transfected cells revealed that the ITM2A protein could colocalize well with the cell membrane marker Dil ( Figure 3 A).

[0232] 3.2. Periosteal cells were harvested from 4-week-old wild-type mice. Lin-Itm2a- and Lin-Itm2a+ cells were sorted and subjected to colony-forming unit (CFU-F) assay (see Han et al., Lkb1 deletion in periosteal mesenchymal progenitors induces osteogenic tumors through mTORC1 activation. J Clin Invest. 2019 May 1; 129(5): 1895-1909). A higher CFU-F capacity ( Figure 3 B and C). Both Lin-Itm2a- and Lin-Itm2a+ cells showed chondrocyte, adipocyte, and osteoblast clonal multipotency in vitro ( Figure 3 D).

[0233] In view of the finding in Example 2 that Itm2a can greatly enrich periosteum SSCs, the stem cell properties of Lin-6C3-CD90.2-CD105-CD200+Itm2a+ (hereinafter referred to as Itm2a-positive SSCs) and Lin-6C3-CD90.2-CD105-CD200+Itm2a- (hereinafter referred to as Itm2a-negative SSCs) were further compared.

[0234] Specifically, the stem cell properties of Itm2a-positive SSCs were verified by transplanting the cells into the bone drill injury site and under the renal capsule ( Figure 4 A). Actin-GFP mice (expressing GFP under the actin promoter) were used as the source of cells for bone drilling and subrenal capsule transplantation models. This allowed for accurate assessment of cell proliferation and differentiation after transplantation, as well as differentiation from the recipient mouse's own cells. GFP-labeled Itm2a-negative and Itm2a-positive SSCs were sorted and then mixed with Matrigel. Matrigel-encapsulated cells were injected into the cortical drilling site of the femoral diaphysis ( Figure 4 A). μ-CT analysis (SkyScan 1272, Bruker) of the femurs of mice 7 days after transplantation showed that the wound healing progressed better in mice injected with Itm2a-positive SSCs ( Figure 4 B and C). At the same time, immunofluorescence staining using anti-osteopontin (OPN, an osteoblast marker) antibodies in frozen sections of femurs 7 days after transplantation showed that the co-localization of GFP and OPN was higher in mice injected with Itm2a-positive SSCs, indicating that Itm2a-positive SSCs exhibited stronger osteogenic potential in vitro ( Figure 4 D). We also transplanted single-cell clones derived from GFP-positive cells beneath the renal capsule of 7- to 8-week-old recipient mice. As assessed by μ-CT and OPN immunofluorescence staining, Itm2a-positive SSCs exhibited significantly higher osteoid-forming capacity compared to Itm2a-negative SSCs ( Figure 4 E to G).

[0235] Example 4: Skeletal Stem Cell Lineage Evolution Ability of Itm2a-Positive Periosteal Skeletal Stem Cells

[0236] The purpose of this example is to verify whether Itm2a-positive periosteal skeletal stem cells have the ability to evolve into the entire skeletal stem cell lineage.

[0237] Flow cytometric analysis of bone organoids formed under the renal capsule showed that Itm2a-positive SSCs were able to reconstitute their entire skeletal stem cell lineage in vitro and maintain their self-renewal capacity after transplantation, indicating their stemness characteristics ( Figure 5A and B). In summary, Itm2a-positive SSCs are at the top of the periosteum skeletal stem cell lineage evolutionary tree and have the ability to self-renew and differentiate into downstream skeletal stem cell lineages. In contrast, Itm2a-negative SSCs do not have the ability to differentiate into Itm2a-positive cells and have a weaker ability to evolve into downstream cell populations.

[0238] Example 5: ITM2A-positive stem cells in human periosteum samples

[0239] The purpose of this example is to identify the ITM2A-positive stem cell population in human periosteum samples.

[0240] Human periosteum samples were obtained from clinical Figure 6 A). Immunofluorescence staining of histological sections of periosteum samples revealed that, like mice, there was also an ITM2A-positive periosteal cell population in human periosteum samples ( Figure 6 B) Single-cell suspensions of human periosteum samples were obtained by enzymatic digestion, and then stained with antibodies for human skeletal stem cell markers (CD45-CD235-CD146-PDPN+CD73+CD164+) and ITM2A, followed by flow cytometry analysis. The results showed that approximately 60.3% of the skeletal stem cells in the human periosteum samples were ITM2A-positive, indicating that ITM2A can effectively enrich the skeletal stem cell population in human periosteum samples ( Figure 6 C).

[0241] Example 6: Function of ITM2A cells in human periosteum

[0242] The purpose of this example is to identify the function of ITM2A cells in human periosteum.

[0243] ITM2A-positive cells isolated and sorted from human periosteum samples were cultured. In a trilineage differentiation experiment in vitro (see Han et al., 2019 above), ITM2A-positive cells showed stronger osteoblast differentiation ability and weaker chondrogenic differentiation ability ( Figure 7 A), which also supports the observation results in mice, Itm2a-positive cells play an important role in the fracture injury process, especially in the ossification and repair of bone ends by osteoblasts.

[0244] The colony forming capacity (CFU-F) assay was performed on ITM2A-negative and ITM2A-positive cells, and a higher CFU-F ( Figure 7 B and C). At the same time, ITM2A-positive cells also showed stronger bone organoid formation ability in the transplantation experiment under the renal capsule ( Figure 7 D and E).

[0245] Example 7: Distribution and Function of Itm2a-Positive P-SSCs in Vivo

[0246] The purpose of this example is to study the distribution and function of Itm2a-labeled P-SSCs in vivo.

[0247] To this end, the CreERT-IRES-mCherry element (SEQ ID NO: 4, 5 and 6) was inserted after the promoter of the Itm2a gene using CRISPR technology to construct Itm2a-CreERT-IRES-mCherry mice (hereinafter referred to as Itm2a-CreER mice) ( Figure 8 A) This mouse can indicate real-time Itm2a gene expression through the expression of the red fluorescent protein mCherry. It can also track Itm2a-positive cells and their progeny cells in vivo after specific tamoxifen induction time points. Furthermore, it can track the cell fate transition of Itm2a-positive cells in vivo through co-localization with immunofluorescence staining using specific antibodies.

[0248] To perform lineage tracing experiments using Itm2a-CreER mice, Itm2a-CreER mice were crossed with R26-LSL-ZsGreen mice (also known as R26-Ai6, i.e., Ai6 fluorescent reporter mice that express ZsGreen green fluorescent protein after Cre enzyme-mediated recombination) to obtain Itm2a-CreER;R26-Ai6 mice.

[0249] Immunofluorescence analysis of frozen sections of 4-week-old Itm2a-CreER;R26-Ai6 mice 2 days after tamoxifen injection showed that Itm2a-CreER could specifically label periosteal cells, but rarely labeled bone marrow cells ( Figure 8 B). This has a great advantage over the previously identified stem cell markers for bone cells. At the same time, through co-localization analysis of osteoblasts and stem cell markers after antibody staining, Itm2a-CreER-labeled periosteal cells highly expressed CD200, but did not express the osteoblast marker OPN ( Figure 8 C and D).

[0250] Next, 2 days after tamoxifen injection in 4-week-old Itm2a-CreER; R26-Ai6 mice, the proportion of SSC lineage in periosteal cells was detected by flow cytometry. The data showed that Itm2a-CreER positive cells were enriched for a higher proportion of skeletal stem cells (24.6% ± 1.1% vs. 3.88 ± 0.76%). Figure 8 E).

[0251] Example 8: Effect of Itm2a-positive cells on fracture repair

[0252] The purpose of this example is to further study the in vivo regenerative ability of Itm2a-positive SSCs and verify that Itm2a-positive SSCs can participate in the repair of fracture injuries.

[0253] 8.1. Itm2a-positive SSCs can participate in fracture repair

[0254] Fracture injury models were established in Itm2a-CreER; R26-Ai6 mice to determine the involvement of Itm2a-positive SSCs in the repair process. Specifically, 4-week-old Itm2a-CreER; R26-Ai6 mice were first induced with tamoxifen to fully label Itm2a lineage cells. One week after the last tamoxifen injection, fracture injury models were established, and samples were collected 3, 7, and 14 days after injury for section analysis. Figure 9 A). Three days after fracture injury, a significant increase in ZsGreen-positive cells in the periosteum was observed, and Itm2a-positive cells were clearly involved in the periosteal reaction ( Figure 9 B) Based on the staining of chondrocyte, osteoblast and bone marrow stromal cell markers and confocal microscopy imaging of callus samples at different time points after fracture, it was found that Itm2a lineage cells (labeled by green fluorescence) were able to form approximately 37.4% COL2A1-positive chondrocytes, approximately 56.6% OPN-positive osteoblasts and approximately 12.6% LepR-positive bone marrow stromal cells within the fracture callus ( Figure 9 C to F). These data indicate that Itm2a-lineage cells have the ability to remodel bone after fracture.

[0255] 8.2. Bmp2 knockout in Itm2a lineage cells leads to impaired fracture repair

[0256] Lin-Itm2a- and Lin-Itm2a+ cells in the periosteum of mice were sorted by flow cytometry and sequenced by bulk-RNAseq (10X Genomics) (R-studio). The results showed that the upregulated genes in Lin-Itm2a+ cells were enriched in genes related to tissue damage repair and the BMP signaling pathway. The ossification and angiogenesis signaling pathways that are crucial for fracture healing were also enriched in Lin-Itm2a+ cells ( Figure 10 A). BMP2 is one of the key components of the BMP signaling cascade in fracture callus tissue. Bmp2 is essential for bone development and fracture healing. In the heat map analysis of genes in the BMP signaling pathway, we found that Bmp2 also has a consistent enrichment trend ( Figure 10B) Previous studies have tested whether Bmp2 knockout in bone cells can lead to impaired fracture repair, but no studies have yet investigated whether Bmp2 also plays an important role in periosteum-derived skeletal stem cells. To test this, 4-week-old Itm2a-CreER; Bmp2 fl / fl Mice (provided Itm2a-CreER mice and Bmp2 fl / fl Bmp2f l / fl Mice were induced with tamoxifen, and fracture models were established one week after the last injection. Samples were collected 7 days, 14 days, and 21 days after injury to observe callus formation during fracture recovery and evaluate the repair of fracture injuries. Figure 10 C). X-ray examination (once a week for three weeks) revealed that, as expected, Itm2a-CreER; Bmp2 fl / fl Mice show impairment of hard callus formation during fracture healing ( Figure 10 D and E). In the results of μ-CT analysis and histological staining (Safranin Fast Green staining) of sections on day 14 after fracture, good hard callus formation was observed in control mice, while in Itm2a-CreER; Bmp2 fl / fl More tissue in the callus of mice showed μ-CT negative cartilage-like tissue ( Figure 10 F and G), indicating that loss of Bmp2 function in Itm2a-lineage cells leads to abnormalities in the entire fracture injury repair process.

[0257] 8.3 Elimination of Itm2a-lineage cells leads to impaired fracture repair

[0258] Itm2a-CreER mice were crossed with R26-DTA mice to obtain Itm2a-positive cells that could clear the periosteum after tamoxifen induction ( Figure 11 B) mice. Tamoxifen was induced in 4-week-old mice, and femoral fracture surgery was performed one week after the last injection ( Figure 11 A). As assessed by μ-CT and histological staining (Safranin Fast Green staining), Itm2a-CreER;R26-DTA mice exhibited a nonunion phenotype, commonly known as a nonunion, with a decrease in Itm2a+ cells and an increase in the nonunion rate at 28 days post-fracture (28 dpf). Figure 11 C and D). Based on the above data, Itm2a-positive periosteal cells play an important role in the repair of fracture injury, especially in hard callus formation and bone healing, and this process is related to the BMP signaling pathway.

[0259] sequence

[0260] SEQ ID NO:1 Mouse Itm2a nucleotide sequence

[0261] ATGGTGAAGATCGCCTTCAACACCCCTACGGCGGTGCAAAAGGAGGAGGCGCGGCAAGATGTAGAGGCGCTCGTCAGTCGCACTGTCCGAGCTCAAATCCTGACTGGCAAGGAGCTCAGAGTTGTCCCGCAGGAGAAAGATGGCTCATCTGGGAGATGCATGCTTACTCTCCTAGGCCTCTCATTCATCTTGGCAGGACTGATTGTTGGTGGAGCCTGCATTTACAAGTACTTCATGCCCAAGAGCACCATTTACCATGGTGAGATGTGCTTCTTTGATTCTGAGGATCCTGTCAATTCCATTCCTGGAGGAGAGCCATACTTTCTGCCTGTGACTGAGGAGGCTGATATCCGTGAGGATGACAACATTGCCATCATTGATGTGCCTGTGCCCAGTTTCTCTGATAGCGATCCGGCGGCAATTATTCACGACTTTGAGAAGGGAATGACTGCTTACCTGGACTTGCTTTTGGGAAACTGTTATCTGATGCCCCTCAATACTTCCATTGTTATGACTCCAAAGAATCTGGTGGAACTTTTTGGAAAACTGGCAAGTGGCAAGTATTTGCCTCATACTTATGTGGTTCGTGAAGACCTGGTTGCTGTGGAAGAAATTCGTGATGTTAGTAACCTTGGTATTTTTATTTACCAACTTTGCAACAACCGAAAATCCTTCCGCCTTAGACGCAGAGACCTTCTGCTGGGTTTCAACAAGCGTGCCATTGACAAATGCTGGAAGATTAGACACTTCCCCAATGAATTTATCGTTGAAACCAAGATCTGTCAGGAGTGA

[0262] SEQ ID NO: 2 Human ITM2A nucleotide sequence

[0263] ATGGTGAAAATCGCCTTCAATACCCCTACCGCCGTGCAAAAGGAGGAGGCGCGGCAAGACGTGGAGGCCCTCCTGAGCCGCACGGTCAGAACTCAGATACTGACCGGCAAGGAGCTCCGAGTTGCCACCCAGGAAAAAGAGGGCTCCTCTGGGAGATGTATGCTTACTCTCTTAGGCCTTTCATTCATCTTGGCAGGACTTATTGTTGGTGGAGCCTGCATTTACAAGTACTTCATGCCCAAGAGCACCATTTACCGTGGAGAGATGTGCTTTTTTGATTCTGAGGATCCTGCAAATTCCCTTCGTGGAGGAGAGCCTAACTTCCTGCCTGTGACTGAGGAGGCTGACATTCGTGAGGATGACAACATTGCAATCATTGATGTGCCTGTCCCCAGTTTCTCTGATAGTGACCCTGCAGCAATTATTCATGACTTTGAAAAGGGAATGACTGCTTACCTGGACTTGTTGCTGGGGAACTGCTATCTGATGCCCCTCAATACTTCTATTGTTATGCCTCCAAAAAATCTGGTAGAGCTCTTTGGCAAACTGGCGAGTGGCAGATATCTGCCTCAAACTTATGTGGTTCGAGAAGACCTAGTTGCTGTGGAGGAAATTCGTGATGTTAGTAACCTTGGCATCTTTATTTACCAACTTTGCAATAACAGAAAGTCCTTCCGCCTTCGTCGCAGAGACCTCTTGCTGGGTTTCAACAAACGTGCCATTGATAAATGCTGGAAGATTAGACACTTCCCCAACGAATTTATTGTTGAGACCAAGATCTGTCAAGAGTAA

[0264] SEQ ID NO:3 EGFP nucleotide sequence

[0265]

[0266] SEQ ID NO:4 Cre-ERT element

[0267] CAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCCCGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCTGGTGGCTGGACCAATGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCTGGAAGATGGCGATCTCGAGCCATCTGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCAAACGCTCTAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTGGATGCTGAGCCCCCCATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCTTCGATGATGGGCTTACTGACCAACCTGGCAGACAGGGAGCTGGTTCACATGATCAACTGGGCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCATGATCAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCACCCAGTGAAGCTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGCATGGTGGAGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTGCAGGGAGAGGAGTTTGTGTGCCTCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACATTTCTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGGACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTGCAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCATGGAGCATCTGT

[0268] SEQ ID NO:5 IRES element

[0269] CTCCCTTTATCCAGCCCTCACTCCTTCTCTAGGCGCCGGAATTAGATCTCTCGAGGTTAACGAATTCTGCTATACGAAGTTATCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAGAACACGATGATAATATGGCCACAACCATGACTAGTGCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGA

[0270] SEQ ID NO: 6mCHERRY element

[0271]

Claims

1. A pharmaceutical composition comprising: i) isolated skeletal stem cells, wherein the skeletal stem cells are Itm2a positive; and ii) a pharmaceutically acceptable carrier.

2. The pharmaceutical composition of claim 1, wherein the skeletal stem cells are human skeletal stem cells, and wherein the skeletal stem cells are CD45-CD31-TER119-CD235-CD146-PDPN+CD73+CD164+ cells.

3. The pharmaceutical composition of claim 1 or 2, wherein the skeletal stem cells have the ability to differentiate into osteoblasts.

4. The pharmaceutical composition of any one of claims 1-3, wherein the skeletal stem cells are self-renewing and clonogenic.

5. The pharmaceutical composition of any one of claims 1-4, wherein the skeletal stem cells are enriched from a bone tissue sample.

6. The pharmaceutical composition of claim 5, wherein the skeletal stem cells are expanded ex vivo.

7. The pharmaceutical composition of any one of claims 1 to 6, wherein the pharmaceutical composition is formulated for local administration, such as local administration at a bone fracture site.

8. A method for preparing an isolated skeletal stem cell population, wherein the skeletal stem cells are Itm2a positive, the method comprising: a) providing a cell pool from bone tissue; b) selecting Itm2a-positive cells from the cell pool derived from bone tissue; as well as c) optionally expanding the cells selected in step b) in culture.

9. The method of claim 8, wherein step b) comprises selecting with a binding molecule directed against Itm2a.

10. The method of claim 9, wherein the binding molecule is an anti-Itm2a antibody or an antigen-binding fragment thereof.

11. The method of any one of claims 8 to 10, wherein step b) comprises selection by flow cytometry.

12. The method of any one of claims 8 to 11, wherein the skeletal stem cells are human skeletal stem cells, and wherein the method further comprises selecting from the pool of cells derived from bone tissue CD45-CD31-TER119-CD235-CD146-PDPN+CD73+CD164+ cells.

13. A method of treating a bone injury or defect in a subject in need thereof, the method comprising a) providing a cell pool from bone tissue; b) selecting Itm2a-positive cells from the cell pool derived from bone tissue; c) expanding the cells selected in step b) in culture; and d) administering the cells expanded in step c) to the subject in need thereof.

14. The method of claim 13, wherein the bone tissue is autologous bone tissue of the subject in need thereof.

15. The method of claim 13, wherein the bone tissue is allogeneic bone tissue.

16. The method of any one of claims 13 to 15, wherein step b) comprises selecting with a binding molecule directed against Itm2a.

17. The method of claim 16, wherein the binding molecule is an anti-Itm2a antibody.

18. The method of any one of claims 13 to 17, wherein step b) comprises selecting by flow cytometry.

19. The method of any one of claims 13-18, wherein the skeletal stem cells are human skeletal stem cells, and wherein the method further comprises selecting from the pool of cells derived from bone tissue CD45-CD31-TER119-CD235-CD146-PDPN+CD73+CD164+ cells.

20. The method of any one of claims 13-19, wherein the expanded cells are administered locally at the site of the bone injury or defect.

21. The method of any one of claims 13-20, wherein the bone injury or defect is a bone fracture.

22. A method of treating a bone injury or defect in a subject in need thereof, comprising administering to the subject in need thereof the pharmaceutical composition of any one of claims 1-6.

23. The method of claim 22, wherein the pharmaceutical composition is administered locally at the site of the bone injury or defect.

24. The method of claim 22 or 23, wherein the bone injury or defect is a bone fracture.

25. The method of any one of claims 22-24, wherein the skeletal stem cells are autologous or allogeneic to the subject in need.

26. The pharmaceutical composition of any one of claims 1-7 for use in treating bone damage or defects in a subject in need thereof.

27. The pharmaceutical composition of claim 26, wherein the bone injury or defect is a bone fracture.

28. Use of the pharmaceutical composition of any one of claims 1-7 or the isolated skeletal stem cell population prepared by the method of any one of claims 8-12 in the preparation of a medicament for treating bone injury or defect in a subject in need thereof.

Images