Application of milk-derived active component in preparation of orthopoxvirus inhibitor

Through milk-derived active ingredients such as lactoferrin, etc., the adsorption, internalization and effusion of orthopoxvirus are blocked, and the inhibitory effect is achieved throughout the time period, solving the resistance and side effects of existing anti-monkeypoxvirus drugs, and providing a safe and efficient broad-spectrum antiviral solution.

CN120459280APending Publication Date: 2025-08-12BIOSTIME (CHANGSHA) NUTRITION FOOD CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510566809.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-12

AI Technical Summary

Technical Problem

Currently, there is a lack of effective, safe, broad-spectrum anti-monkeypoxvirus drugs. The existing drugs have risks of resistance and side effects, and the antiviral activity of milk-derived active ingredients in breast milk has not been fully utilized.

Method used

Using milk-derived active ingredients such as lactoferrin, whey protein, creamy globulin membrane, osteopontin, etc., the virus enters the cells by inhibiting the adsorption, internalization and effusion of orthopoxvirus, and achieving full-time inhibition.

Benefits of technology

The milk-derived active ingredients significantly inhibit orthopoxvirus infection, have broad-spectrum antiviral activity and low toxicity. They are suitable for the preparation of products that prevent and treat monkeypox and vaccinia virus infectious diseases, and have potential clinical application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120459280A_ABST
    Figure CN120459280A_ABST
Patent Text Reader

Abstract

The invention provides application of a milk-derived active component in preparation of an orthopoxvirus inhibitor. The milk-derived active component comprises one or more of lactoferrin, whey protein, milk fat globule membrane and osteopontin. The milk-derived active component has the activity of remarkably inhibiting orthopox virus infection, and is a potential preparation for treating monkey pox and vaccinia virus infectious diseases. The lactoferrin can inhibit virus infection in the whole life cycle of the virus, has important medicinal value, and is a promising candidate preparation for treating infectious diseases of monkey pox virus and other orthopox virus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of peptide-containing pharmaceutical preparations, and in particular to the application of a milk-derived active ingredient in the preparation of an orthopoxvirus inhibitor. Background Art

[0002] Monkeypox is a zoonotic disease caused by the monkeypox virus. Clinically, it presents primarily with fever, rash, and swollen lymph nodes. It was once endemic in West and Central Africa. Monkeypox infection is associated with a range of complications, including secondary infection, bronchopneumonia, sepsis, encephalitis, and corneal infection, which can subsequently lead to vision loss and even death. Since May 2022, monkeypox outbreaks have been reported in multiple countries and regions, and the rapid increase in confirmed cases could pose a serious threat to the international community. On July 23, 2022, the World Health Organization declared the monkeypox outbreak a Public Health Emergency of International Concern.

[0003] Monkeypox virus (MPXV) is one of four orthopoxviruses (OPXVs) that can cause human disease, the others being variola virus (VARV), vaccinia virus (VACV), and cowpox virus (CPXV). Of these, MPXV and VARV are the most dangerous pathogens. Although VARV was eradicated globally in the 1980s, it remains a significant biosafety threat due to potential risks of laboratory release and bioterrorism. Furthermore, cross-species transmission of MPXV and CPXV can cause severe disease in humans. Current epidemiological data suggest that the emergence of monkeypox in non-endemic areas has a significant impact on public health security, and high rates of human-to-human transmission could lead to further outbreaks.

[0004] Different species of the Orthopoxvirus genus can undergo recombination. Poxviruses of the same genus share similar antigenicity, and the immune response induced by one virus can provide cross-immune protection against infection by other viruses. The Tiantan strain of vaccinia virus (VACV_TT) was isolated from a smallpox patient in my country and then passaged through monkeys, rabbits, cattle, and other animals. It was subsequently used in vaccine production and played a significant role in my country's smallpox eradication. The Tiantan strain of vaccinia virus has been used as a vaccine against smallpox in my country, with hundreds of millions of people vaccinated with it, demonstrating excellent efficacy and safety. Following smallpox eradication, this vaccine strain was used as a viral expression vector in the development of various recombinant vaccines.

[0005] To date, there are no specific antiviral drugs approved by the US Food and Drug Administration (FDA) for the treatment of MPXV. Most infected individuals receive symptomatic and supportive care. In addition, only a few drugs used to treat smallpox have some inhibitory activity against MPXV and could serve as alternative antiviral agents for monkeypox, including cidofovir (Cidovir), tecovirimat (TCV), and brincidofovir (BCV). Cidovir and its derivative, brincidofovir, are ring-opening phosphonic acid nucleosides in the nucleoside class of antiviral drugs. They are inhibitors of viral DNA polymerase and act as DNA synthesis raw materials, interfering with the synthesis of viral DNA by pyrimidine and purine analogs, thereby achieving antiviral effects. Studies have reported that cidofovir and brincidofovir can inhibit MPXV replication in vitro and in vivo. However, cidofovir is highly excreted through the kidneys and can cause irreversible renal damage in severe cases, necessitating its use with caution. The nucleoside analog inhibitor Nioch-14 has strong antiviral activity against many orthopoxviruses. Its efficacy against MPXV and VACV is comparable to that of TCV, and it is considered a potential anti-MPXV drug. Although nucleoside antiviral drugs have developed rapidly, studies have shown that orthopoxviruses themselves have mutations in their DNA polymerases, which can easily cause widespread cross-resistance, and further research and development of drugs with different mechanisms of action targeting poxviruses is needed. Many non-structural proteins are involved in viral replication, transcription, and other processes and are potential virulence factors and drug targets. Tecovirimat is a small molecule viral inhibitor that can bind to the viral F13L product and interfere with the assembly of the viral capsid, preventing the virus from spreading again from the target cell. In 2022, Tecovirimat was approved in Europe for the treatment of MPXV.

[0006] In general, the research and development of anti-monkeypox virus drugs and the exploration of their molecular mechanisms are of great significance. In order to cope with viral mutations, the development of safe, highly active and broad-spectrum anti-orthopoxvirus drugs has important theoretical significance and clinical application value for the prevention and treatment of the current monkeypox epidemic and possible future orthopoxvirus infections. Breast milk is rich in useful ingredients, such as proteins, minerals, vitamins and antibacterial compounds, which have inhibitory activity against a variety of viruses. Among them, lactoferrin is an important non-heme iron-binding glycoprotein in mammalian milk. It has been widely used in in vivo and in vitro studies and is widely used as a dietary supplement. Its safety has been fully verified and the US FDA has classified it as "generally recognized as safe" (GRAS). The concentration of lactoferrin in breast milk is approximately 2-5 g / L. Because lactoferrin resists proteolysis by digestive enzymes such as proteases, oral lactoferrin can enter intestinal epithelial cells through the mediation of lactoferrin receptors. Its concentration in the intestine can reach as high as 200-500 mg / L, allowing it to be fully absorbed in the gastrointestinal tract and exert its potential antiviral activity. Currently, there are no reports on the broad-spectrum antiviral activity of lactoferrin against orthopoxviruses such as monkeypox and vaccinia.

[0007] The non-patent document "Antiviral Activity of Purified Human Breast Milk Mucin" discloses that breast milk mucin has anti-poxvirus activity and reveals that milk mucin appears to aggregate before poxviruses enter host cells. This method uses a mixed protein containing MUC1 mucin, the strain used is vGK5, and activity was tested only in one cell line (BSC-1). It does not indicate whether other components of the milk-derived active ingredient have inhibitory effects on orthopoxviruses, or whether they have a broad-spectrum inhibitory effect on orthopoxviruses. Summary of the Invention

[0008] In view of the shortcomings of the prior art, the present invention provides a use of a milk-derived active ingredient in the preparation of an orthopoxvirus inhibitor, with the aim of providing a new method for treating orthopoxvirus.

[0009] In a first aspect, the present invention provides a use of a milk-derived active ingredient in the preparation of an orthopoxvirus inhibitor, wherein the milk-derived active ingredient comprises one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin.

[0010] In an embodiment of the present invention, the milk-derived active ingredient includes lactoferrin.

[0011] In an embodiment of the present invention, the milk-derived active ingredient is derived from humans or cows.

[0012] In an embodiment of the present invention, the orthopoxvirus inhibitor is used for at least one of the following:

[0013] (1) Prevent, alleviate and / or treat diseases caused by orthopoxvirus infection;

[0014] (2) inhibiting the adsorption and internalization stages of orthopoxvirus;

[0015] (3) inhibiting the exocytosis stage of orthopoxvirus;

[0016] (4) Acts on heparan sulfate receptors.

[0017] In a specific embodiment of the present invention, the milk-derived active ingredient can inhibit orthopoxviruses including monkeypox virus and vaccinia virus, or treat diseases caused by orthopoxvirus infection including monkeypox virus and vaccinia virus, or improve diseases caused by orthopoxvirus infection including monkeypox virus and vaccinia virus.

[0018] In one embodiment of the present invention, the inhibition of orthopoxviruses including monkeypox virus and vaccinia virus can be at the organism level or the cellular level.

[0019] In a specific embodiment of the present invention, the cells include but are not limited to African green monkey kidney cell line Vero E6, human breast cancer cell line HeLa, human embryonic kidney cell line 293T, human liver cancer cell line Huh 7 and rhesus monkey kidney cell line MA-104.

[0020] In a specific embodiment of the present invention, the symptoms of the disease caused by infection with orthopoxviruses including monkeypox virus and vaccinia virus may be fever, severe headache, muscle pain and swollen lymph nodes. About 1-3 days after the fever, ulcers may appear in the mouth and rashes may appear in other parts of the body.

[0021] In one embodiment of the present invention, the milk-derived active ingredient inhibits vaccinia virus infection both before and after entry into host cells. Therefore, the milk-derived active ingredient is suitable for preparing products for preventing, alleviating, and / or treating diseases caused by orthopoxvirus infection, including monkeypox virus and vaccinia virus.

[0022] In an embodiment of the present invention, the orthopoxvirus includes at least one of monkeypox virus, vaccinia virus, cowpox virus, and smallpox virus.

[0023] In a specific embodiment of the present invention, the orthopoxvirus is the Tiantan strain of vaccinia virus.

[0024] In one embodiment of the present invention, the orthopoxvirus is a monkeypox virus pseudovirus.

[0025] After extensive research, the inventors discovered a new use for milk-derived active ingredients. They evaluated the antiviral activity of milk-derived active ingredients using the vaccinia virus Tiantan strain (VACV_TT), a surrogate model for orthopoxvirus drug screening, and the monkeypox virus (VSV) pseudovirus model. The results demonstrated that the milk-derived active ingredients effectively inhibited the infection and replication of both the VACV Tiantan strain (VACV_TT) and the monkeypox virus (VSV) pseudovirus, exerting their inhibitory effects both before and after the VACV Tiantan strain's entry into cells, and at all times.

[0026] Among them, in the orthopoxvirus drug screening alternative model VACV_TT, milk-derived active ingredients from different healthy donors can dose-dependently inhibit VACV_TT infection in the Vero E6 cell line, EC 50 =0.17mg / mL, CC 50 >4.00mg / mL, SI>23.53; its main component human lactoferrin (hLF) in Vero E6 cell line EC 50 =0.12mg / mL, CC 50 >2.5 mg / mL, SI>20.83; EC in Hela cell line 50 =0.28mg / mL, CC 50 >5 mg / mL, SI>17.86; EC in MA-104 cell line 50 =0.15mg / mL, CC 50 >5mg / mL, SI>33.33; EC in 293T cell line 50 =0.38mg / mL, CC 50 >5mg / mL, SI>13.16. Further expansion found that bovine lactoferrin (bLF) has better antiviral activity than human lactoferrin, and its EC in Vero E6 cell line 50 =0.03mg / mL, CC 50 >2.5mg / mL, SI>83.33; EC in Hela cell line 50 =0.01mg / mL, CC 50 >5mg / mL, SI>500; EC in MA-104 cell line 50 =0.07mg / mL, CC 50 >5mg / mL, SI>71.42; EC in 293T cell line 50 =0.12mg / mL, CC 50 >5mg / mL, SI>41.7.

[0027] In addition, the present invention explored the inhibition of lactoferrin on VACV_TT infection of Vero E6 cells at different MOIs. The results showed that lactoferrin from different sources could inhibit viral infection at multiple MOIs. At MOI=0.01, 0.1 and 1, the EC 50 = 0.13 mg / mL, 0.12 mg / mL and 0.59 mg / mL, EC of bovine lactoferrin 50 =0.02mg / mL, 0.03mg / mL and 0.08mg / mL. Using a pseudovirus drug screening alternative model, it was found that bovine lactoferrin could inhibit monkeypox pseudovirus infection in a dose-dependent manner in different cell lines, including A35R, B6, E8, and A29.

[0028] The above results indicate that milk-derived active ingredients have great potential clinical application value in alleviating and / or treating orthopoxvirus infectious diseases including monkeypox virus and vaccinia virus.

[0029] In a second aspect, the present invention provides a composition for use in preparing an orthopoxvirus inhibitor, wherein the composition comprises a milk-derived active ingredient, preferably the milk-derived active ingredient comprises one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin; more preferably, the milk-derived active ingredient comprises lactoferrin; further preferably, the milk-derived active ingredient comprises bovine lactoferrin.

[0030] In a specific embodiment of the present invention, the composition further comprises an antiviral drug, preferably the antiviral drug comprises one or more of cidofovir, tecovirizumab, and brincidofovir.

[0031] In a third aspect, the present invention provides a preparation for use in the preparation of an orthopoxvirus inhibitor, wherein the preparation comprises a milk-derived active ingredient, preferably the milk-derived active ingredient comprises one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin; more preferably, the milk-derived active ingredient comprises lactoferrin.

[0032] Preferably, the preparation can be used alone or mixed with other pharmaceutical excipients;

[0033] Preferably, the pharmaceutical excipients include one or more of excipients, diluents, vehicles, and carriers;

[0034] Preferably, the preparation includes tablets, capsules, granules, syrups, powder injections, solutions, nasal drops, suspensions, and semisolid preparations.

[0035] In a fourth aspect, the present invention provides a use of a product in the preparation of an orthopoxvirus inhibitor, wherein the product comprises a milk-derived active ingredient, preferably the milk-derived active ingredient comprises one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin; more preferably, the milk-derived active ingredient comprises lactoferrin;

[0036] The products include functional foods, functional drinks, skin care products, cosmetics, medicinal liquor, and mouthwash.

[0037] In a fifth aspect, the present invention provides an orthopoxvirus inhibitor comprising a milk-derived active ingredient, wherein the milk-derived active ingredient comprises one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin;

[0038] Preferably, the antiviral drug is further included, wherein the antiviral drug includes one or more of cidofovir, tecovir, and brincidofovir;

[0039] Preferably, the orthopoxvirus inhibitor can be prepared in the form of a preparation, including tablets, capsules, granules, syrups, powder injections, solutions, nasal drops, suspensions, and semisolid preparations;

[0040] Preferably, the orthopoxvirus inhibitor can be used alone or in combination with other pharmaceutical excipients;

[0041] The pharmaceutical excipients include one or more of excipients, diluents, vehicles, and carriers;

[0042] Preferably, the orthopoxvirus inhibitor can be prepared into any one of functional food, functional drink, skin care product, cosmetic, medicinal wine, and mouthwash.

[0043] The technical principle of the present invention is:

[0044] After extensive research, the inventors discovered a new use for milk-derived active ingredients. They evaluated the antiviral activity of milk-derived active ingredients using the vaccinia virus Tiantan strain (VACV_TT), a surrogate model for orthopoxvirus drug screening, and the monkeypox virus (VSV) pseudovirus model. The results demonstrated that the milk-derived active ingredients effectively inhibited the infection and replication of both the VACV Tiantan strain (VACV_TT) and the monkeypox virus (VSV) pseudovirus, exerting their inhibitory effects both before and after the VACV Tiantan strain's entry into cells, and at all times.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] (1) The experimental data of the present invention show that the milk-derived active ingredients have significant inhibitory activity against orthopoxvirus infection. The milk-derived active ingredients significantly inhibited viral infection and replication in both vaccinia virus and monkeypox VSV pseudovirus systems. The milk-derived active ingredients inhibit viral replication by inhibiting the entire viral life cycle. These results strongly suggest the potential clinical application value of milk-derived active ingredients for the treatment of diseases caused by the currently prevalent monkeypox virus and other orthopoxvirus infections.

[0047] (2) The present invention found that lactoferrin, whey protein, milk fat globule membrane, and osteopontin can block the entry of orthopoxvirus into cells at the cellular level, and also effectively inhibit the exocytosis of orthopoxvirus, thereby achieving the effect of preventing, alleviating and / or treating monkeypox virus and vaccinia virus infection.

[0048] (3) Lactoferrin can inhibit viral infection throughout the entire viral life cycle, suggesting that lactoferrin has potential clinical application value for the currently prevalent monkeypox virus and other orthopoxvirus infections that can cause human disease. As a potential drug for the treatment of orthopoxviruses such as monkeypox and vaccinia virus, lactoferrin has significant medicinal value and is a promising candidate drug for the treatment of monkeypox virus and other orthopoxvirus infections.

[0049] (4) The present invention found that milk-derived active ingredients have a broad-spectrum inhibitory effect on orthopoxviruses (monkeypox, smallpox, cowpox pseudovirus, and vaccinia virus Tiantan strain (VACV_TT)), and specific protein components in breast milk (lactoferrin, whey protein, osteopontin, and milk fat globule membrane) all have antiviral activity.

[0050] (5) Compared with the drugs already on the market, the milk-derived active ingredients mentioned in the present invention are less toxic and have clear ingredients, and are more likely to be developed as food-derived products such as dietary supplements. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 The inhibitory effect of milk-derived active ingredients from different donors on VACV_TT infection;

[0052] Figure 2 Initial screening results of milk-derived active ingredients that inhibit VACV_TT infection in different cell lines;

[0053] Figure 3 The results of the test of four proteins (lactoferrin, milk fat globule membrane, osteopontin, and whey protein) inhibiting VACV_TT and VACV_WR infection;

[0054] Figure 4 To verify the effectiveness of lactoferrin in inhibiting VACV_TT infection in Vero E6 cell line;

[0055] Figure 5The results show that lactoferrin from different sources inhibits VACV_TT infection in different cell lines (Hela cells, Huh 7 cell line, and 293T cells);

[0056] Figure 6 The results show that lactoferrin from different sources inhibits VACV_TT infection of Vero E6 cells at different multiplicities of infection (MOI = 0.01, 0.1, 1);

[0057] Figure 7 The results of the test of different dosing times of bovine lactoferrin inhibiting VACV_TT infection of Vero E6 cells;

[0058] Figure 8 The results of the test show that bovine lactoferrin inhibits the adsorption and internalization stage of Vero E6 cells infected with VACV_TT.

[0059] Figure 9 The results show that bovine lactoferrin inhibits the post-cytosolic stage of VACV_TT infection in Vero E6 cells (the level of viral DNA in the cells).

[0060] Figure 10 The results of the adsorption receptor test of bovine lactoferrin inhibiting VACV_TT infection of Vero E6 cells;

[0061] Figure 11 For the binding experiment of bovine lactoferrin and heparin;

[0062] Figure 12 The results show that bovine lactoferrin can inhibit pseudovirus infection in Huh 7 cell lines;

[0063] Figure 13 The drug combination effect of bovine lactoferrin and Brincidofovir;

[0064] Figure 14 The results of transcriptome analysis of Hela cells infected with VACV_TT by bovine lactoferrin;

[0065] Figure 15 The results of bovine lactoferrin treatment on VACV_WR-infected BALB / c mice;

[0066] Figure 16 The results of bovine lactoferrin staining of the lungs of BALB / c mice infected with VACV_WR. DETAILED DESCRIPTION

[0067] The technical solutions of the present invention will be described in further detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are encompassed within the scope of protection that the present invention is intended to protect.

[0068] Unless otherwise noted, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods. All infection experiments were conducted in a Biosafety Level 2 (BLS-2) laboratory. The Tiantan strain of vaccinia virus was purchased from the Institute of Virology, Chinese Center for Disease Control and Prevention. All relevant pseudoviruses used were synthesized using methods known in the art.

[0069] Viral Sample Processing and Detection Methods: Total DNA was extracted using the One-Step Blood / Tissue / Cell Genomic DNA Extraction Kit (Beijing Nobel Biotechnology Co., Ltd., DNE24) according to the manufacturer's instructions. Quantstudio Real-Time PCR Detection Reagents (Applied Biosystems, Foster City, CA, USA) were used for qRT-PCR amplification using the SYBR-Green method: 95°C for 5 min, 40 cycles of 95°C for 10 s, 55°C for 20 s, and 72°C for 31 s. Normalization was achieved by detecting the GAPDH gene. The primers used are shown in Table 1.

[0070] EC 50 It refers to the drug concentration that can effectively inhibit 50% of cells from being infected with the virus. The smaller the value, the better the drug's inhibitory effect on the virus.

[0071] CC 50 It is the drug concentration that makes 50% of cells cytotoxic. The higher the value, the lower the toxicity of the drug to cells. SI: Selectivity index, CC 50 With EC 50 The larger the value, the higher the possibility of drug development.

[0072] Table 1 Primer sequences used in the study

[0073] Primer name Sequence (5'-3') VACV_TT-F TGCTTGGTATAAGGAGCCCA VACV_TT-R GTACCGGCATCTCTAGCAGTC GAPDH-F AGCCTCAAGATCATCAGCAATG GAPDH-R ATGGACTGTGGTCATGAGTCCTT

[0074] Research using monkeypox virus requires high-level biocontainment facilities, which conflicts with the urgent needs of current research. In this application, the inventors used vaccinia virus (VACV) and a monkeypox pseudovirus system based on the VSV backbone to evaluate the activity of several milk-derived active ingredients. This achieved the effectiveness and reliability of monkeypox virus research while ensuring safety, and the authenticity of the content of this invention was guaranteed through multiple verification methods.

[0075] Example 1 Preliminary screening of milk-derived active ingredients to inhibit vaccinia virus Tiantan strain (VACV_TT) infection

[0076] 1. Cell and virus culture

[0077] African green monkey kidney cell line Vero E6, human breast cancer cell line Hela, human embryonic kidney cell line 293T, human hepatoma cell line Huh 7, and rhesus monkey kidney cell line MA-104 were obtained from the American Type Culture Collection (ATCC, No. 1586) and cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS; Gibco Invitrogen) in an incubator at 37°C and 5% CO2.

[0078] 2. Preliminary screening test of VACV_TT antiviral activity in breast milk samples

[0079] 2.5×10 4 Vero E6 cells were seeded into 96-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. Milk components from 11 different healthy donors, numbered 1-11, were then added to the wells to serve as experimental groups. A control group without milk was also established. The samples were diluted in DNEM medium containing 2% FBS and 1% double-antibody to achieve 4-, 20-, and 100-fold dilutions. VACV_TT virus dilutions (MOI = 0.1) were added to the wells and cultured in a 37°C, 5% CO2 incubator. Preliminary assessment was made by observing cytopathic effects. Intracellular viral DNA and the expression of the reference gene GAPDH were quantitatively detected and analyzed by qRT-PCR.

[0080] The antiviral activity of sample No. 1, which has the highest antiviral activity, was further tested. 5 Vero E6 cells were seeded into 48-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. Milk samples containing 3.0 mg / mL, 0.6 mg / mL, and 0.12 mg / mL of total protein were then added to the cell culture wells, along with VACV_TT virus dilution (MOI = 0.1). A control group without lactoferrin was established. Intracellular viral DNA and the expression of the reference gene GAPDH were quantitatively detected and analyzed by qRT-PCR. A parallel experimental group was set up, and the number of infectious viral particles was determined by plaque assay after freeze-thaw.

[0081] EC was performed on the above samples 50 / CC 50 Detection: 2.5×10 4Vero E6 cells were seeded into 96-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. Milk samples with final concentrations of 5 mg / mL, 2.5 mg / mL, 1.25 mg / mL, 0.625 mg / mL, 0.312 mg / mL, 0.156 mg / mL, 0.078 mg / mL, 5 mg / mL, 0.039 mg / mL, 0.020 mg / mL, 0.010 mg / mL, and 0 mg / mL were then added to the cell culture wells. Virus dilution was also added and cultured in a 37°C, 5% CO2 incubator. Samples were collected 36 hours after viral infection, and the expression of intracellular viral DNA and the cellular reference gene GAPDH was quantitatively detected by qRT-PCR. GraphPad-Prism 8 software was used for data analysis and calculation of EC 50 Detection: CC was performed using the CellTiter-Blue method. 50 The cells were seeded into 96-well cell culture plates and the experiment was performed when the cell density reached 60%-80%. 50 The corresponding concentrations of drugs were cultured in an incubator at 37°C with 5% CO2 for 48 h. 20 μL of resazurin dye was added to each well. The fluorescence intensity was detected using CellTiter-Blue reagent with an excitation wavelength of 554 nm and an emission wavelength of 593 nm. GraphPad-Prism 8 software was used for data analysis and calculation of CC. 50 The results are as follows Figure 1 shown.

[0082] Depend on Figure 1 It can be seen that milk-derived active ingredients from different sources can inhibit VACV_TT infection of cells in a dose-dependent manner, and still have high antiviral activity after 20-fold dilution. It is quantified by total protein concentration. The inhibition rate of 3.0 mg / mL milk component on VACV_TT is 99%, and the number of infectious virus particles is reduced by 1000 times. Its antiviral EC 50 The value is 0.17mg / mL.

[0083] 3. Initial screening test for monomer components with higher content in breast milk

[0084] 2.5×10 4Cells (Vero E6, 293T, Huh7, and Hela) were seeded into 96-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. Components found in high concentrations in breast milk were then added to the wells. These included four proteins (lactoferrin, milk fat globule membrane, osteopontin, and lactalbumin), eight oligosaccharides (2'-fucoyllactose, 3'-fucoyllactose, 2'-sialyllactose, 3'-sialyllactose, fructooligosaccharides, galacto-oligosaccharides, fructose-N-tetraose, and fructose-N-neotetraose), and three vitamins (vitamin B1, vitamin B2, and vitamin D). A final concentration of 5 mg / mL for proteins and oligosaccharides and 1 mg / mL for vitamins was recommended. VACV_TT virus dilutions were added to the wells (MOI = 0.1) and cultured in a 37°C, 5% CO2 incubator. A preliminary judgment was made by observing the cytopathic effect, and the expression of intracellular viral DNA and the intracellular reference gene GAPDH was quantitatively detected and analyzed by qRT-PCR. Figure 2 shown.

[0085] Depend on Figure 2-3 It can be seen that the four proteins have a certain inhibitory effect on VACV_TT and VACV_WR infected cells, among which lactoferrin has a good inhibitory effect on the virus in multiple cell lines.

[0086] Example 2 Lactoferrin inhibits vaccinia virus Tiantan strain (VACV_TT) infection of cells

[0087] 1. Verification of the effectiveness of lactoferrin in inhibiting vaccinia virus Tiantan strain (VACV_TT) infection

[0088] 5×10 4 Vero E6 cells were seeded into 48-well plates and cultured in an incubator at 37°C and 5% CO2 for 24 hours. Then, different concentrations of lactoferrin (10 mg / mL, 1 mg / mL, 0.1 mg / mL, 0.01 mg / mL) and VACV_TT virus dilution (MOI = 0.1) were added to the cell culture wells, and a control group without lactoferrin was set up and cultured in an incubator at 37°C and 5% CO2. Intracellular nucleic acids were collected, and the expression of intracellular viral DNA and the intracellular reference gene GAPDH was quantitatively detected and analyzed by qRT-PCR. Intracellular proteins were collected, and vaccinia virus A27L protein and β-actin protein were quantitatively analyzed by Western Blot. Cells and supernatants were collected and analyzed by plaque and TCID 50 The results are as follows: Figure 4 shown.

[0089] Depend on Figure 4 The results showed that lactoferrin had a certain inhibitory effect on VACV_TT infection in the Vero E6 cell line, and the effect was dose-dependent. Lactoferrin at concentrations of 10 mg / mL, 1 mg / mL, 0.1 mg / mL and 0.01 mg / mL could inhibit viral infection and effectively reduce the viral nucleic acid level, vaccinia virus A27L protein expression and the number of infectious virus particles.

[0090] 2. Lactoferrin inhibits the EC of vaccinia virus Tiantan strain (VACV_TT) 50 and CC 50 Determination

[0091] EC 50 Detection: 2.5×10 4 Cells (Hela, 293T, MA-104, Vero E6) were seeded into 96-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. Human lactoferrin or bovine lactoferrin at final concentrations of 5 mg / mL, 2.5 mg / mL, 1.25 mg / mL, 0.625 mg / mL, 0.312 mg / mL, 0.156 mg / mL, 0.078 mg / mL, 5 mg / mL, 0.039 mg / mL, 0.020 mg / mL, 0.010 mg / mL, and 0 mg / mL were then added to the cell culture wells. Virus dilution was also added and cultured in a 37°C, 5% CO2 incubator. Samples were collected 36 hours after viral infection, and the expression of intracellular viral DNA and the cellular reference gene GAPDH was quantitatively detected by qRT-PCR. GraphPad-Prism 8 software was used for data analysis and calculation of EC 50 .

[0092] CC 50 Detection: CC was performed using the CellTiter-Blue method 50Detection. Cells (Hela, 293T, MA-104, Vero E6) were seeded into 96-well cell culture plates, and the experiment was carried out when the cell density reached 60%-80%. After the cells were replaced with medium, diluted 5mg / mL, 2.5mg / mL, 1.25mg / mL, 0.625mg / mL, 0.312mg / mL, 0.156mg / mL, 0.078mg / mL5mg / mL, 0.039mg / mL, 0.020mg / mL, 0.010mg / mL, 0mg / mL of human lactoferrin or bovine lactoferrin were added. The cells were cultured at 37°C with 5% CO2 for 48h, 20μL of resazurin dye was added to each well, and the fluorescence intensity was detected using CellTiter-Blue reagent with an excitation wavelength of 554nm and an emission wavelength of 593nm. GraphPad-Prism 8 software was used for data analysis and calculation of CC 50 The results are as follows Figure 5 、 Figure 6 shown.

[0093] Depend on Figure 5 It can be seen that lactoferrin from different sources can effectively inhibit VACV_TT virus infection in multiple cell lines. Compared with human lactoferrin, bovine lactoferrin has a better effect. In addition, lactoferrin has the best antiviral effect in Hela cell line. Human lactoferrin has a better antiviral effect in Hela cell line. 50 =0.28mg / mL, CC 50 >5mg / mL, SI>17.86; EC of bovine lactoferrin in Hela cell line 50 =0.01mg / mL, CC 50 >5mg / mL, SI>500.

[0094] Depend on Figure 6 It can be seen that lactoferrin from different sources can effectively inhibit VACV_TT infection of Vero E6 cells at different multiplicities of infection (MOI=0.01, 0.1, 1). The higher the MOI, the higher the lactoferrin concentration required to effectively inhibit viral infection.

[0095] 3. Dosing time experiment

[0096] 5×10 5 Vero E6 cells were seeded into 48-well plates and cultured in a 37°C, 5% CO2 incubator for 24 h. The cell culture wells of the full-time drug administration group and the pre-invasion drug administration group were added with the drug EC values according to the drug. 50The final concentration of bovine lactoferrin was determined, and an equal volume of DMEM culture medium (containing 2% FBS and 1% double antibody) as the above lactoferrin was added to the cell culture wells of the post-cytosolic drug administration group and the virus control group, and the virus (MOI = 0.1) was added at the same time. After 2 hours of infection, the cells were washed 3 times with PBS and the medium was replaced. The culture medium containing the same concentration of drugs was added to the cell culture wells of the full-time drug administration group and the post-cytosolic drug administration group, and the culture medium without drugs was added to the cell culture wells of the pre-cytosolic drug administration group and the control group. The cells were cultured in an incubator at 37°C and 5% CO2. 14 hours after viral infection, the expression of intracellular viral DNA and the intracellular reference gene GAPDH was quantitatively detected by qRT-PCR. At the same time, intracellular proteins were collected, and Western Blot was used to quantitatively analyze the vaccinia virus A27L protein and β-actin protein. The results are as follows. Figure 7 After incubation with the same concentration of milk-derived active ingredients, the cells were infected with the virus-drug mixture. Figure 7 It can be seen that lactoferrin has an inhibitory effect on VACV_TT infection of Vero E6 cells before, after and during the entire period of cellular entry. Compared with the post-cellular entry stage, the inhibitory effect is better in the pre-cellular entry stage.

[0097] 4. Inhibitory effect of lactoferrin on the adsorption and internalization stages of vaccinia virus Tiantan strain (VACV_TT)

[0098] 5×10 5 Vero E6 cells were seeded into 48-well plates and cultured in a 37°C, 5% CO2 incubator for 24 h. 50 The concentration of bovine lactoferrin and the corresponding volume of virus (MOI = 10) were determined. The adsorption group was incubated at 4°C for 2h, the internalization group was first incubated at 4°C for 2h, and then pre-incubated at 37°C for 1h. After the incubation, the cells were washed three times with PBS. The adsorption group was added with the corresponding volume of lysis buffer. The internalization group was first added with 7.5mL of proteinase K and digested at 4°C for 5-10min. After pipetting and mixing, the cells were transferred to a 1.5mL EP tube and centrifuged at 12000rpm for 3min. After aspirating the supernatant, the lysis buffer was added. The expression of viral DNA and the reference gene GAPDH in the cells was quantitatively detected by qRT-PCR. Figure 8 It can be seen that lactoferrin has an inhibitory effect on both the adsorption and internalization stages of VACV_TT at the selected concentration.

[0099] 5. Effect of lactoferrin on the post-cytosolic stage of vaccinia virus Tiantan strain (VACV_TT)

[0100] 5×10 5Vero E6 cells were inoculated into 48-well plates and cultured in a 37°C, 5% CO2 incubator for 24 h. Then, the corresponding volume of virus (MOI = 0.1) was added. After incubation at 37°C for 2 h, the virus solution was discarded and the cells were washed once with PBS. 50 The concentration of bovine lactoferrin and the positive control drug Brincidofovir were determined and cultured in an incubator at 37°C and 5% CO2. The supernatant and cells were collected at 2h, 4h, 6h, 8h, 10h, 12h, 14h, and 16h, respectively. The viral DNA levels in the supernatant and cells were quantitatively detected by qRT-PCR, and absolute quantitative analysis was performed using quality control plasmids. Figure 9 It can be seen that lactoferrin has little effect in the replication stage after the virus enters the cell, but plays a major role in the exocytosis process, thereby reducing the virus level.

[0101] 6. Detection of lactoferrin adsorption receptors

[0102] 5×10 5 Vero E6 cells were seeded into 48-well plates and cultured in a 37°C, 5% CO2 incubator for 24 h. 50 After incubating at 37°C for 2 hours, the virus solution was discarded and the cells were pre-cooled at 4°C for 5 minutes to increase their permeability. The cells were washed three times with PBS and the corresponding volume of virus (MOI = 10) was added. After incubation at 4°C for 2 hours, the cells were harvested and the expression of viral DNA and the reference gene GAPDH in the cells were quantitatively detected by qRT-PCR. Figure 10 It can be seen that the main mechanism of action of lactoferrin is to inhibit the adsorption of viruses into cells. After pre-incubation of the drug with cells, it can inhibit viral adsorption in a dose-dependent manner.

[0103] 7. Lactoferrin and heparin binding test

[0104] 5×10 5 Vero E6 cells were inoculated into 48-well plates and cultured in a 37°C, 5% CO2 incubator for 24 hours. Then, corresponding concentrations of bovine lactoferrin and heparin were added to make the concentration ratio 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3. Then, a certain volume of virus solution (MOI = 0.1) was added. After culturing in a 37°C, 5% CO2 incubator for 24 hours, the original solution was aspirated and the cells were washed once with PBS. The cells were collected and the expression of intracellular viral DNA and the intracellular reference gene GAPDH was quantitatively detected by qRT-PCR. Figure 11 It was found that the adsorption receptor of lactoferrin was heparan sulfate.

[0105] Example 3 Lactoferrin inhibits monkeypox pseudovirus infection of cells

[0106] 2.5×10 4 Cells (Hela cells, Huh 7 cells) were inoculated into 96-well plates and cultured in a 37°C, 5% CO2 incubator for 6 hours. 50 μL of pseudovirus (pseudovirus A29, B6, E8 with VSV as the backbone) and 50 μL of gradiently diluted lactoferrin (10 mg / mL, 5 mg / mL, 2.50 mg / mL, 1.25 mg / mL) were added to the cell culture wells respectively. The cells were cultured for 24 hours. The amount of pseudovirus entering the target cells was calculated by detecting the expression of luciferase. 100 μL of Britelite plus reagent was evenly added to the experimental wells of the 96-well plate. Incubate in the dark for 2 minutes at room temperature to completely lyse the cells. Use a pipette to pipette six to eight times to mix well, transfer 80 μL of lysis buffer to the corresponding 96-well chemiluminescence detection plate, and add the working solution. Incubate for 2 minutes in a multifunctional microplate reader, read the average relative light unit (RLU) of the plate, save the data, compare it with the virus group control, and calculate the inhibitory effect of the drug on the virus. Figure 12 Show.

[0107] Depend on Figure 12 It can be seen that bovine lactoferrin can inhibit the infection of pseudoviruses A29, B6, and E8 with VSV as the backbone in both Hela and Huh 7 cell lines in a dose-dependent manner. The inhibition rate of 5 mg / mL lactoferrin on pseudovirus infection can reach 99%.

[0108] Example 4 Combination of Lactoferrin and Brincidofovir

[0109] 2.5×10 4 Vero E6 cells were seeded into 96-well plates and cultured in an incubator at 37°C and 5% CO2 for 24 hours. Then, bovine lactoferrin at final concentrations of 0.312 mg / mL, 0.078 mg / mL, 0.039 mg / mL, 0.02 mg / mL, 0.05 mg / mL, and 0 mg / mL were added to the cell culture wells, and 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.12 μM, and 0 μM Brincidofovir were added to the corresponding wells. Virus dilution solution (MOI = 0.1) was also added and cultured in an incubator at 37°C and 5% CO2. Samples were collected 36 hours after viral infection, and the expression of intracellular viral DNA and the intracellular reference gene GAPDH was quantitatively detected by qRT-PCR. SynergyFinder was used to evaluate the potential synergistic effect of the combination drug. The results are shown in the figure below. Figure 13 , as shown in Table 2.

[0110] Table 2 Synergy index determination

[0111] Drug combination Synergy Index Best synergy score method brincidofovir-lactoferrin 2.838±1.42 5.92 ZIP

[0112] The results show that lactoferrin can be used in combination with the FDA-approved anti-orthopoxvirus drug Brincidofovir, and the two can play a synergistic role.

[0113] Example 5 Transcriptome Analysis Experiment

[0114] The experimental lactoferrin concentration was 2.5 mg / mL, and Hela cells were infected with VACV_TT at an MOI of 0.1. Four experimental groups were set up: Hela, Hela + Virus, Hela + bLF (bovine lactoferrin), and Hela + bLF + Virus. After 48 hours of culture, cell samples were collected and RNA was extracted using TRIzol. rRNA was removed using the QIAseq FastSelect-rRNA HMR Kit (Qiagen, product number 334387). An mRNA sequencing library was prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, product number E7770L). RNA sequencing (RNA-seq) was performed using the Illumina HiSeq 2500 sequencing system (Novogene Biotechnology Co., Ltd.).

[0115] FastQC (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ) tools and fastx_trimmer in the FASTX toolkit were used to remove low-quality data and adapter sequences; HISAT2 (v2.1.0) was used to map the trimmed RNA-seq sequences to the reference HeLa cell genome ChISab1.1 (GCA 000409795.2); SAMtools (v1.5) was used to remove double-end data duplicate sequences; HTseg was used to count each different gene; DESeq2 was used to identify differentially expressed genes between different experimental groups; the Benjamini-Hochberg method was used to adjust the P value to calculate the false discovery rate (FDR); genes with FDR g value < 0.05 and Log2 (fold change) > 1 were considered differentially expressed genes: ggplot2 package of R language was used to draw volcano plots. The results are shown in Figure 2. Figure 14 shown.

[0116] Depend on Figure 14It can be seen that lactoferrin can reverse the gene upregulation after virus-infected cells, thereby affecting the response of inflammatory factors and inhibiting viral infection.

[0117] Example 6 The therapeutic effect of lactoferrin on mice infected with VACV_WR in vivo

[0118] Pathogen-free female BALB / c mice (6-8 weeks old) were purchased from Vital River and received standard laboratory chow and free access to drinking water. The animals were acclimated to the new environment for 7 days before the experiment. Mice were anesthetized with 0.9 mg of sodium pentobarbital intraperitoneally. 6-8 week old female BALB / c mice were inoculated intranasally with 10 4 PFU of VACV_WR or sham inoculation was performed with 50 μL of sterile 2% DMEM. Animals were allowed to aspirate the inoculum for 30 seconds while remaining upright until they fully recovered from anesthesia. An uninfected group was also established. From two days before to five days after viral infection, mice in the lactoferrin-treated and tecovir-treated groups were intraperitoneally injected with 100 mg / kg of bovine lactoferrin or 50 mg / kg of the active drug tecovir, respectively. Mice in the placebo group were intraperitoneally injected with an equal volume of PBS buffer.

[0119] After intranasal infection with the virus, mice were weighed once daily and observed for signs of weight loss, hunched back, ruffled hair, and poor activity. This was done to assess weight loss and disease severity using the Clinical Sign Score (CDSS) developed by our group. This score consists of five parameters: weight, activity, posture, hair growth, and mental status. The specific scoring criteria are as follows:

[0120] 1. Weight loss: 0—weight loss <3%; 1—weight loss 3%-5%; 2—weight loss >5%;

[0121] 2. Mouse behavior, ability to grasp the iron frame: 0—active behavior; 1—slightly decreased activity; 2—almost no interaction or slow movement, rapid breathing, severe chills;

[0122] 3. Mouse morphology: 0—normal posture, relaxed; 1—mild kyphosis; 2—severe kyphosis, abnormal posture;

[0123] 4. Hair appearance: 0 - smooth hair; 1 - slightly shaggy hair; 2 - severely shaggy hair, rough and matted hair;

[0124] 5. Mental status: 0—no sleepiness; 1—mild sleepiness; 2—severe sleepiness.

[0125] On day 5 after VACV_WR infection, mice were sacrificed and their lung tissues dissected. Lung viral load was quantified by culture and RT-qPCR. Whole lung specimens were fixed in 10% buffered formalin for histological evaluation. Formalin-fixed lung tissue sections were stained with H&E, and lung inflammation was assessed using a standardized histopathological score (HPS). All samples were run in duplicate.

[0126] Depend on Figure 15 It can be seen that the weight loss of mice treated with lactoferrin slowed down the weight loss caused by viral infection and improved clinical pathological manifestations. Both qPCR analysis and plaque analysis showed that the number of VACV_WR viral genome copies in the lung tissue of mice treated with lactoferrin was reduced. Figure 16 H&E staining revealed that the lung tissue of the virus-infected group showed large areas of visible necrosis, with loss of bronchioles and surrounding alveolar structures, leaving a structureless eosinophilic mass. Necrotic cell debris was visible, as was edema around interstitial vessels. Connective tissue was loosely arranged, accompanied by numerous infiltrations of granulocytes, lymphocytes, and macrophages, with macrophages also visible within the bronchiolar lumen. However, the lung tissue of mice treated with lactoferrin showed significant improvement, with no large areas of visible necrosis, and the bronchioles and surrounding alveolar structures remained clearly visible.

[0127] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. Use of a milk-derived active ingredient in the preparation of an orthopoxvirus inhibitor, characterized in that: The milk-derived active ingredients include one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin.

2. Use of a milk-derived active ingredient according to claim 1 in the preparation of an orthopoxvirus inhibitor, characterized in that: The milk-derived active ingredient includes lactoferrin.

3. Use of a milk-derived active ingredient according to claim 1 in the preparation of an orthopoxvirus inhibitor, characterized in that: The milk-derived active ingredient is derived from humans or cows.

4. Use of a milk-derived active ingredient in the preparation of an orthopoxvirus inhibitor according to claim 1, characterized in that: The orthopoxvirus inhibitor is used for at least one of the following: (1) Prevent, alleviate and / or treat diseases caused by orthopoxvirus infection; (2) inhibiting the adsorption and internalization stages of orthopoxvirus; (3) inhibiting the exocytosis stage of orthopoxvirus; (4) Acts on heparan sulfate receptors.

5. Use of a milk-derived active ingredient in the preparation of an orthopoxvirus inhibitor according to claim 1, characterized in that: The orthopoxvirus includes at least one of monkeypox virus, vaccinia virus, cowpox virus, and smallpox virus.

6. Use of a composition in the preparation of an orthopoxvirus inhibitor, characterized in that: The composition includes milk-derived active ingredients, preferably the milk-derived active ingredients include one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin; more preferably, the milk-derived active ingredients include lactoferrin; further preferably, the milk-derived active ingredients include bovine lactoferrin.

7. Use of a composition according to claim 6 in the preparation of an orthopoxvirus inhibitor, characterized in that: The composition further comprises an antiviral drug, preferably one or more of cidofovir, tecovir, and brincidofovir.

8. Use of a preparation in the preparation of an orthopoxvirus inhibitor, characterized in that: The preparation comprises a milk-derived active ingredient, preferably the milk-derived active ingredient comprises one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin; more preferably the milk-derived active ingredient comprises lactoferrin; Preferably, the preparation is used alone or in combination with other pharmaceutical excipients; Preferably, the pharmaceutical excipients include one or more of excipients, diluents, vehicles, and carriers; Preferably, the preparation includes tablets, capsules, granules, syrups, powder injections, solutions, nasal drops, suspensions, and semisolid preparations.

9. Use of a product in the preparation of an orthopoxvirus inhibitor, characterized in that: The product comprises milk-derived active ingredients, preferably the milk-derived active ingredients comprise one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin; more preferably the milk-derived active ingredients comprise lactoferrin; Preferably, the products include functional foods, functional drinks, skin care products, cosmetics, medicinal wines, and mouthwashes.

10. An orthopoxvirus inhibitor, characterized in that: The invention comprises milk-derived active ingredients, wherein the milk-derived active ingredients include one or more of lactoferrin, whey protein, milk fat globule membrane, and osteopontin; Preferably, the antiviral drug is further included, wherein the antiviral drug includes one or more of cidofovir, tecovir, and brincidofovir; Preferably, the orthopoxvirus inhibitor is prepared in the form of a preparation, including tablets, capsules, granules, syrups, powder injections, solutions, nasal drops, suspensions, and semisolid preparations; Preferably, the orthopoxvirus inhibitor is used alone or in combination with other pharmaceutical excipients; Preferably, the pharmaceutical excipients include one or more of excipients, diluents, vehicles, and carriers; Preferably, the orthopoxvirus inhibitor is prepared into any one of functional food, functional drink, skin care product, cosmetic, medicinal wine, and mouthwash.