CRISPR / Cas9 plasmid taking Leu2 gene as selection marker

Abstract

The invention provides a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 plasmid taking a Leu2 gene as a selection marker, and belongs to the technical field of gene engineering. According to the CRISPR / Cas9 plasmid developed by the invention, Cas9 protein and components required for transcription of sgRNA are constructed on one plasmid, and the complete CRISPR / Cas9 system assembly can be realized only by one-step construction. And the plasmid is used for knocking out an endogenous gene Yl4HPPD (YALI1B28454g) of the yarrowia lipolytica, and meanwhile, an exogenous gene EcaroGS180F from escherichia coli is introduced, so that the betacyanin production capacity of the strain BE12 is further improved. According to the invention, exogenous gene knock-in is successfully realized, the high-yield betacyanin strain BE26 is obtained, and the total yield of betacyanin is 66.1 mg / L after the strain is cultured in an SC liquid culture medium for 48 hours.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a CRISPR / Cas9 plasmid using the Leu2 gene as a screening marker and its application. Background Art

[0002] Knocking out endogenous genes is often performed using homologous recombination assisted by Clustered regularly interspaced short palindromic repeats (CRISPR). This experiment used the second type II CRISPR / Cas9 system (Wu YK, Liu YF, Lv XQ, et al. Applications of CRISPR in a microbial cell factory: from genome reconstruction to metabolic network reprogramming [J]. ACS Synthetic Biology, 2020, 9 (9): 2228-2238.), in which Cas9 protein induces double-strand breaks (DSBs) on the target DNA, and the addition of a suitable donor causes synthesis-dependent strand annealing (SDSA) to complete the conservative homologous recombination repair process (Puchta H. Repair of genomic double-strand breaks in somatic plant cells by one-sided invasion of homologous sequences [J]. Plant Journal,1998,13(3):331-339.).

[0003] The process is divided into the following three stages (Sternberg SH, Redding S, Jinek M, et al. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9[J]. Nature, 2014, 507(7490):62-67.):

[0004] 1. Targeting: Relying on complementary pairing between CRISPR RNA (crRNA) and target DNA. Trans-activating crRNA (tracrRNA) fuses with crRNA to form sgRNA, which the Cas9 protein can bind to and localize to the target sequence.

[0005] 2. Recognition and cutting: After Cas9 binds to sgRNA, it recognizes the protospacer adjacent motif (PAM, usually "NGG") of the target DNA, and cuts the DNA chain complementary to the crRNA through its HNH structure, while the RuvC domain cuts the non-complementary chain to generate a blunt-ended double-strand break.

[0006] 3. Editing basis: SDSA is performed based on the donor to complete the mutation, knockout of endogenous genes or introduction of exogenous genes.

[0007] The construction of this plasmid was based on the CRISPR / Cas9 plasmid developed in our laboratory with the Ura3 gene as the screening tag (Zhang Jinlai. Construction and optimization of fatty alcohol and triterpenoid high-yielding Yarrowia lipolytica [D]. Tianjin: Tianjin University, 2019.), and the pWLH plasmid (Wang Luxin. Screening of new targets for furfural and acetic acid tolerance in the whole genome of Yarrowia lipolytica based on CRISPRi library [D]. Tianjin: Tianjin University, 2022.).

[0008] Pyomelanin is a tyrosine bypass competitive product endogenously present in Yarrowia lipolytica. Its synthesis requires the consumption of 4-hydroxyphenylpyruvic acid (4HPP), a key precursor for tyrosine synthesis. Studies have successfully knocked out this gene to improve the production capacity of betaine microbial cell factories in Yarrowia lipolytica (Thomsen PT, Meramo S, Ninivaggi L, et al. Beet red food colorant can be produced more sustainably with engineered Yarrowia lipolytica[J]. Nature Microbiology, 2023, 8(12): 2290-2303.)(Jiang W, Wang SB, Avila P, et al. Combinatorial iterative method for metabolic engineering of Yarrowia lipolytica: application for betanin biosynthesis[J]. Metabolic Engineering, 2024, 86: 78-88.). Summary of the Invention

[0009] The CRISPR / Cas9 plasmid developed by the present invention constructs the components required for Cas9 protein and sgRNA transcription on a single plasmid, and a complete CRISPR / Cas9 system can be assembled in just one step. The plasmid was used to knock out the endogenous lipolysis gene Yl4HPPD (YALI1B28454g) and introduce the exogenous gene EcaroG from Escherichia coli. S180F The betalain production capacity of the strain was further improved.

[0010] The technical solution of the present invention mainly includes the following three aspects:

[0011] 1. A CRISPR / Cas9 plasmid with the Leu2 gene as a selection marker.

[0012] 2. A simple method for disrupting Yarrowia lipolytica cells to release intracellular water-soluble substances.

[0013] 3. A strain BE26 with the ability to stably and highly produce betalain.

[0014] Development of a new CRISPR / Cas9 plasmid using the Leu2 gene as an auxotrophic screening marker

[0015] The present invention uses the independently constructed plasmid pBE05 (pWLH-Cas9-BtgZⅠ-sgRNA-Leu2-Amp R ) for gene editing experiments. This plasmid is characterized by integrating the Cas9 protein gene, the tracrRNA sequence, and the crRNA spacer sequence into one plasmid, so only one plasmid is needed for transformation. Specifically, it includes:

[0016] Efficient construction: The step-by-step Golden Gate method was used to efficiently and quickly construct the CRISPR / Cas9 plasmid, and the specific IIS-type nuclease BtgZⅠ was selected to avoid internal enzyme recognition sequences.

[0017] Plasmid shuttling: Efficient and rapid construction in E. coli. Once verified, the construct can be transformed into Yarrowia lipolytica. Combined with the appropriate donor sequence, endogenous gene knockout and exogenous gene knock-in can be achieved. Plasmid elimination is also convenient, allowing for rapid regeneration of the Leu2 auxotrophic selection marker.

[0018] Technical effect: A new CRISPR / Cas9 plasmid pBE05 (SEQ ID No.1) was obtained.

[0019] [2] Inhibit bypass metabolism and increase shikimate flux to increase tyrosine metabolic flux and increase betacyanin production

[0020] Using BE12 as the chassis strain, the newly developed plasmid pBE05 was combined with the Yl4HPPD upper and lower arm sequences and the exogenous gene EcaroG S180F By assembling large fragments as donor sequences, the key enzymes of bypass metabolism were knocked out while increasing the metabolic flux of the shikimate pathway. A new method for detecting the total production of betalains in Yarrowia lipolytica was developed, and a high-yield betalain strain BE26 was obtained.

[0021] Target selection: Knockout of the key endogenous gene Yl4HPPD for pyomelanocortin synthesis and in situ introduction of the exogenous gene EcaroG S180F , that is, the expression cassette of Yl4HPPD was retained to further improve the tyrosine synthesis flux.

[0022] EcaroG S180F The amino acid sequence is SEQ ID No.24; the nucleotide sequence is SEQ ID No.25.

[0023] Betalain total yield detection: A simple and efficient method for disrupting Yarrowia lipolytica cells to release intracellular betalain was developed. The effects of methanol, ethanol, isopropanol, and water on the disruption were compared horizontally, and methanol was selected as the most suitable solvent for disruption.

[0024] Technical effect: The exogenous gene was successfully knocked in, and a high-yield betalain strain BE26 was obtained. The total betalain yield of this strain after culturing in SC liquid culture medium for 48 hours was 66.1 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The liquid phase peak diagrams corresponding to different crushing solvents;

[0026] Figure 2 Comparison of fermentation yields between BE12 and BE26;

[0027] Figure 3 The following is the pBE05 plasmid map and annotation;

[0028] Figure 4 This is the liquid chromatography peak diagram when methanol is used as the crushing solvent;

[0029] Figure 5 This is the liquid chromatography peak diagram when ethanol is used as the crushing solvent;

[0030] Figure 6 This is the liquid chromatography peak diagram when isopropanol is used as the crushing solvent;

[0031] Figure 7 This is the liquid chromatography peak diagram when water is used as the crushing solvent;

[0032] Figure 8 This is the standard curve of betalain. DETAILED DESCRIPTION

[0033] In the specific embodiment of the present invention, the test methods used in each example are as follows:

[0034] 1. 2×Phanta Max MasterMix (Dye Plus) amplification fragment components and program settings:

[0035] Table 1 Amplified fragment components and program settings

[0036]

[0037] Table 2 Gibson assembly reaction system and procedure

[0038]

[0039] 2. Yeast transformation process:

[0040] Take a single colony from four streaks of -80°C glycerol stock and inoculate it into 3 mL of liquid YPD medium. When the OD600 reaches ≈ 3.0, transfer 200 μL of the culture to 2.8 mL of liquid YPD medium for activation.

[0041] When the yeast solution grows to the logarithmic growth phase (OD600 = 0.8-1.0, about 5 × 10 6 ~2×10 7 cells / mL), and after about 3.5 to 4 hours, completely transfer the bacterial solution to a 1.5 mL EP tube and centrifuge at 4000 rpm for 1 minute to collect the bacteria; take the kit out of the 4°C refrigerator one hour in advance and place it at room temperature.

[0042] Resuspend the cells in 500 μL sterile ddH2O to wash away the residual culture medium, centrifuge at 4000 rpm for 1 min to collect the cells, then add 500 μL Solution 1 to resuspend the cells and let it stand for 20 min.

[0043] After standing, obtain competent cells. Centrifuge at 4000 rpm for 1 minute to collect the cells. Add 50 μL of Solution 2 to resuspend the cells. Then, add approximately 500 ng of plasmid or a DNA fragment larger than 1 μg, depending on the purpose of the transformation experiment. Be careful to use a high DNA concentration to avoid excessive volume addition, which may cause an imbalance in the solution ratio. After standing for five minutes, add 500 μL of Solution 3 and incubate at 28°C, 250 rpm for 3 hours.

[0044] Take 200 μL of the transformation solution and spread it on the corresponding resistance plate medium. After drying, invert it and place it in a 28°C incubator for static culture. Store the remaining bacterial solution in a 4°C refrigerator.

[0045] YPD medium: Dissolve 22g / L glucose monohydrate, 20g / L peptone, and 10g / L yeast extract in ddH2O, bring to volume, and autoclave at 115°C for 15 minutes. If preparing a solid medium, add 20g / L agar powder.

[0046] SC screening medium: 22 g / L glucose monohydrate, 6.7 g / L amino-free yeast nitrogen base (YNB), 2 g / L tetraamino acid powder (AA powder), 0.02 g / L tryptophan (Trp), 0.02 g / L histidine (His), add 0.1 g / L leucine (Leu) and 0.02 g / L uracil (Ura) as needed, add ddH2O to the volume and adjust the pH to 6.0 with 2 M NaOH solution. Sterilize at 115°C and high temperature for 15 min.

[0047] Table 3 AA powder formula

[0048] Ingredients (dosage / g) Ingredients (dosage / g) Ingredients (dosage / g) Ingredients (dosage / g) Adenine (0.5) Glycine (2) Alanine (2) Lysine (2) Arginine (2) Methionine (2) Aspartic acid (2) p-Aminobenzoic acid (2) Asparagine (2) Phenylalanine (2) Cysteine ​​(2) Proline (2) Glutamine (2) Serine (2) Glutamate (2) Threonine (2) Isoleucine (2) Tyrosine (2) Valine (2) Inositol (2)

[0049] 3. Betalain standard: Weigh 2.988 g of red beetroot extract diluted with dextrin in a dark place and dissolve it with a small amount of ddH2O by ultrasonication. Be careful not to overheat during the ultrasonication process. Then use a 25 mL volumetric flask to make up the volume. 1 g of this extract standard contains 0.837 mg of betanin and isobetanin, respectively (Thomsen PT, Meramo S, Ninivaggi L, et al. Beet red food colorant can be produced more sustainably with engineered Yarrowia lipolytica[J]. Nature Microbiology, 2023, 8(12): 2290-2303.). The resulting mother solution is 100 mg / L, which is divided into 2 mL / tube and placed in a -20°C refrigerator for use. It has been verified that there is no difference in liquid phase detection between the freshly prepared mother solution and the mother solution thawed after being frozen at -20°C. It should be noted that this standard product contains a very low proportion of active ingredient, requiring the addition of a large amount of powder, which affects the final volume. Therefore, further increasing the stock solution concentration is difficult. Sample preparation should be fully diluted to meet the standard curve coverage range. For use, perform a gradient dilution according to the table below and mix thoroughly. After filtering through a 13mm x 0.22μm aqueous mixed cellulose (MCE) filter, it can be used as an HPLC standard.

[0050] Table 4 Statistics of mother solution preparation and working solution

[0051] Stock solution dosage / μL <![CDATA[Volume of ddH2O / μL]]> Concentration after dilution mg / L 1000 0 100 800 200 80 600 400 60 400 600 40 200 800 20

[0052] 4. Shake flask fermentation: First, isolate single colonies on SC solid medium. Then, select three single colonies and inoculate them into 3 mL of liquid SC as the primary culture. After 24 hours of culture, transfer the culture once to reduce the occurrence of excessive parallel differences caused by lipolysis heterogeneity. After another 24 hours, measure the OD660 to calculate the transfer volume (if not specified, the initial OD660 = 0.05). Then, transfer the corresponding bacterial liquid according to the transfer volume into a 250 mL unbaffled Erlenmeyer flask containing 50 mL of liquid medium. Incubate at 28°C, 250 rpm for 48 hours, and then sample.

[0053] Extracellular detection: 1 mL of fermentation broth was centrifuged at 11,000 × g for 10 min (Centrifuge 5430R, Eppendorf) in a 1.5 mL EP tube. The supernatant was filtered through a 13 mm*0.22 μm aqueous mixed cellulose (MCE) filter and dispensed into 1.5 mL liquid sample bottles with inner liner tubes. Water was added for dilution as needed during sampling. For example, for a two-fold dilution, 0.5 mL of fermentation broth was added to 0.5 mL of water.

[0054] Total volume determination: Pre-add approximately 200 μL of quartz sand and 0.5 mL of chromatography-grade methanol to a 1.5 mL EP tube. Add 0.5 mL of fermentation broth to the methanol. Seal the EP tube with parafilm and vortex at 3200 rpm for 20 minutes. Remove the tube and centrifuge at 11,000 × g for 10 minutes. Pass the supernatant through a 13 mm x 0.22 μm aqueous mixed cellulose (MCE) filter and aliquot into 1.5 mL liquid sample vials placed in inner tubes.

[0055] HPLC parameters and methods:

[0056] Chromatographic system: Shimadzu LC-20AT liquid chromatography system

[0057] Detector: SPD-20A UV detector (detection wavelength 535nm)

[0058] Chromatographic column: C18 reverse phase column (Shim-pack HPLC Packed Column, 250 mm × 4.6 mm, 5 μm)

[0059] Mobile phase: methanol: water (containing 0.1% chromatography grade formic acid) volume ratio = 20:80

[0060] Flow rate: 1.0 mL / min

[0061] Column temperature: 28°C

[0062] Injection volume: 10 μL

[0063] Detection time: 20 minutes

[0064] A standard curve was prepared for each test, and the R2 of the standard curve obtained from at least five points was required to be greater than 0.999.

[0065] 5. Verify yeast transformants: Once transformants have grown on the transformation plate, if the transformation was a plasmid, you can directly pick the transformants and proceed to the next experimental step. If the goal is genomic integration, a bacterial test is required. First, select a certain number of single colonies and replicate them on new plates with the corresponding resistance medium. This step aims to eliminate the interference of false positive transformants containing free fragments in the cells. After colonies have grown on the replicate plates, take an appropriate amount of bacteria and add them to 30-50μL of 20mM NaOH solution. Run a thermal lysis reaction in a PCR instrument to disrupt the cells and obtain genomic DNA (gDNA).

[0066] Table 5 Thermal cracking reaction program

[0067]

[0068] Perform colony-based PCR using the resulting gDNA as a template using DNA polymerase. After completion, a portion of the PCR reaction solution is collected and verified for bands by gel electrophoresis. Prepare a 50 μL reaction system using the reaction solution corresponding to the correct result as a template, select appropriate primers, and submit for testing. After verifying the correct colony, separate four lines of the corresponding numbered colonies on the replica plate onto YPD or SC plates for purification in preparation for the next experiment.

[0069] Plasmid elimination: Bacteria transformed with plasmids often need to use a selection marker (usually a nutritional deficiency marker) to eliminate the plasmid. That is, the bacteria that need to eliminate the plasmid are inoculated into fresh YPD culture medium, cultured at 28°C and 250rpm for 24h to 36h, then a small amount of bacterial liquid is taken out and purified by four-zone streaking on a YPD plate. Then, the single colony is plated on a new YPD plate and the corresponding nutritional deficiency plate. The strain that grows on the YPD plate but not on the deficiency plate is the strain that has completed plasmid elimination.

[0070] Table 6 Two-step Overlap PCR steps

[0071]

[0072] Example 1

[0073] [1] Development of a new CRISPR / Cas9 plasmid using the Leu2 gene as a nutrient-deficient screening marker

[0074] 1. Introduction of the Cas9 minimal transcription unit into the pWLH plasmid: Using the pWLH plasmid as a template, the upstream primer pWLH-CRI-F (SEQ ID No. 2: ctcgaaggctttagctagatactatgtgctcaaggttgc) and the downstream primer (SEQ ID No. 3: tactttccgaaaaccggc) amplified a length of 6345 bp, and using the CRI-Part2 developed by Zhang Jinlai as a template, the upstream primer: op-Cri-F (SEQ ID No. 4:

[0075] gccggttttcggaaagtaatcttcgaaggtacccgaat), downstream primer op-Cri-R (SEQ ID No.5:

[0076] The amplified length was 5468 bp (tctagctaaagccttcgag). Gibson assembly was performed using a seamless cloning kit (Nearshore Protein) to obtain the basic plasmid pWLH-Cas9-sgRNA-leu2-Amp.

[0077] Table 7 Sequencing primers

[0078] v-Cas9-1F GAGCAGGCTGAGAACATC SEQ ID No.26 v-sgRNA-2R TGGCTAACGGCGAGAT SEQ ID No.27 v-CRI-6R TAATGGGAGGCGAGGT SEQ ID No. 28 new-v-CRI-5R CACGACAGCGTTCAGGTAG SEQ ID No. 29 v-Cas-mid-F GTGTCGGCCCATCACC SEQ ID No.30 v-CRI-4F AGAAGAAGGCTATTGTGGAT SEQ ID No.31 v-CRI-3F TCCTCAAGGCTCTGGTCC SEQ ID No.32 v-CRI-2R TCGGTTCCGTCCATCTT SEQ ID No.33 v-Cas9-2R CGCAGGTGGTAGATGGTG SEQ ID No.34 v-Cas9-2F GCCAACTGGTAAATAAATGA SEQ ID No.35

[0079] 2. Introducing the BtgZⅠ restriction site and simultaneously introducing point mutations to avoid internal sequence interference: Using the basic plasmid as a template, the upstream primer Cas-1-F (SEQ ID No. 6: GGCGTAATCATGGTCATAGC) and the downstream primer Cas-1-R (SEQ ID No. 7: aaatatgttgcatcgctttgcgatgttccgtctggAACCTGCGCCGACCCG) were used to amplify 2642 bp to obtain fragment 1, and the upstream primer Cas-2-F (SEQ ID No. 8: caaagcgatgcaacatatttGTTTTAGAGCTAGAAATAGCAAGT) and the downstream primer Cas-2-R (SEQ ID No. 9: tctctgcacgagcacattgccaacctggccggct) were used to amplify 2689 bp to obtain fragment 2, where the ATC in the coding sequence for isoleucine at position 724 in the Cas9 protein sequence was mutated to ATT. The upstream primer Cas-3-F (SEQ ID No. 10: atgtgctcgtgcagagag) and the downstream primer Cas-3-R (SEQ ID No. 11: GCTATGACCATGATTACGCC) were used to amplify 6520 bp to obtain the vector. Fragments 1 and 2 underwent Gibson assembly with the vector to obtain plasmid pBE05. See the map for details. Figure 3 The BtgZⅠ recognition sequence was introduced. This enzyme is characterized by cleavage 10 bp downstream of the recognition site. Separating the recognition sequences by aaa and internalizing the two end recognition sequences reduces steric hindrance between the two enzymes while enabling seamless manipulation of the original sgRNA expression cassette without introducing additional bases. The enzyme recognizes the GCGATG sequence. See the table below for sequencing primers.

[0080] Table 8 Sequencing primers

[0081] v-BtgZ-1F ATCTCAAATCGGACACTTCT SEQ ID No.36 v-BtgZ-1R AGAAGTGTCCGATTTGAGAT SEQ ID No.37 v-BtgZ-2F CGCCAGTAGTTCTTCATCT SEQ ID No.38 v-BtgZ-2R GACAACGGCTCTATCCC SEQ ID No.39 v-BtgZ-3F CACAGATGCGTAAGGAGAA SEQ ID No.40 v-BtgZ-3R TACAGCGTGAGCATTGAGA SEQ ID No.41

[0082] 3. Use of pBE05:

[0083] Design insert primers: Use (http: / / crispor.tefor.net / ) to design a spacer sequence. Enter the target gene (starting at the end of the transcription start codon, no more than 2300bp, and omitting introns). Select the Yarrowia lipolytica CLIB122 strain and the Cas9 protein from Streptococcus pyogenes. The sgRNA design results will be output. Select a high-scoring sequence that is as close to the N-terminus as possible and has low off-target efficiency. Add "GGTT" to the 5' end of this sequence as the upstream primer and "AAAC" to the 5' end of the complementary sequence as the downstream primer. Select five candidate sequences for construction.

[0084] Annealing Insert Construction: Add 2 μL each of the upstream and downstream primers (synthesized by Beijing Qingke, prepared using dry powder at a concentration of 100 μM) and 36 μL of 30 mM HEPES buffer (pH 7.8) to a PCR tube. Run the annealing program: maintain at 95°C for 5 minutes, then decrease to 4°C at a rate of 0.1°C / s. Remove the insert and dilute the system with 120 μL of ddH2O. HEPES powder was from Genview.

[0085] Since BtgZⅠ has an optimal operating temperature of 60°C and cannot be used in the same system with T4 ligase, the digestion and ligation steps are performed separately. For the digestion system, place a PCR tube on ice, add 100-200 ng of pBE05, 1 μL of 10× rCutsmart Buffer, 0.5 μL of BtgZⅠ, and then add ddH2O to make up to 10 μL. Mix well and place in a PCR instrument at 60°C for 1 hour to complete the digestion.

[0086] Ligation system: Place 5 new PCR tubes on ice, add 1.5 μL of digested product, 0.5 μL of T4 Ligase, 1 μL of 10× T4 Ligase Buffer, and then add 0.5 μL of each of the five inserts. Add 7 μL of ddH2O, mix well, and place in a PCR instrument at 16°C for 1 hour to achieve ligation. Do not open the heated lid of the PCR instrument during the process.

[0087] Complete enzyme digestion and inactivation procedure: After the ligation reaction, the PCR tube was opened with a heated lid and incubated at 60°C for 10 minutes, then at 80°C for 20 minutes and then maintained at 16°C to complete the CRISPR / Cas9 plasmid construction. The resulting final reaction solution was transformed into Escherichia coli, coated on Amp-resistant plates, and sequenced using m-Cas-spacer-R (SEQ ID No. 42: GAGATAGCAACGGGTAGTC).

[0088] This method can be used to transform Yarrowia lipolytica and the corresponding donor simultaneously. Homologous recombination arms of 500-1000 bp are generally selected. Transformants are grown, genotypes are verified, and plasmids are removed.

[0089] [2] Inhibit bypass metabolism and increase shikimate flux to increase tyrosine metabolic flux and increase betacyanin production

[0090] First, a CRISPR / Cas9 plasmid was constructed. According to the above process, the upstream primer for constructing Insert was SEQ ID No. 12: GGTTGACCACGTCCACTGGTACGT, and the downstream primer was SEQ ID No. 13: AAACACGTACCAGTGGACGTGGTC. That is, the spacer sequence for the constructed transcriptional sgRNA was SEQ ID No. 43: GACCACGTCCACTGGTACGT, and the PAM sequence was TGG. Then, the repair homology arm was selected and the Yarrowia lipolytica Po1f genome was used as a template to amplify the upstream homology arm. The upstream primer was 4hppd-down-R (SEQ ID No. 14: TATTGACTGCGCGGGGTCAT), and the downstream primer was op-4hppd-down-F (SEQ ID No. 15: acaaacaaataaccaccaacaacatgaattatcagaacgacgatt). The PCR product length was 520 bp. The upstream primer for amplifying the downstream homology arm was op-Arog-homoup-R (SEQ ID No. 16: taaaagcgcgtcgcgggtaatcatctctagagacgaggcgtg), and the downstream primer was 4hppd-up-F (SEQ ID No. 17: aaaaccaatcgttgcggaca). The PCR product length was 520 bp, and then it was ligated with the fragment EcaroGS180F by overlap extension PCR (Overlap PCR) to form a large fragment. Fragment EcaroG S180FUsing the Escherichia coli genome as a template, the upstream primer for the first segment was AroG-F (SEQ ID No. 18: atgaattatcagaacgacgatt), and the downstream primer was aroG (S180F)-R (SEQ ID No. 19: aagccctgatgccagttcg), and the PCR product length was 537 bp; the upstream primer for the second segment was op-aroG (S180F)-F (SEQ ID No. 20: cgaactggcatcagggcttttctgtccggtcg), and the downstream primer was AroG-R (SEQ ID No. 21: ttacccgcgacgcgctttta), and the PCR product length was 535 bp; these two fragments were also connected by overlap.

[0091] After obtaining the knockout plasmid and repair fragment, the cells were transformed using BE12 as the chassis and plated onto SC-Leu plates. Gene validation primers used were: 4hppd-down-R, m-Arog-1F (SEQ ID No. 22: ttcagccatgctaactcg), v-IN002-Arog-R (SEQ ID No. 23: cccatcacgccaata), and 4hppd-up-F. Correctly identified transformants were streaked onto SC plates to obtain single colonies. The strain was then fermented in shake flasks and designated BE26. Samples were collected after 48 hours.

[0092] Because measuring intracellular yield alone is difficult, this study considered developing a new method for measuring total yield, which could be derived by subtracting the intracellular yield from the extracellular yield. The mechanical shear force of quartz sand was considered, combined with vigorous vortexing of the disruption solvent to disrupt the cells and release intracellular betacyanin. The choice of disruption solvent is crucial for product detection. Considering the product's water solubility, methanol, ethanol, isopropanol, and water were used as disruption solvents, mixed with the fermentation broth in a 1:1 ratio, added to a 1.5 mL EP tube filled with quartz sand, and vortexed for 20 minutes. Liquid chromatography analysis of the final total yield revealed that only the sample with methanol disruption had a peak time that corresponded to the standard. The presence of isopropanol in disruption shifted the retention time of betacyanin by 0.2 minutes and split into two peaks. The second peak, judging by its peak area, likely contained isobetacyanin, indicating that these disruption conditions could not separate the two. The presence of ethanol in disruption shortened the retention time by approximately 1.5 minutes, resulting in a single peak. The presence of water resulted in only a small amount of intracellular product diffusion, rendering the disruption ineffective. And by calculating the peak area, it was found that the total betalain yield detected using methanol as the crushing solvent was 20% higher than that of ethanol and isopropanol. This shows that methanol can crush yeast more thoroughly and further release the intracellular product. Therefore, the total yield was tested using methanol as the crushing solvent. (See the schematic diagram. Figures 4 to 8 ).

[0093] After 48 h of culture in SC medium, the extracellular betalain yield of BE26 was 33.1 mg / L and the total betalain yield was 66.1 mg / L (see data in the figure). Figure 2 ).

[0094] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A CRISPR / Cas9 plasmid pBE05 with the Leu2 gene as a screening marker, characterized in that: The nucleotide sequence of the CRISPR / Cas9 plasmid pBE05 is shown in SEQ ID No.

1.

2. The method for constructing the CRISPR / Cas9 plasmid pBE05 according to claim 1, characterized in that: The following steps are involved: (1) Using the pWLH plasmid as a template, the first fragment was amplified using the upstream primer pWLH-CRI-F and the downstream primer pWLH-CRI-R; Using CRI-Part2 as a template, the second fragment was amplified using the upstream primer op-Cri-F and the downstream primer op-Cri-R; the nucleotide sequence of the upstream primer pWLH-CRI-F is shown in SEQ ID No. 2, and the nucleotide sequence of the downstream primer pWLH-CRI-R is shown in SEQ ID No. 3; the nucleotide sequence of the upstream primer op-Cri-F is shown in SEQ ID No. 4, and the nucleotide sequence of the downstream primer op-Cri-R is shown in SEQ ID No. 5; (2) Assemble the first and second fragments to obtain the basic plasmid pWLH-Cas9-sgRNA-leu2-Amp; (3) Using the basic plasmid pWLH-Cas9-sgRNA-leu2-Amp as a template, the third fragment was amplified using the upstream primer Cas-1-F and the downstream primer Cas-1-R; the fourth fragment was amplified using the upstream primer Cas-2-F and the downstream primer Cas-2-R; the fifth fragment was amplified using the upstream primer Cas-3-F and the downstream primer Cas-3-R; the nucleotide sequence of the upstream primer Cas-1-F is shown in SEQ ID No.6, and the nucleotide sequence of the downstream primer Cas-1-R is shown in SEQ ID No.7; the nucleotide sequence of the upstream primer Cas-2-F is shown in SEQ ID No.8, and the nucleotide sequence of the downstream primer Cas-2-R is shown in SEQ ID No.9; the nucleotide sequence of the upstream primer Cas-3-F is shown in SEQ ID No.10, and the nucleotide sequence of the downstream primer Cas-3-R is shown in SEQ ID No.11; (4) Assemble the third fragment, the fourth fragment, and the fifth fragment to obtain the CRISPR / Cas9 plasmid pBE05.

3. The construction method according to claim 2, characterized in that: The assemblies described in step (2) and step (4) are both Gibson assemblies.

4. Use of the CRISPR / Cas9 plasmid pBE05 according to claim 1 in the one-step assembly of a complete CRISPR / Cas9 system.

5. A CRISPR / Cas9 system for gene editing, characterized in that Including sgRNA upstream primer and downstream primer designed according to the target gene, and annealing the sgRNA upstream primer and downstream primer to construct Insert; The CRISPR / Cas9 plasmid pBE05 according to claim 1 is digested with BtgZⅠ and then connected to the Insert to obtain a CRISPR / Cas9 system for gene editing.

6. The CRISPR / Cas9 system according to claim 5, characterized in that The 5' end of the upstream primer of the sgRNA includes GGTT, and the 5' end of the downstream primer includes AAAC.

7. A method for increasing betalain production in Yarrowia lipolytica, characterized in that: The following steps are involved: (1) amplifying Insert using an upstream primer with a nucleotide sequence such as SEQ ID No. 12 and a downstream primer with a nucleotide sequence such as SEQ ID No. 13; (2) Using the Yarrowia lipolytica Po1f genome as a template, the upstream homology arm was amplified using the upstream primer shown in SEQ ID No. 14 and the downstream primer shown in SEQ ID No. 15; the downstream homology arm was amplified using the upstream primer shown in SEQ ID No. 16 and the downstream primer shown in SEQ ID No. 17; (3) The upstream homology arm, downstream homology arm and fragment EcaroG S180F Overlap PCR was used to connect the fragments into a large fragment, in which the fragment EcaroG S180F Using the Escherichia coli genome as a template, the first segment was amplified using the upstream primer shown in SEQ ID No. 18 and the downstream primer shown in SEQ ID No. 19, and the second segment was amplified using the upstream primer shown in SEQ ID No. 20 and the downstream primer shown in SEQ ID No.

21. The first and second segments were connected by Overlap PCR; (4) inserting the insert into the CRISPR / Cas9 plasmid pBE05 described in claim 1 to construct a knockout plasmid; (5) The knockout plasmid described in step (4) and the large fragment described in step (3) were transformed into BE12.

8. The method according to claim 7, characterized in that: After the transformation in step (5), the transformed strain is plated on an SC-Leu plate medium and verified using a primer pair consisting of SEQ ID No. 14 and SEQ ID No. 22, and a primer pair consisting of SEQ ID No. 23 and SEQ ID No.

15.

9. The high-betalain-producing strain BE26 constructed using the method according to claim 7 or 8.

Images