Method for preparing eucheuma peptide EZY-1 in tandem expression mode and application of eucheuma peptide EZY-1 in preparation of scar prevention and repair gel
The preparation of Kirinca peptide EZY-1 through genetic engineering is used to prepare scar prevention and repair gels, which solves the problem of scar keloid treatment in the prior art, and achieves efficient inhibition of keloid formation and reduction of recurrence.
Patent Information
- Application Number
- CN202510617985.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-12
AI Technical Summary
The prior art lacks effective and low side effects for the treatment of keloid scars, and the high recurrence rate of surgical and drug treatments, resulting in double psychological and physiological disorders in patients.
The tandem expression mode is used to prepare the Kirin cabbage peptide EZY-1, which is efficiently expressed through genetic engineering technology, and is prepared into a scar prevention and repair gel, which is used to apply externally to wounds and inhibit the formation of keloids.
It has achieved efficient inhibition of keloid formation, reduced recurrence, reduced side effects of drugs, and improved the quality of life of patients.
Smart Images

Figure CN120464658A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering and biomedicine technology, and more particularly to a method for preparing an Eucheuma peptide EZY-1 in a tandem expression mode and its application in preparing a scar prevention and repair gel. Background Art
[0002] EZY-1, a hexadecapeptide derived from Eucheuma, has been shown to prevent organ fibrosis, boost immunity, inhibit tumor growth and metastasis, and combat aging. However, the low concentration of EZY-1 in Eucheuma limits its widespread application. Efficient preparation of EZY-1 is a promising approach to addressing the raw material shortage, while genetic engineering is a promising approach to green, low-carbon production.
[0003] Modern medical research believes that keloid (KD) is a benign tumor formed by excessive deposition of collagen fibers and excessive infiltration and growth of fibroblasts in the dermis and subcutaneous tissue after tissue damage. The pathological manifestations of KD are mainly inflammatory reactions in the early tissue site of trauma, leukocyte infiltration, excessive proliferation, activation, and migration of fibroblasts in the repair period, and excessive deposition of collagen fibers. This disease often occurs in the recovery period of trauma, surgery, and a few weeks or months after burns. Generally, the injured area is single or multiple, with an oval or round shape, a smooth surface, and a crab-like protrusion at the edge. Keloid has It has a family genetic tendency and can be induced or aggravated by slight stimulation. It often does not disappear on its own, seriously affecting the appearance and function, causing both psychological and physiological disorders in patients. In addition, the disease has a long course and is prone to relapse, which brings great pain and economic burden to patients. In clinical practice, simply using surgery and physical therapy to remove scar tissue is the most direct treatment method, but this treatment has a high recurrence rate. Therefore, it is necessary to combine glucocorticoids, 5-fluorouracil, bleomycin and other drug treatments to reduce the recurrence rate. These drugs often cause patients to have adverse reactions such as drug-induced dermatitis, skin infection and necrosis, pigmentation, etc.
[0004] Currently, there is still a lack of effective drugs to treat keloids in clinical practice, and keloids remain a clinical problem that needs to be solved urgently. Based on this, screening for drugs with low side effects and effective inhibition of scar formation is an urgent clinical need.
[0005] Therefore, providing a method for preparing the Eucheuma peptide EZY-1 in a tandem expression mode and its application in preparing scar prevention and repair gel is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0006] In light of this, the present invention provides a method for preparing the Eucheuma peptide EZY-1 using a tandem expression model and its use in the preparation of a scar prevention and repair gel. The method for efficiently expressing EZY-1 using a tandem expression model yields an EZY-1 sequence that is completely identical to that obtained from the natural product. A tandem expression model has been established for the expression of short linear peptides with a proline residue at the carboxyl terminus.
[0007] In the early stages, an active peptide, named EZY-1, was successfully extracted from Eucheuma. Tandem expression technology was used to produce EZY-1, overcoming the limitations of raw material shortages. EZY-1 was used to create a scar treatment ointment for external application to wounds. Experimental results showed that EZY-1 can inhibit keloid formation.
[0008] In order to achieve the above object, the present invention adopts the following technical solutions:
[0009] A method for preparing the Eucheuma peptide EZY-1 in a tandem expression mode comprises the following specific steps: ligating the open reading frame sequence shown in SEQ ID NO. 2 to the vector pET30a via the NdeI and BamHI double enzyme sites, and performing transformation, induction, purification, and hydrolysis to obtain the Eucheuma peptide EZY-1 with the amino acid sequence shown in SEQ ID NO. 1.
[0010] Furthermore, the Eucheuma peptide EZY-1 is prepared by the method.
[0011] A functional polypeptide, whose amino acid sequence is:
[0012] Arg-Thr-Gly-Ala-Cys-Phe-Cys-Val-Ile-Tyr-Asn-Gly-Ile-Leu-Tyr-Pro.
[0013] The amino acid sequence of the functional polypeptide is abbreviated as:
[0014] RTGACFCVIYNGILYP (SEQ ID NO. 1).
[0015] Furthermore, polypeptides having the same or similar functions after replacing one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1 are also within the scope of protection of the present invention.
[0016] Furthermore, the Eucheuma peptide EZY-1 prepared by the method is used in the preparation of scar prevention and repair gel.
[0017] The present invention also relates to the functional polypeptide or its pharmaceutically acceptable use in preparing scar prevention drugs.
[0018] The present invention also relates to the functional polypeptide or pharmaceutically acceptable use thereof in preparing a repair gel drug.
[0019] Preferably, it includes applications such as knife wounds, burns, and skin injuries caused by external forces.
[0020] The functional polypeptide of the present invention can be used alone or in combination with other drugs.
[0021] Natural EZY-1 is a hexadecapeptide molecule with a proline residue at the carboxyl terminus, and the entire peptide chain consists of only one proline. A single EZY-1 expression cassette requires only 48 nucleotide bases. Ten expression cassettes containing a 48-bp repeating sequence were synthesized. The first EZY-1 expression cassette was fused to a His tag at its amino terminus for detection and purification. The cassette was ligated to the pET30a vector with dual enzyme sites, NdeI and BamHI, at both ends. This expression cassette contains a repeating nucleotide sequence capable of simultaneously expressing ten EZY-1 units. The open reading frame (ORF) is approximately 504 nucleotides long, including a stop codon, TAG, for a total length of 507 nucleotides (as shown in SEQ ID NO. 2). This vector was designated pET30a-10EZY-1.
[0022] The open reading frame sequences are as follows:
[0023] ATG CATCACCATCACCATCAC CCGCGTACCGGCGCTTGTTTCTGTG
[0024] TAATCTATAACGGCATTCTGTACCCTCGTACCGGCGCGTGTTTCTGCGT
[0025] TATTTATAACGGTATTCTGTATCCTCGTACGGGTGCTTGTTTCTGTGTAA
[0026] TTTACAATGGCATCCTGTACCCGCGTACCGGCGCGTGTTTTTGCGTAAT
[0027] CTACAATGGTATCCTGTACCCTCGCACCGGTGCTTGCTTCTGTGTTATCT
[0028] ACAACGGCATTCTGTACCCGCGTACCGGTGCCTGCTTTTGTGTTATCTA
[0029] CAATGGCATTCTGTACCCACGTACGGGTGCATGTTTCTGCGTGATCTAT
[0030] AACGGTATTCTGTACCCACGTACTGGTGCTTGCTTCTGCGTAATCTATA
[0031] ATGGCATCCTGTATCCGCGCACGGGCGCCTGTTTCTGTGTGATCTACAA
[0032] CGGTATCCTGTATCCGCGTACCGGTGCGTGCTTCTGTGTGATCTATAAC
[0033] GGCATCCTGTACCCGTAG; SEQ ID NO. 2.
[0034] In SEQ ID NO. 2, 4-21 bp are His tags, 22-24 bp are proline, and 25-504 bp are repeated nucleotide sequences of 10 EZY-1 units.
[0035] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a method for preparing the Eucheuma peptide EZY-1 in a tandem expression mode and its application in preparing a scar prevention and repair gel, which has the following beneficial effects:
[0036] (1) The present invention establishes for the first time a method for efficiently preparing EZY-1 using genetic engineering technology, which has good application prospects in the field of biomedicine.
[0037] (2) The present invention also establishes a tandem expression mode for expressing a linear short peptide with a proline residue at the carboxyl terminus;
[0038] (3) The present invention reports for the first time the use of EZY-1 to inhibit keloid formation. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0040] Figure 1 The accompanying drawings are diagrams of IPTG-induced tandem expression and purified expression products of E. coli BL21 (DE3) of the present invention; wherein: 1. Protein quality standards; 2. Expression products of E. coli BL21 (DE3) without IPTG induction; 3. Expression products of E. coli BL21 (DE3) after IPTG induction; 4. Expression products purified by His affinity chromatography column.
[0041] Figure 2 The accompanying drawings show the HPLC analysis of the enzymatic cleavage effect of the present invention; wherein, A: sample before prolyl endopeptidase hydrolysis; B: sample after prolyl endopeptidase hydrolysis; C: EZY-1 standard; the arrow indicates the EZY-1 peak in the HPLC.
[0042] Figure 3 The attached figure is the amino acid sequence of the sample prepared by mass spectrometry analysis of the present invention; the prepared sequence is: RTGACFCVIYNGILYP, which is consistent with the natural product.
[0043] Figure 4 The accompanying drawings show the therapeutic effect of the burn repair gel prepared with EZY-1 as the core raw material of the present invention; wherein, A: recording wound changes at different time points; B: 28-day wound sampling and sectioning analysis of tissue changes. DETAILED DESCRIPTION
[0044] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0045] Example 1 Preparation of EZY-1 by Tandem Expression
[0046] The method for preparing, purifying and identifying EZY-1 comprises the following steps:
[0047] (1) Ten expression cassettes containing 48 bp repeat sequences were artificially synthesized. The first EZY-1 expression cassette had a His tag fused to its amino terminus to serve as a detection and purification sequence. NdeI and BamHI sites were designed at both ends to connect to the pET30a vector. This expression cassette contained a repeat nucleotide sequence capable of simultaneously expressing 10 EZY-1 units, with a nucleotide length of approximately 507 bp (as shown in SEQ ID NO. 2). This vector was designated pET30a-10EZY-1.
[0048] (2) pET30a-20EZY-1 was transformed into competent E. coli BL21 (DE3), and a single colony was inoculated into 5 mL LB (containing 20 mg / L kanamycin) and cultured with shaking at 37°C overnight; inoculated into 50 mL LB (containing 20 mg / L kanamycin) at a ratio of 1:50, and cultured with shaking until OD600 reached 0.6. IPTG was added at a final concentration of 0.08 mmol / L and cultured for another 4 h. The cells were collected and the expression products were detected by 10% SDS-PAGE. The results are shown in Figure 2. Figure 1 .
[0049] (3) The expression product was purified using a His affinity chromatography column. The purified product was hydrolyzed with prolyl endopeptidase (PEPs). In theory, the EZY-1 unit can be completely released to obtain complete EZY-1. The peptide chain generated by one expression frame can theoretically produce 10 complete and independent EZY-1s that are completely consistent with the natural sequence. Prolyl endopeptidase (PEP) provided by Beijing Xiasheng Enzyme Biotechnology Co., Ltd. was used for specific enzymatic cleavage reaction. The enzyme solution concentration was 12.4μg / μL after BCA protein quantitative detection. When establishing the enzymatic hydrolysis system, the target protein sample and PEP were mixed at a ratio of 100:1 (mass ratio) and reacted at a constant temperature of 37℃ for 20min. In order to accurately control the enzymatic hydrolysis process, pre-cooled trifluoroacetic acid (TFA) was immediately added to a final concentration of 0.2% (v / v) after the reaction was completed to terminate the enzymatic cleavage reaction. Store in a -20℃ refrigerator until subsequent high-performance liquid chromatography analysis. The hydrolysis mixture was collected and purified by preparative high performance liquid chromatography (HPLC) and then freeze-dried to obtain the EZY-1 polypeptide. The product was sequenced by HPLC-MS. Figure 2 and Figure 3 HPLC conditions: Chromatographic system: LC220 (Shanghai Instrument and Electronics Analytical Technology Co., Ltd.), Sharpsil-U C18 column (250 × 4.6 mm, 5 μm), mobile phase: 0.07% trifluoroacetic acid / 30% acetonitrile (v / v), flow rate: 1.0 mL / min, detection wavelength: 220 nm, column temperature: 30°C, injection volume: 20 μL. Mass spectrometry conditions: nanometer source, scan mode: positive mode; capillary voltage: 1.4 kV; capillary temperature: 30°C; collision energy: 30%; ion energy: 1 V; mass scan range: 200–2000 m / z.
[0050] Example 2 Scald model experiment
[0051] (1) Prepare a repair gel with the following formula: 5% carbomer 940, 15% glycerol, 15% propylene glycol, 0.5% menthol, and mix with purified water to make a volume of 100 ml. Sterilize at 121°C for 15 min, add 300 mg of the EZY-1 polypeptide obtained above, and mix thoroughly. Mix thoroughly to obtain a scar prevention and repair gel containing EZY-1.
[0052] (2) Rabbit skin burn repair experiment
[0053] A rabbit model of deep second-degree burns was established: the rabbits were anesthetized with 3.8% sodium pentobarbital at a dose of 1 kg / ml, their limbs and head were fixed, and the fur on their backs was shaved. A constant-temperature burn instrument was used, and the probe was heated to 100°C. The probe was in contact with the skin on both sides of the back spine for 10 seconds with a pressure of 500 g to establish a deep second-degree burn model. After the model was established, the wound was cooled and disinfected. The left wound (control group) was given simple disinfection care every day, and the right wound (treatment group) was given simple disinfection + gel dressing (applied once a day to cover the wound with gel) for care. The wound healing status was observed and recorded every day and photographed until the wound was completely healed.
[0054] This study will use EZY-1 as the core material and add auxiliary materials to prepare hydrogel dressings. A constant temperature burn instrument will be used to establish a deep second-degree burn model on the rabbit back skin. Each rabbit's own wound will be used as a control. The wound on the left side of the back will receive daily disinfection and care, while the wound on the right side will be disinfected and given EZY-1 hydrogel dressings in groups for care once a day, with 5 rabbits in each group.
[0055] The wound healing process was continuously observed. The results showed that after EZY-1 hydrogel dressing care, the wound repair speed and the effective inhibition of scar proliferation were better than those of the control group ( Figure 4 ).
[0056] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A method for preparing the Eucheuma peptide EZY-1 in a tandem expression mode, characterized in that: The specific steps are as follows: the open reading frame sequence shown in SEQ ID NO.2 is connected to the vector pET30a through the NdeI and BamHI double enzyme sites, and after transformation, induction, purification, and hydrolysis, the amino acid sequence of the Eucheuma peptide EZY-1 shown in SEQ ID NO.1 is obtained.
2. Eucheuma peptide EZY-1 prepared by the method according to claim 1.
3. Use of the Eucheuma peptide EZY-1 prepared by the method according to claim 1 in the preparation of scar prevention and repair gel.