Hybridoma cell strain, goat pox virus G9 protein monoclonal antibody and application
The monoclonal antibody of goat poxvirus G9 protein was prepared by developing hybridoma cell line 9C5, which was applied to indirect competition ELISA detection, which solved the problem of insufficient specificity and sensitivity of the existing detection methods and achieved efficient goat poxvirus detection.
Patent Information
- Application Number
- CN202510682791.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2025-08-12
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The existing goat poxvirus detection methods are not specific and sensitive, making it difficult to meet the needs of fast and accurate detection.
A hybridoma cell line 9C5 was developed to prepare a goat poxvirus G9 protein monoclonal antibody, and the antibody was used for indirect competition ELISA detection to prepare a goat poxvirus detection kit.
It improves the specificity and sensitivity of goat pox virus detection, provides an efficient detection method, laying the foundation for the prevention and treatment of goat pox virus.
Smart Images

Figure CN120464580A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of bioengineering technology, and more specifically to a hybridoma cell line, a goatpox virus G9 protein monoclonal antibody and applications thereof. Background Art
[0002] Capripox virus (GTPV) is a double-stranded DNA virus belonging to the Poxviridae family that primarily infects goats and sheep, causing a highly contagious disease known as goatpox or sheeppox. The virus is transmitted through direct contact, aerosols, or by arthropod vectors such as flies and ticks. Infection causes a characteristic pox-like rash on the skin and mucous membranes, accompanied by symptoms such as high fever, loss of appetite, and difficulty breathing. Severe infection can result in high mortality, particularly in young and immunosuppressed animals. Capripox poses a serious threat to the livestock industry, making timely detection crucial for implementing biosecurity measures.
[0003] Currently, laboratory testing methods for goatpox virus detection primarily include virus isolation and culture, electron microscopy, immunodiffusion assays, indirect immunofluorescence assays, virus neutralization assays, and PCR. However, these methods suffer from low specificity and sensitivity. Therefore, developing a hybridoma cell line capable of producing the relevant monoclonal antibodies is crucial for improving the specificity and sensitivity of goatpox virus detection methods. Summary of the Invention
[0004] To solve the above problems, the present invention provides a hybridoma cell line, a monoclonal antibody against goatpox virus G9 protein and their applications.
[0005] The present invention is achieved through the following technical solutions:
[0006] A hybridoma cell line, named 9C5, was deposited in the General Microbiology Center of China Culture Collection of Microorganisms with a deposit number of CGMCC No.46312.
[0007] A goatpox virus G9 protein monoclonal antibody is secreted and produced by the hybridoma cell line or its passaged cell line.
[0008] Preferably, the monoclonal antibody against goatpox virus G9 protein is prepared from the hybridoma cell line or its passaged cell line by in vivo ascites induction method.
[0009] An immunogen of a monoclonal antibody against goatpox virus G9 protein, wherein the monoclonal antibody against goatpox virus G9 protein is the monoclonal antibody against goatpox virus G9 protein; the immunogen of the monoclonal antibody against goatpox virus G9 protein is the goatpox virus G9 gene, and the nucleotide sequence of the goatpox virus G9 gene is shown in SEQ ID NO.1.
[0010] The application of the goatpox virus G9 protein monoclonal antibody in detecting goatpox virus.
[0011] Preferably, the specific application method is to use the sample to be tested as the coating antigen and the goatpox virus G9 protein monoclonal antibody as the primary antibody to perform indirect competitive ELISA detection.
[0012] Preferably, the goatpox virus G9 protein monoclonal antibody is used to prepare a goatpox virus detection kit.
[0013] Preferably, the detection kit comprises an ELISA detection component coated plate, an enzyme-labeled secondary antibody and a colorimetric substrate.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] The present invention provides a hybridoma cell line named 9C5 and deposited with the General Microbiology Center of the China National Center for Microbiological Culture Collection with a deposit number of CGMCC No. 46312. The present invention prepares a goatpox virus G9 protein immunogen. Through cell fusion and multiple subcloning, hybridoma cells that stably secrete antibodies are prepared. A large amount of goatpox virus G9 protein monoclonal antibodies are obtained by preparing ascites. The goatpox virus G9 protein monoclonal antibodies can still effectively bind to goatpox virus after being diluted 64K times. These goatpox virus G9 protein monoclonal antibodies can be used to construct a goatpox virus detection method, laying a foundation for the prevention and treatment of goatpox virus.
[0016] Biomaterial Deposit
[0017] The hybridoma cell line provided by the present invention is named 9C5 and classified as a hybridoma cell. It was deposited in the General Microbiology Center of the China Culture Collection Administration on December 26, 2024, with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number being: CGMCC No. 46312. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0019] Figure 1 This is the PCR amplification of the goatpox virus G9 gene of the present invention; wherein, M: DL2000 DNA Marker; 1: goatpox virus G9 gene; 2: ddH2O.
[0020] Figure 2 The invention relates to PCR amplification of the goatpox virus G9 gene; wherein, M: DL2000 DNA Marker; 1-4: goatpox virus G9 gene; 5: ddH2O.
[0021] Figure 3 The figure shows the SDS-PAGE of the expression products of pCold-TF-N1P and pCold-TF-G9 after fragmentation of the present invention; wherein, M: protein marker; 1: pCold TF empty vector; 2: N1P induced supernatant; 3: N1P uninduced supernatant; 4: N1P induced precipitate; 5: N1P uninduced precipitate; 6: G9 induced supernatant; 7: G9 uninduced supernatant; 8: G9 induced precipitate; 9: G9 uninduced precipitate.
[0022] Figure 4 The SDS-PAGE diagram of the induced expression of pCold-G9 of the present invention at different times; wherein, M: protein marker; 1: induction time 14h; 2: induction time 16h; 3: induction time 18h; 4: induction time 20h; 5: induction time 22h; 6: induction time 24h.
[0023] Figure 5 The present invention is for the purification of goatpox virus G9 protein; wherein, M: protein marker; 1: supernatant of bacterial solution after ultrasonication in the induction group; 2: protein flow-through; 3: 20mM imidazole elution; 4: 40mM imidazole elution; 5: 60mM imidazole elution; 6: 100mM imidazole elution; 7: 200mM imidazole elution; 8: 500mM imidazole elution; 9: 600mM imidazole elution.
[0024] Figure 6 The Western blot identification results of the goatpox virus G9 protein of the present invention are His-tagged antibodies; wherein, M: protein marker; 1: purified ultrafiltered G9 protein. DETAILED DESCRIPTION
[0025] To facilitate understanding of the present invention, the present invention will be described more fully below, along with preferred embodiments thereof. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and comprehensive understanding of the disclosure of the present invention.
[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in this specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0027] The beneficial effects of the present invention are described below by means of specific embodiments:
[0028] The sequences in the present invention are all from 5' to 3'.
[0029] Example 1
[0030] 1. Extraction of Goatpox Virus Genome
[0031] Goatpox virus DNA was extracted using the TIANamp Genomic DNA Kit for blood, cell, and tissue genomic DNA extraction. The procedure is as follows:
[0032] a. Transfer 200 μL of goatpox attenuated live vaccine into a 1.5 mL centrifuge tube.
[0033] b. Add 20 μL of Proteinase K solution and mix well.
[0034] c. Add 200 μL of Buffer GB, mix thoroughly by inversion, and incubate at 70°C for 10 min. When the solution becomes clear, briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0035] d. Add 200 μL of anhydrous ethanol, shake thoroughly for 15 seconds, and centrifuge briefly to remove water droplets on the inner wall of the tube cap.
[0036] e. Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, place the adsorption column in a collection tube, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 back into the collection tube.
[0037] f. Add 500 μl of buffer GD to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.
[0038] g. Add 600 μL of rinse solution PW to the adsorption column CB3. Before use, check whether anhydrous ethanol has been added. Centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.
[0039] h. Repeat step g.
[0040] i. Return the adsorption column CB3 to the collection tube and centrifuge at 12,000 rpm for 2 minutes. Discard the waste liquid. Leave the adsorption column CB3 at room temperature for several minutes to completely dry any remaining rinse solution from the adsorption material.
[0041] j. Transfer the adsorption column CB3 to a clean centrifuge tube, add 200 μL of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 5 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the solution in the centrifuge tube.
[0042] k. Store the resulting solution at -20°C.
[0043] 2. Amplification of the Goatpox Virus G9 Gene
[0044] (1) Primer design and synthesis
[0045] Primers were designed using snapgene software based on the sequence of the goatpox virus G9 gene. The nucleotide sequence of the goatpox virus G9 gene is shown in SEQ ID NO.1:
[0046] ATGTTAGATGAAGATATATATTCTTTCTGTGATAAAAACGAAAACGATATAAGATGTAGGTGTTTAAATCCTGATTTGAGTATAATAAAAATAGGAGAAGAAACAAGATTACCATACTATTGTTGGTATGAACCATGCAAACGATCAGATGCGCTTATTGTTAAATCGCTTAAAAAGAACATATCACTATGTAATATTTCA GATTGTAGAGTAACACTAGGTAATATTAAAATAAAAAATGGATATATTGATGTTAAAAATGTTTGTGGTACTAATTCATCTTTTACAAATGAATATATTCGAACTAAATATTTAAATCAAGAAATAGAAGAACCTATCATACATCCAATATGGTTACCAATATCTTTTATTTATAATAACGTCTCTAATACTGATTACATAA.
[0047] The primer sequences are as follows:
[0048] GTPV-G9-F is shown in SEQ ID NO. 2, which is: GCTCGGTACCCTCGAGATGTT AGATGAAGATATATATTCTTTCTGTGATAAAAACGAAAACG.
[0049] GTPV-G9-R is shown in SEQ ID NO. 3, which is: CGACAAGCTTGAATCTTGAATTCTTATG TAATCAGTATTAGAGACGTTATTATAAATAAAGATATTGGTAAC.
[0050] EcoRI and XhoⅠ restriction sites were introduced into the 5' end of the upstream and downstream primers, respectively, and the underlined parts were delivered to a biotechnology company for synthesis.
[0051] (2) PCR amplification of goatpox virus G9 gene
[0052] The goatpox virus cDNA obtained in 1 was directly used for PCR amplification.
[0053] The PCR amplification reaction system with a total volume of 50 μL is shown in Table 1 below.
[0054] Table 1 PCR amplification reaction system
[0055]
[0056] PCR amplification program: 98°C for 3 min; 98°C for 10 s; 59°C for 10 s; 68°C for 10 s; 68°C for 5 min.
[0057] After the reaction is completed, the PCR amplification product is detected by gel electrophoresis. Figure 1 As shown, a very obvious band of about 402 bp was amplified, which was consistent with the size of the pre-taken G9 target band.
[0058] Then the gel is recovered and the product is purified. The specific operation steps are as follows:
[0059] a. Under long-wave UV light, use a clean blade to cut out the DNA band to be recovered, and try to remove the gel that does not contain DNA.
[0060] b. Place the excised gel containing the DNA band into a 1.5 mL centrifuge tube and weigh it.
[0061] c. Add 3 times the volume of binding buffer GMB.
[0062] d. Place in a 56°C water bath for 10 minutes. Vortex every 3 minutes to accelerate dissolution.
[0063] e. Add the solution obtained in the previous step to the adsorption column EC, place the adsorption column in the collection tube, leave it at room temperature for 1 minute, centrifuge at 12000 rpm for 60 seconds, and discard the waste liquid in the collection tube.
[0064] f. Add 600 μL of WB rinse buffer, first check whether anhydrous ethanol has been added, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid.
[0065] g. Add 600 μL of washing buffer (WB), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.
[0066] h. Place the EC adsorption column back into the empty collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much rinsing fluid as possible to prevent residual ethanol in the rinsing fluid from inhibiting downstream reactions.
[0067] i. Remove the adsorption column EC and place it in a clean centrifuge tube. Add 50 μL of elution buffer EB to the middle of the adsorption membrane. For better results, preheat the elution buffer in a 70°C water bath. Allow to stand at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 1 minute. Add the resulting solution back to the adsorption column and centrifuge for 1 minute.
[0068] 3. Construction of pCold-TF-G9 prokaryotic expression vector.
[0069] pCold-TF was double-digested with EcoRI and XhoⅠ.
[0070] The double enzyme digestion reaction system and reaction conditions were as follows: EcoRⅠ1μL, XhoⅠ1μL, 10×rCutSmart Buffer 3μL, pCold-TF vector 25μL, 37℃, 3h.
[0071] After the enzyme digestion reaction is completed, the product is recovered and purified.
[0072] The pCold-TF vector after enzyme digestion was subjected to homologous recombination with the amplified fragment of the G9 gene. The recombination reaction system and reaction conditions are shown in Table 2.
[0073] Table 2 Recombination reaction system
[0074] Element Dosage G9 gene 3.5 μL pCold-TF 1 μL <![CDATA[ddH2O]]> 0.5μL 2×ClonExpressMix 5μL
[0075] 50℃, 15min.
[0076] Transform the ligation product into DH5α competent cells. The specific steps are as follows:
[0077] a. Preparation of resistance plates: Add ampicillin to a final concentration of 50 μg / mL to sterilized LB nutrient agar.
[0078] b. Add sample: Add 10 μL of the ligation product to DH5α competent cells, place on ice, and gently stir to mix evenly.
[0079] c. Ice bath: Keep on ice for 30 minutes.
[0080] d. Heat shock: Remove the competent cells from ice and heat shock them in a 42°C water bath for 60 seconds.
[0081] e. Ice bath: Place back on ice for 5 minutes.
[0082] f. Recovery: Add 800 μL of LB medium to the competent cells and culture in a shaking incubator at 37°C, 180 rpm for 60 min.
[0083] g. Plate coating: Centrifuge the above suspension at 5000 rpm for 3 minutes, discard the supernatant of 600 μL of the suspension after centrifugation, resuspend the bacteria in the remaining 200 μL of liquid, and evenly spread the bacterial suspension on the surface of the plate containing ampicillin resistance. Place it in a 37°C constant temperature incubator and incubate it on the front side for about 15 minutes. After the liquid on the surface of the plate is dry, turn the plate upside down and continue incubating for 18 hours.
[0084] h. Bacteria Picking: Pick a single colony, preferably one with a smooth, intact surface and rounded edges. Place it in LB medium containing ampicillin resistance and culture at 37°C, 220 rpm, for 12 hours. Then, extract the plasmid from the cultured bacteria. The specific steps are as follows:
[0085] a. Centrifuge 4.5 mL of overnight culture at 12,000 rpm for 30 seconds, then remove as much of the supernatant as possible to collect the cells. If more than 1.5 mL of culture is collected, discard the supernatant and add more culture to the same 1.5 mL tube until sufficient cells are collected.
[0086] b. Resuspend the bacterial pellet in 250 μL of solution S1 and vortex until thoroughly suspended. If there are any bacterial clumps that are not thoroughly mixed, it will affect lysis, resulting in low extraction yield and purity.
[0087] c. Add 250 μL of solution S2, gently invert the tube eight times to fully lyse the cells, and let it stand at room temperature for 4 minutes.
[0088] d. Add 350 μL of Solution S3 and immediately and gently invert the tube eight times. A white flocculent precipitate will form when thoroughly mixed. Centrifuge at 12,000 rpm for 10 minutes and carefully remove the supernatant. Mix immediately after adding Solution S3 to avoid localized precipitation of SDS.
[0089] e. Add the supernatant obtained in the previous step to adsorption column AC, place the adsorption column in a collection tube, centrifuge at 12000 rpm for 60 seconds, and discard the waste liquid in the collection tube.
[0090] f. Add 600 μL of WB rinse buffer, first check whether anhydrous ethanol has been added, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.
[0091] g. Add 600 μL of washing buffer (WB), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.
[0092] h. Place the adsorption column AC back into the empty collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much of the rinse solution as possible to prevent residual ethanol in the rinse solution from inhibiting downstream reactions.
[0093] i. Remove the adsorption column AC and place it in a clean centrifuge tube. Add 100 μL of elution buffer EB to the center of the adsorption membrane. Preheat the elution buffer in a 70°C water bath for optimal results. Incubate at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 1 minute. If a larger amount of plasmid is required, add the resulting solution back to the centrifuge column and centrifuge for 1 minute.
[0094] The recombinant plasmid was used as cDNA and PCR amplification was performed using the primers in 1.4. The total volume of the PCR amplification reaction system was 50 μL as shown in Table 3.
[0095] Table 3 PCR amplification reaction system
[0096]
[0097]
[0098] PCR amplification program: 98°C for 3 min; 98°C for 10 s; 59°C for 10 s; 68°C for 10 s; 68°C for 5 min.
[0099] After the reaction is completed, the PCR amplification product is detected by gel electrophoresis. Figure 2 As shown, a distinct band of approximately 402 bp was amplified, which was consistent with the size of the pre-extracted G9 target band and in line with expectations. Recombinant plasmids with positive identification results were sent to a sequencing company for sequencing. Sequencing results were compared using SnapGene, and the alignment results showed consistency with the target sequence.
[0100] The plasmids with positive test results were sent to a biological company for sequencing, and the recombinant plasmids with correct sequencing results were named pCold-TF-G9 plasmids and frozen at -20°C for future use.
[0101] 4. Prokaryotic Expression of Goatpox Virus G9 Protein
[0102] Transform the recombinant plasmid pCold-TF-G9 into E. coli BL21 competent cells. The specific steps are as follows:
[0103] a. Preparation of resistance plates: Add ampicillin to a final concentration of 50 μg / mL to sterilized LB nutrient agar.
[0104] b. Add sample: Add 1.5 μL of recombinant plasmid to BL21 competent cells, place on ice, and gently stir to mix evenly.
[0105] c. Ice bath: Keep on ice for 30 minutes.
[0106] d. Heat shock: Remove the competent cells from ice and heat shock them in a 42°C water bath for 60 seconds.
[0107] e. Ice bath: Place back on ice for 5 minutes.
[0108] f. Recovery: Add 800 μL of LB medium to the competent cells and culture in a shaking incubator at 37°C, 180 rpm for 60 min.
[0109] g. Plate coating: Pipette 200 μL of bacterial suspension and evenly spread it on the surface of the plate containing ampicillin resistance. Place it in a 37°C constant temperature incubator and incubate it on the front for about 15 minutes. After the liquid on the surface of the plate dries, turn the plate upside down and continue incubating for 18 hours.
[0110] h. Picking bacteria: Pick a single colony, preferably one with a smooth, intact surface and rounded edges, and place it in LB medium with ampicillin resistance. Incubate at 37°C, 220 rpm, for 12 hours.
[0111] Take 100 μL of pCold-TF-G9 recombinant bacterial solution and add it to 10 mL of liquid LB medium with ampicillin resistance. Shake and culture at 37°C and 200 rpm until the OD value of the bacterial solution reaches 600 When the nm value was 0.8, the culture was stopped, and at this time, IPTG was immediately added to a final concentration of 0.5 mM, and the cells were induced at 16 °C and 180 r / min. At the same time, a group without IPTG was set as a control.
[0112] 5. Determination of pCold-TF-G9 protein expression pattern
[0113] (1) SDS-PAGE analysis of expression products
[0114] Take 10mL of the induced bacterial solution and centrifuge at 8000rpm for 10min at 4℃ to collect the cells. Add 1mL of 1×PBS to every 0.1g of cells and resuspend them. Ultrasonicate on ice and centrifuge at 10000rpm for 30min at 4℃ to collect the supernatant and precipitate of the broken bacterial solution. Resuspend the precipitate with 80μL of 1×PBS. Add the supernatant and resuspended precipitate to SDS-PAGE 4× Loading Buffer respectively, mix well, boil for 10min, and then perform SDS-PAGE electrophoresis. The results are as follows: Figure 3 As shown, the recombinant protein was clearly expressed in the supernatant.
[0115] (2) Selection of G9 protein induction time
[0116] Add the recombinant bacterial solution to the LB medium and culture on a shaker at 16°C and 180 rpm until the OD 600 When the value reaches 0.8, IPTG is immediately added to a final concentration of 0.5 mM. 1 mL of the induced culture solution is taken every 2 hours after induction, centrifuged at 10,000 rpm for 10 minutes, the supernatant is discarded, and the remaining bacteria are resuspended in 80 μL PBS. SDS-PAGE 4× Loading Buffer is added to the resuspended bacterial solution, mixed evenly, and boiled for 10 minutes. SDS-PAGE electrophoresis is then performed. The results are as follows: Figure 4 The expression level of the recombinant protein was optimal at 22 hours after induction with IPTG.
[0117] (3) Purification and ultrafiltration of goatpox virus G9 protein
[0118] After expressing the above successfully expressed protein in large quantities, it was purified using nickel column affinity chromatography. The specific steps are as follows:
[0119] a. Place a white gasket at the bottom of the affinity chromatography column, add 3 mL of nickel column filler, add 6 mL of wash buffer to resuspend the filler, and cover the top with a white gasket.
[0120] b. Add the successfully expressed protein to the affinity chromatography column and incubate at 4°C overnight.
[0121] c. Collect the protein flow-through.
[0122] d. Elute with 20mM, 40mM, 60mM, 100mM, 200mM, 500mM, and 600mM imidazole, respectively, and collect the eluate.
[0123] e. Add the above eluates to SDS-PAGE 4× Loading Buffer respectively, mix well and boil for 10 minutes, then perform SDS-PAGE electrophoresis and observe the electrophoresis results.
[0124] f. Add the purified protein to a 50 kDa ultrafiltration tube and centrifuge horizontally at 4000 × g for 10 min at 4°C. Collect the liquid and store it at -80°C.
[0125] The results are as follows Figure 5 The purified goatpox virus G9 protein showed a clear band at 69 kDa, and no other protein bands were found at other positions in the purified protein sample.
[0126] 6. Western blot identification
[0127] The G9 protein after ultrafiltration was tested. The specific steps are as follows
[0128] a. Add SDS-PAGE 4× Loading Buffer to the purified protein, mix well, boil for 10 minutes, place on ice for 10 minutes, and then perform SDS-PAGE electrophoresis.
[0129] b. Electrophoresis: First, inject the separating gel, leaving approximately 2 cm of space above the gel for the stacking gel. Seal the gel with 300 μL of anhydrous ethanol. After approximately 30 minutes, discard the anhydrous ethanol and blot with filter paper. Then inject the stacking gel and insert the comb. Allow 30 minutes for the electrophoresis tank to stand. After adding sufficient electrophoresis solution, remove the comb and prepare to add the sample. Avoid drawing in air bubbles. Electrophoresis is best performed at 100V.
[0130] c. Transfer: Cut the gel of interest, then cut a PVDF membrane and four pieces of filter paper of the same size. Activate the PVDF membrane with methanol for 5 minutes. Then, soak the PVDF membrane, filter paper, and gel in transfer buffer for 20 minutes. Once the transfer time is up, transfer the gel to a semi-dry transfer apparatus in the order of two pieces of filter paper, PVDF membrane, gel, and two pieces of filter paper.
[0131] d. Blocking: Wash the PVDF membrane three times with TBST, 10 min each time, and place it in blocking solution at 4°C overnight.
[0132] e. Incubation: After blocking, add primary antibody at a dilution of 1:5000 to the incubation solution and incubate overnight at 4°C. Wash three times with TBST, each wash for 10 minutes.
[0133] f. Incubate with secondary antibody for 1 hour, wash three times with TBST, each wash for 10 minutes, and finally perform chemiluminescence.
[0134] g. Chemiluminescence: Protect from light, luminescent solution A:B = 1:1.
[0135] The results are as follows Figure 6As shown, a specific reaction occurred at 69 kDa, indicating that it could react specifically with the His tag antibody.
[0136] 7. Immunization of Balb / c Mice
[0137] Implement according to the following plan:
[0138] a. Take the measured concentration of goatpox virus G9 protein, dilute it with PBS, add an equal amount of Freund's complete adjuvant to the mixture, shake it thoroughly, and emulsify it. It is best if the drop does not dissipate when it is dropped on the liquid surface.
[0139] b. The emulsified sample was injected twice at the neck and back of the mouse, 200 μL at each site.
[0140] c. Record the immunization time and give the second immunization two weeks later.
[0141] d. Take the measured concentration of goatpox virus G9 protein, dilute it with PBS, add an equal amount of Freund's incomplete adjuvant to the mixture, shake it thoroughly, and emulsify it.
[0142] e. The emulsified sample was injected twice at the neck and back of the mouse, 200 μL at each site.
[0143] f. The second vaccination is after two weeks, and the third vaccination is after one week. The third vaccination is the same as the second vaccination.
[0144] g. 5 days before cell fusion, mice were boosted with intraperitoneal injection of 200 μL of goatpox virus G9 protein per mouse.
[0145] 8. Detection of Serum Titer in Immunized BALB / c Mice
[0146] Eight-week-old female BALB / c mice were immunized with purified goatpox virus G9 protein as an antigen. A second immunization was administered 7 days after the first, and a third immunization was administered 14 days after the second. Seven days after the second or third immunization, orbital blood was collected from the BALB / c female mice, and serum was isolated and assayed for antibody levels. The ELISA results in Tables 4 and 5 show that serum antibody levels after the second immunization were significantly lower than those after the third immunization. After the third immunization, all mice achieved cell fusion.
[0147] Table 4 Serum titer test results of mice secondary immunized with G9 protein
[0148]
[0149]
[0150] Table 5 Serum titer test results of mice immunized three times with G9 protein
[0151]
[0152] 9. Preparation of Feeder Cells
[0153] Prepare feeder cells according to the following protocol:
[0154] a. Unimmunized female Balb / c mice were killed by cervical dislocation and then immersed in 75% alcohol for approximately 5 minutes.
[0155] b. Cut the external skin of the mouse corpse on a sterile operating table to expose the peritoneum and make a small cut in the center of the abdomen.
[0156] c. Use a syringe to draw out 4 mL of DMEM basal culture medium and inject it into the mouse's peritoneal cavity. Repeat the wash and flush process twice. The drawn-out fluid contains peritoneal macrophages.
[0157] d. Add an appropriate amount of HAT selection culture medium, mix thoroughly, and add 100 μL per well to a 96-well plate.
[0158] 10.Resuscitation, activation and preparation of sp2 / 0 myeloma cells
[0159] The specific implementation plan is as follows:
[0160] a. Thaw frozen sp2 / 0 cells one week before fusion.
[0161] b. When the cell density reaches 90%, the cells are uniform in size and in good condition, resuspend them in basal culture medium and collect them.
[0162] c. Centrifuge at 1200 rpm for 10 min and discard the supernatant.
[0163] 11. Preparation of Immune Splenocytes
[0164] The preparation protocol for splenocytes is as follows:
[0165] Immunized female Balb / c mice were bled from their orbits to collect positive serum. The mice were sacrificed by cervical dislocation and then immersed in 75% alcohol for approximately 5 minutes.
[0166] b. Aseptically tear open the mouse's external skin, cross-fix the mouse laterally, remove the spleen, and homogenize it with 5 mL of basal culture medium.
[0167] c. Centrifuge at 1200 rpm for 10 min and discard the supernatant.
[0168] 12. Cell Fusion
[0169] Cell fusion was performed as follows:
[0170] a. Preheat 40 mL of HAT culture medium, 15 mL of basal culture medium, and 0.8 mL of polyethylene glycol-40000 to 37°C in a beaker of water.
[0171] b. Aspirate approximately 3×10 myeloma cells 7 Splenic lymphocytes 10 7 Place the two into a 50 mL centrifuge tube, mix thoroughly, and then add basal culture medium to 40 mL.
[0172] c. Centrifuge at 1000 rpm for 10 minutes, discard the supernatant, and gently tap the bottom of the tube to mix the two cell pellets into a paste.
[0173] d. Place the centrifuge tube in a preheated beaker, draw 0.8 mL of polyethylene glycol-4000, and add it to the precipitate over 1 minute while stirring.
[0174] e. Incubate in a water bath for 90 seconds. Dilute polyethylene glycol-4000 with 15 mL of pre-warmed basal medium. Add 1 mL during the first 30 seconds, 3 mL during the last 30 seconds, and the remaining 11 mL within 2 minutes.
[0175] f. Add basal culture medium until 40 mL is reached, centrifuge at 1000 rpm for 10 min, discard the supernatant and keep the paste-like cell pellet for later use.
[0176] g. Gently resuspend the cells in 40 mL of HAT selective culture medium containing 20% newborn calf serum.
[0177] h. Mix the feeder cells and fused cells, add 200 μL to each well of a 96-well plate using a dispenser, and culture in a 37°C, 5% CO2 incubator. Observe daily.
[0178] i. Detect cell colonies when they grow to a visual field.
[0179] 13. Indirect enzyme-linked immunosorbent assay (ELISA) screening of positive cell wells
[0180] After coating with goat pox virus G9 protein, 50 μL of supernatant from each well of the 96-well plate was aspirated and added to the ELISA plate. The plate was incubated at 37°C for 1 hour and washed 3 times with PBST. Then, 100 μL of 1:5000 goat anti-mouse secondary antibody was added to each well. The plate was incubated at 37°C for 1 hour and washed 3 times with PBST. TMB colorimetric solution was added to each well at 100 μL and color was developed for 15 minutes. Finally, 100 μL of stop solution was added to each well to stop color development. OD was measured. 450 , record the OD value, and retain the wells with higher OD value and good cell growth for subsequent screening of positive clones.
[0181] 14. Cloning of positive cells by limiting dilution method
[0182] The cloning method of positive cells is as follows:
[0183] a. According to the test results, select OD 450 The wells with higher values and good cell growth were selected as positive wells.
[0184] b. Use a micropipette to disperse the cells in the well to be cloned, take 100 μL and transfer it into an EP tube, aspirate an appropriate amount and count.
[0185] c. Dilute to 10% in EP tube with HT medium. 3 pieces / mL.
[0186] d. Fill three 4 mL centrifuge tubes with 3.8 mL, 2.4 mL, and 2.0 mL of culture medium, respectively, for dilution.
[0187] e. Take 200 μL and dilute to 10 3 Place 2.5 mL of cells / mL in the first centrifuge tube, mix thoroughly, then pipette 1.6 mL of the mixture into the second centrifuge tube, mix again, then pipette 2 mL of the mixture into the third centrifuge tube.
[0188] f. Divide the cells in the centrifuge tube into 96-well feeder cell plates at 100 μL / well. Place one column in the first centrifuge tube, two columns in the second centrifuge tube, and five columns in the third centrifuge tube. Transfer the excess cells in the EP tube to a 12-well plate.
[0189] g. Thereafter, observe the status of cells in the clone wells daily.
[0190] 15. Secondary and tertiary cloning of goatpox virus G9 protein
[0191] The screening method is the same as the above method, until 90% of the wells on the entire plate are positive, it is considered that monoclonal cells have been selected.
[0192] 16. Large-scale preparation of monoclonal antibodies
[0193] 0.5 mL of liquid paraffin was injected into the peritoneal cavity of mice, and 5 × 10 hybridoma cells were injected into the peritoneal cavity of mice. 5 The cells were injected intraperitoneally 10 days later. After about 7 days, the mouse abdomen would show swelling of varying sizes. The condition of the mouse was always monitored and the ascites was extracted in time. The extracted ascites was centrifuged at 1000 rpm for 10 minutes. After the ascites was removed from the mouse, it was mixed and packaged for subsequent use. This monoclonal antibody was named 9C5.
[0194] 17. Indirect ELISA test for ascites
[0195] After coating with goatpox virus G9 protein, 100 μL of ascites was aspirated and added to the ELISA plate, incubated at 37°C for 1 hour, and washed 3 times with PBST; then, goat anti-mouse secondary antibody was added, 100 μL per well, incubated at 37°C for 1 hour, and washed 3 times with PBST; TMB color development solution was added, 100 μL per well, and color development was performed for 15 minutes; finally, 100 μL of stop solution was added to each well to stop color development; OD was measured. 450 The results are shown in Table 6, indicating that the goatpox virus G9 protein monoclonal antibody prepared by the present invention can still effectively bind to goatpox virus after being diluted 64K times.
[0196] Table 6 G9 protein indirect ELISA ascites test results
[0197] Antibody dilution 9C5 9C5 9C5 100 3.933 3.849 3.745 1K 3.822 3.65 3.292 2K 3.893 3.582 3.558 4K 3.754 3.619 3.386 8K 3.092 3.042 3.013 16K 2.593 2.413 2.323 32K 1.709 1.836 1.785 64K 1.635 1.912 1.617
[0198] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0199] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. A hybridoma cell line, characterized in that: The hybridoma cell line was named 9C5 and deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit number of CGMCC No.46312.
2. A monoclonal antibody against goatpox virus G9 protein, characterized in that: The goatpox virus G9 protein monoclonal antibody is secreted and produced by the hybridoma cell line or its passaged cell line according to claim 1.
3. The monoclonal antibody against goatpox virus G9 protein according to claim 2, wherein The goat pox virus G9 protein monoclonal antibody is prepared from the hybridoma cell line or its passage cell line by inducing ascites in vivo.
4. An immunogen of a monoclonal antibody against goatpox virus G9 protein, characterized in that: The goatpox virus G9 protein monoclonal antibody is the goatpox virus G9 protein monoclonal antibody according to claim 2; the immunogen of the goatpox virus G9 protein monoclonal antibody is the goatpox virus G9 gene, and the nucleotide sequence of the goatpox virus G9 gene is shown in SEQ ID NO.
1.
5. Use of the monoclonal antibody against goatpox virus G9 protein according to claim 2 in detecting goatpox virus.
6. The use according to claim 5, characterized in that The specific application method is to use the sample to be tested as the coating antigen and the goat pox virus G9 protein monoclonal antibody as the primary antibody to perform indirect competitive ELISA detection.
7. The use according to claim 5, characterized in that The goatpox virus G9 protein monoclonal antibody is used to prepare a goatpox virus detection kit.
8. The use according to claim 7, characterized in that The detection kit comprises an ELISA detection component coating plate, an enzyme-labeled secondary antibody and a color development substrate.