Method for rapidly obtaining high-yield betacyanin yarrowia lipolytica strain

Abstract

The invention provides a method for rapidly obtaining a high-yield betacyanin yarrowia lipolytica strain, and belongs to the technical field of genetic engineering. According to the invention, the chassis BE00 suitable for producing tyrosine derivatives is constructed, the construction process of the yarrowia lipolytica chassis in which a high-copy betacyanin pathway gene is externally introduced is accelerated, and a stable and high-yield betacyanin production chassis BE12 is obtained.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a method for rapidly obtaining a Yarrowia lipolytica strain with high betalain yield. Background Art

[0002] In 2023, Irina et al. completed the construction of a high-yield betalain microbial cell factory in Yarrowia lipolytica for the first time (Thomsen PT, Meramo S, Ninivaggi L, et al. Beetred food colorant can be produced more sustainably with engineered Yarrowia lipolytica[J]. Nature Microbiology, 2023, 8(12): 2290-2303.). The researchers screened pathway genes from different sources and finally introduced EvTYH W13I , MjDOD and BvSGT2 successfully constructed the betalain pathway and achieved a yield of about 10 mg / L. Then, referring to the previous experience of Yarrowia lipolytica in producing tyrosine derivatives, the mutant overexpression of YlARO4 was used. K221L and YlARO7 G141S The method increased the yield to 21.7 mg / L. The researchers then overexpressed the synthesis pathway genes, increasing the yield of the two-copy chassis to 47.5 mg / L. They then explored overexpressing tyrosine synthesis precursor genes. The results showed that overexpression of YlARO1-3 had a negative impact on betalain production, not an increase. Furthermore, supplementing the culture medium with L-tyrosine had no significant effect on increasing production, suggesting that the tyrosine supply was already high enough. Therefore, the researchers introduced three copies of the pathway genes, bringing the yield to 63.3 mg / L.

[0003] Traditional genomic library construction technology usually relies on a single transformation operation, which makes it difficult to efficiently generate a large-scale diversity strain library in a short time, and there is an upper limit on the efficiency of exogenous fragment integration. Especially in eukaryotic organisms such as lipolytica, homologous recombination is inefficient, time-consuming and labor-intensive. Therefore, considering the strong ability of non-homologous end joining (NHEJ) of Yarrowia lipolytica, the truncated Ura3 gene promoter developed by Bai Qiuyan (Bai QY, Cheng S, Zhang JL, et al. Establishment of genomic library technology mediated by non-homologous end joining mechanism in Yarrowia lipolytica [J]. Science China Life Sciences, 2021, 64 (12): 2114-2128.) increases the screening pressure to introduce a high-copy gene multiple-round iterative transformation method. This study first enhanced the endogenous NHEJ pathway, and then introduced a multi-copy gene using the Ura3 nutritional deficiency selection marker with a truncated promoter to reduce expression intensity. It was verified by two applications: green fluorescent protein introduction and lycopene production. Summary of the Invention

[0004] The present invention provides a method for obtaining a Yarrowia lipolytica strain capable of increasing the metabolic flux of the shikimate pathway:

[0005] Using Yarrowia lipolytica Po1f as the base strain, and addressing the problem of insufficient metabolic flux in its natural synthesis of aromatic compounds, we overexpressed key enzyme genes in the shikimate pathway through genetic engineering, thereby improving the supply capacity of tyrosine precursors and achieving efficient synthesis of heterologous aromatic products (such as betacyanin). Specifically,

[0006] Target selection: Select the endogenous gene YlARO4 K221L (encoding 3-deoxy-D-arabinoheptulose-7-phosphate synthase and YlARO7 G141S (encoding chorismate mutase), the introduction of point mutations can relieve the feedback inhibition of tyrosine and drive the metabolic flux of the shikimate pathway. Figure 1 .

[0007] Gene expression regulation: Place the above genes under a strong promoter (P TEFin 、P FBAin ) under the control of a minimum transcription unit to improve the efficiency of tyrosine synthesis.

[0008] Genome integration: The expression unit was integrated into the rDNA site of Yarrowia lipolytica using homologous recombination technology, and a stably inherited recombinant strain was obtained through the hygromycin resistance selection marker (with loxP sites on both sides).

[0009] Technical effect: Enhancing the ability of chassis strains to synthesize aromatic compounds provides an optimized strain BE00 for the large-scale production of betalain.

[0010] The present invention also provides a non-homologous end-joining library construction technology to quickly obtain a high-yield betalain chassis. The NHEJ library construction technology was applied to the construction of a betalain Yarrowia lipolytica microbial cell factory. This study expanded the scope of application and demonstrated the high efficiency of the present technology.

[0011] Using BE00 as the chassis strain, taking advantage of the efficient non-homologous end joining of Yarrowia lipolytica, an exogenous pathway gene was combined with the Ura3 nutritional deficiency marker of the truncated promoter to increase the screening pressure, thereby obtaining a high-copy number betalain-producing strain in a short time.

[0012] Target selection: The gene encoding tyrosine hydroxylase (TYH) was selected from EvTYH of Ercilla volubilis. W13I The gene encoding 4,5-DOPAdioxygenase extradiol (DOD) was selected from MjDOD of Mirabilis jalapa and the gene encoding glycosyltransferase (betanidin 5-O-glucosyltransferase, GT) was selected from BvSGT2 of Beta vulgaris to construct the betalain biosynthesis pathway. The relevant reactions are shown in the attached Figure 2 .

[0013] Gene expression regulation: Place the above genes under a strong promoter (P TEFin 、P EXp1p 、P FBAin ) driven by the construction of a minimal transcription unit to improve the efficiency of tyrosine synthesis.

[0014] Genome integration: Non-homologous end joining technology was used to randomly insert betalain biosynthesis pathway genes into the BE00 genome to achieve high-copy strain construction.

[0015] Technical effect: A high-yield betalain strain BE12 was obtained. The extracellular betalain yield of this strain was 11.0 mg / L after 48 hours of culture in SC liquid culture medium, and its multi-copy genotype was verified by real-time fluorescence quantitative PCR technology.

[0016] The technical solution adopted in the present invention is as follows:

[0017] The present invention provides a method for carrying Y1ARO4 K221L and YlARO7 G139S The recombinant plasmid pBE00 containing the minimum transcription unit of the present invention is prepared, and the nucleotide sequence of the recombinant plasmid pBE00 is shown in SEQ ID No.1.

[0018] The present invention also provides a method for constructing the above-mentioned recombinant plasmid pBE00, comprising the following steps: (1) using CYRIN002 (SEQ ID No. 2) as a template, amplifying the linear YlARO4 using the upstream primer Gib-IN002-aro4-F and the downstream primer PTEFin-R K221L vector (3415 bp);

[0019] Gib-IN002-aro4-F (SEQ ID No. 3): gcgacgaaacaagaactaataaaggaagtgtggatgggg;

[0020] PTEFin-R(SEQ ID No.4):ctgcggttagtactgcaaaa;

[0021] (2) Using the genome of Saccharomyces lipolytica Po1f as a template, upstream primer op-IN002YL-aro4-up-F and downstream primer op-aro4-K221L-R were used to amplify fragment 1 (679 bp); upstream primer overlap-aro4-K221L-F and downstream primer YL-aro4-down-R were used to amplify fragment 2 (431 bp);

[0022] op-IN002YL-aro4-up-F(SEQ ID No.5):tttgcagtactaaccgcagatgtcccgttcctcctctcc;

[0023] op-aro4-K221L-R (SEQ ID No. 6): ggtgacacccatgaagtggt;

[0024] overlap-aro4-K221L-F (SEQ ID No.7):acttcatgggtgtcaccctgcagggtgttg;

[0025] YL-aro4-down-R (SEQ ID No. 8):ttagttcttgtttcgtcgctcc;

[0026] (3) The linear YIARO4K221L vector and fragments 1 and 2 were assembled to obtain plasmid pSA01;

[0027] Preferably, the assembly is performed using the Gibson assembly technique (seamless cloning kit: Nearshore Protein) to obtain plasmid SA01, and the plasmid is verified using primers LD03in-1F, v-aro4-1F, and v-aro4-1R;

[0028] LD03in-1F (SEQ ID No. 9): cccgaattacctttcctcttct;

[0029] v-aro4-1F(SEQ ID No.10):ctgcgaccttaccgactt;

[0030] v-aro4-1R (SEQ ID No. 11): gctggcacgacaggttt;

[0031] (4) Using the genome of Saccharomyces lipolytica Po1f as a template, fragment 3 (431 bp) was amplified using the upstream primer bsaI-aro7-F and the downstream primer op-aro7-G139S-R; fragment 4 (393 bp) was amplified using the upstream primer op-aro7-G139S-F and the downstream primer bsa1-aro7-R; fragments 3 and 4 were connected to form a YlARO7 fragment with a BsaI restriction site. G139S fragment;

[0032] bsaI-aro7-F (SEQ ID No. 12): gccgcgggtctcaccagatggacttcactaaagccga;

[0033] op-aro7-G139S-R (SEQ ID No. 13): atagttctcgggctgatctc;

[0034] op-aro7-G139S-F (SEQ ID No. 14): agatcagcccgagaactattcctcggtcatgg;

[0035] bsa1-aro7-R (SEQ ID No. 15): gccgcgggtctcatttactactccaaccgccggag;

[0036] Preferably, the two fragments are joined by Overlap PCR to form a fragment with a bsaI restriction site, with a total length of 805 bp;

[0037] (5) YlARO7 G139S The fragment was assembled with CYRIN003 (SEQ ID No. 16) to form plasmid pSA02;

[0038] Preferably, the recombinant plasmid pSA02 is assembled by GoldenGate reaction, and the plasmid is verified using primers K8FB-F, v-aro7-1F and v-aro7-1R;

[0039] K8FB-F (SEQ ID No. 17): cgatgtccgagccgtgag;

[0040] v-aro7-1F(SEQ ID No.18):ctcagttctgccgttcc;

[0041] v-aro7-1R (SEQ ID No. 19): tggcacgacaggtttcc;

[0042] (6) Using pUC19 as a template, the linearized vector pUC19 (2647 bp) was amplified using the primer pair linerized-puc19-F and linerized-puc19-R;

[0043] linerized-puc19-F (SEQ ID No. 20): ctgcaggcatgcaag;

[0044] linerized-puc19-R (SEQ ID No. 21): actggccgtcgtttt;

[0045] (7) Using the Po1f genome as a template, the primer pair Gib-puc19-rDNAup-F and rDNAup-R were used to amplify the rDNAup fragment (723 bp);

[0046] Gib-puc19-rDNAup-F (SEQ ID No. 22): aaaacgacggccagtgcggccgctcgatcctaa;

[0047] rDNAup-R (SEQ ID No. 23): tggctaccttaagagagtcatag;

[0048] (8) Using pSA01 as a template, the primer pair op-rDNAup-TEFin-aro4-F and IN002-TR were used to amplify the fragment YlARO4 K221L (1884bp);

[0049] op-rDNAup-TEFin-aro4-F (SEQ ID No. 24): tgactctcttaaggtagccaagagaccgggttggcggc;

[0050] IN002-TR (SEQ ID No. 25): ctgtacgagtaagagcactagc;

[0051] (9) Using pSA02 as a template, the primer pair op-aro4-aro7-F and op-octt-Hph-R were used to amplify the fragment YlARO7 G139S (2139 bp);

[0052] op-aro4-aro7-F (SEQ ID No. 26): tagtgctcttactcgtacagacagtgtacgcagtactatagag;

[0053] op-octt-Hph-R (SEQ ID No. 27):gagcaatgatgattccctgcttcctctttgattgttccttagg;

[0054] (10) Fragment 1 rDNAup, fragment 2 YlARO4K221L, and fragment 3 YlARO7G139S were connected to obtain fragment A (4706 bp);

[0055] Preferably, the fragments are connected into complete fragments by Overlap PCR, and the amplified length is 4706 bp;

[0056] (11) Using CYRIN005 (SEQ ID No. 28) as a template, fragment B (2129 bp) was amplified using the primer pair loxp-Hph-up-F and Gib-hph-down-loxp-R;

[0057] loxp-Hph-up-F (SEQ ID No. 29): gcagggaatcatcattgctcataacttcgtataatgtatgctatacgaagttatgtcgacaccatatcatataaaac;

[0058] Gib-hph-down-loxp-R (SEQ ID No. 30): cattatacgaagttatcttcgagcgtcccaaa;

[0059] (12) Using CYRIN013 (SEQ ID No. 31) as a template, the primer pair loxp-rDNAdown-F and Gib-rDNAdown-puc19-R was used to amplify fragment C (656 bp);

[0060] loxp-rDNAdown-F (SEQ ID No. 32): gctcgaagataacttcgtataatgtatgctatacgaagttataatgcctcgtcatctaattag;

[0061] Gib-rDNAdown-puc19-R (SEQ ID No. 33): cttgcatgcctgcagcttcggtatgataggaagagc;

[0062] (13) Linearized pUC19 was assembled with fragments A, B, and C, and the plasmid pBE00 was obtained by screening for a hygromycin resistance marker with loxP sites in the same direction on both sides.

[0063] Preferably, the vector and fragments A, B, and C are assembled by Gibson, and the E. coli universal vector pUC19 is assembled into YlARO4 K221L and YlARO7 G139S The two minimal transcription units were constructed into a vector with 708 bp upstream and 599 bp downstream of the endogenous rDNA locus of lipolysis. The screening tag was a hygromycin resistance marker with loxP sites in the same direction on both sides, and the plasmid pBE00 was obtained.

[0064] The present invention also provides a method for constructing a recombinant bacterium BE00, comprising the following steps: using the above-mentioned recombinant plasmid pBE00 as a template, using the primer pair rDNAup-F and rDNAdown to amplify the fragment, and transforming it into the chassis cell lipolytic yeast Po1f to obtain the recombinant bacterium BE00;

[0065] rDNAup-F (SEQ ID No. 34): gcggccgctcgatcctaa;

[0066] rDNAdown-R (SEQ ID No. 35): cttcggtatgataggaagagcc.

[0067] The present invention also provides a method for constructing a high-yield betalain chassis cell, comprising the following steps: (1) using pUC19 as a template and amplifying a linearized vector using a primer pair linerized-puc19-F and linerized-puc19-R;

[0068] linerized-puc19-F (SEQ ID No. 36): ctgcaggcatgcaag;

[0069] linerized-puc19-R (SEQ ID No. 37): actggccgtcgtttt;

[0070] (2) Using BE02 (SEQ ID No. 38) as a template, fragment 1 was amplified using the primer pair Gib-puc19-BE12-F and op-IN002-R;

[0071] Gib-puc19-BE12-F (SEQ ID No. 39): aaaacgacggccagtatagagaccgggttggcg;

[0072] op-IN002-R(SEQ ID No.40):ctgtacgagtaagagcactagcc;

[0073] (3) Using BE01 (SEQ ID No. 41) as a template, fragment 2 was amplified using the primer pair op-EvTYH-MjDod-F and op-MjDod-BvSGT2-R;

[0074] op-EvTYH-MjDod-F (SEQ ID No. 42): tagtgctcttactcgtacagggagtttggcgcccgtttttt;

[0075] op-MjDod-BvSGT2-R (SEQ ID No. 43): tatagtactgcgtacactgtgaattcggacacgggcatct;

[0076] (4) Using BE03 (SEQ ID No. 44) as a template, fragment three was amplified using the primer pair op-PFBAin-F and Gib-octt-loxP-Ura-R;

[0077] op-PFBAin-F (SEQ ID No. 45):acagtgtacgcagtactatagagg;

[0078] Gib-octt-loxP-Ura-R (SEQ ID No. 46): actgaaataaatttagtctgcagataacttcgtatagcatacattatacgaagttatttcctctttgattgttcctt;

[0079] (5) Using CYRIN014 (SEQ ID No. 47) as a template, fragment 4 was amplified using the primer pair op-41Ura-F and op-uradown-loxP-R;

[0080] op-41Ura-F (SEQ ID No. 48): ctgcagactaaatttatttcagtctcctcttcaccaccaaaatgccc;

[0081] op-uradown-loxP-R (SEQ ID No. 49): cttgcatgcctgcagataacttcgtatagcatacattatacgaagttatggtgtagtggtagtgcagtg;

[0082] (6) The linearized vector, fragment 1, fragment 2, fragment 3, fragment 4, and the Ura3 gene truncated to 41 bp in length were connected to form the recombinant plasmid BE04;

[0083] (7) Using the recombinant plasmid BE04 as a template, primers op-PTEFin-F and lacza-up-R were used to amplify the transformed fragment;

[0084] op-PTEFin-F (SEQ ID No. 50): atagagaccgggttggcggc;

[0085] lacza-up-R (SEQ ID No. 51): agcttgcatgcctgcag;

[0086] (8) The transformation fragment was transformed into BE00 constructed using the above construction method, and the obtained bacterial liquid was divided into two parts: one-third was coated on SC-URA screening plates, and the remaining two-thirds was transferred to fresh YPD liquid culture medium for overnight culture, and then iterative screening was performed to obtain high-yield betalain chassis cells.

[0087] The amplification method used in the present invention is PCR amplification, and its procedure is: pre-denaturation at 95°C for 3 to 5 minutes, wherein the plasmid template is 3 minutes and the genomic template is 5 minutes; pre-denaturation at 94°C for 15 seconds, annealing at Tm-2°C for 15 seconds, extension at 72°C for 30 seconds / kb, 25 to 35 cycles; and further extension at 72°C for 5 minutes.

[0088] Betalain standard: Weigh 2.988g of red beetroot extract diluted with dextrin in a dark place and dissolve it with a small amount of ddH2O by ultrasonication. Be careful not to overheat during the ultrasonication process. Then use a 25mL volumetric flask to make up the volume. 1g of this extract standard contains 0.837mg of betanin and isobetanin respectively. The resulting mother solution is 100mg / L, which is divided into 2mL / tube and placed in a -20℃ refrigerator for use. It has been verified that there is no difference in liquid chromatography detection between freshly prepared mother solutions and mother solutions thawed after being frozen at -20℃. It should be noted that since the proportion of active ingredients in this standard product is too small, a large amount of powder needs to be added, which affects the volume of the mother solution. Therefore, the concentration of the mother solution is difficult to increase further. The sample should be fully diluted to meet the coverage range of the standard curve when preparing it. When using, perform a gradient dilution according to the table below and mix well. Pass it through a 13mm*0.22μm aqueous mixed cellulose (MCE) filter and it can be used as a high-performance liquid chromatography standard. The standard curve of betalain is shown below. Figure 4 shown.

[0089] In addition, in the present invention, the primers used in qPCR are shown in Table 1:

[0090] Table 1 Primer sequences used in qPCR

[0091] BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 The reaction process of tyrosine synthesis from the shikimate pathway;

[0093] Figure 2 It is a reaction related to the synthesis of betalain from tyrosine;

[0094] Figure 3 Flowchart for constructing high-betalain-producing strains for multiple rounds of iterations;

[0095] Figure 4 This is the standard curve of betalain;

[0096] Figure 5 Line graphs are drawn for representative strains from multiple iterations;

[0097] Figure 6 This is the result diagram of the fermentation liquid phase of BE00-BE24;

[0098] Figure 7 The copy number of the strain was verified by qPCR. DETAILED DESCRIPTION

[0099] Example 1

[0100] [1] Obtaining a Yarrowia lipolytica strain that improves the metabolic flux of the shikimate pathway

[0101] 1. Constructing a YlARO4-carrying K221L and YlARO7 G139S The recombinant plasmid of the minimum transcription unit.

[0102] YlARO4 K221L Vector: CYRIN002 (pUC57 harboring H2-P TEFin -BsmbI-pex20t-H3,KanR) was used as template, upstream primer Gib-IN002-aro4-F, downstream primer PTEFin-R, and 3415 bp was amplified.

[0103] YlARO4 K221L Fragment: Using the Po1f genome of Saccharomyces lipolytica as a template, upstream primers op-IN002YL-aro4-up-F and op-aro4-K221L-R were used to amplify 679bp; upstream primer: overlap-aro4-K221L-F and downstream primer YL-aro4-down-R were used to amplify 431bp.

[0104] The two fragments of the above vector were assembled by Gibson assembly technique (seamless cloning kit: Nearshore Protein) to obtain plasmid SA01, and the primers LD03in-1F, v-aro4-1F, and v-aro4-1R were used to verify the plasmid.

[0105] YlARO7 G139S Fragment: Using the Saccharomyces lipolytica Po1f genome as a template, upstream primers bsaI-aro7-F and op-aro7-G139S-R were used to amplify a 431-bp fragment; upstream primer op-aro7-G139S-F and downstream primer bsa1-aro7-R were used to amplify a 393-bp fragment. The two fragments were ligated by overlap PCR to form a single fragment with a bsaI restriction site, totaling 805 bp.

[0106] The above fragments and vector: CYRIN003 (pUC57 harboring H3-P FBAin -BsaI-octt-H4, KanR) were assembled into the recombinant plasmid SA02 through GoldenGate reaction, and the plasmid was verified using primers K8FB-F, v-aro7-1F, and v-aro7-1R.

[0107] 2. Construction of homologous recombination fragments:

[0108] The rDNA locus was selected as YIARO4 K221L and YlARO7 G139S Integration site:

[0109] Vector: Template: pUC19, upstream primer: linerized-puc19-F, downstream primer: linerized-puc19-R to amplify 2647bp.

[0110] Fragment 1 rDNAup: template Po1f genome, upstream primer: Gib-puc19-rDNAup-F, downstream primer rDNAup-R length: 723bp.

[0111] Fragment 2 Y1ARO4 K221L : Template: pSA01, upstream primer op-rDNAup-TEFin-aro4-F, downstream primer IN002-TR amplified 1884bp.

[0112] Fragment 3 YlARO7 G139S Template: pSA02, upstream primers op-aro4-aro7-F, downstream primers op-octt-Hph-R amplified 2139 bp. Fragments 1, 2, and 3 were ligated by Overlap PCR to form a complete fragment, amplifying 4706 bp to obtain Fragment A.

[0113] Fragment B: Hph with loxP site: template CYRIN005 (pUC57 harboring H3-hisG-Hph-hisG-intEdown, KanR), upstream primer: loxp-Hph-up-F, downstream primer Gib-hph-down-loxp-R, amplifying 2129 bp;

[0114] Fragment C: loxP-rDNAdown: template CYRIN013 (pUC57 harboring, H4-rDNAdown, KanR), upstream primer: loxP-rDNAdown-F, downstream primer Gib-rDNAdown-puc19-R, length 656 bp;

[0115] The vector and fragments A, B, and C were assembled by Gibson, and YlARO4 was cloned into the universal vector pUC19 of E. coli. K221L and YlARO7 G139S The two minimal transcription units were constructed into a vector with 708 bp upstream and 599 bp downstream of the endogenous rDNA locus of lipolysis. The screening tag was a hygromycin resistance marker with loxP sites in the same direction on both sides, and the plasmid pBE00 (plasmid genetic characteristics: pUC19:

[0116] rDNAup-P TEFin -YlARO4 K221L -pex20t-PFBAin -YlARO7 G139S -octt-loxP-HphR-loxP-rDNAdown),

[0117] Using the upstream primer rDNAup-F and the downstream primer rDNAdown-R, pBE00 was used as a template and the high-fidelity enzyme 2×Phanta Max MasterMix (Dye Plus) (Nanjing Novezan) was used to amplify a 7417 bp fragment. The fragment was transformed into the chassis Po1f using the Frozen-EZYeast Transformation II kit (ZYMO RESEARCH) to obtain the target strain BE00, which was then spread on YPD solid culture medium containing hygromycin B (400 mg / L, Beijing Solaibao) for screening.

[0118] [2] NHEJ library construction technology quickly obtains high-yield betalain chassis

[0119] The three target genes of the synthetic pathway were synthesized by BGI to obtain pBE01 (Amp R )、pBE02(Kan R ), pBE03 plasmid (Kan R ).

[0120] Vector: Template: pUC19, upstream primer: linerized-puc19-F, downstream primer: linerized-puc19-R to amplify 2647bp.

[0121] Fragment 1: template pBE02, upstream primer Gib-puc19-BE12-F, downstream primer op-IN002-R, amplified fragment 2292 bp;

[0122] Fragment 2: template pBE01, upstream primer: op-EvTYH-MjDod-F, downstream primer: op-MjDod-BvSGT2-R, amplified fragment 2103 bp;

[0123] Fragment 3: template pBE03, upstream primer: op-PFBAin-F, downstream primer: Gib-octt-loxP-Ura-R, amplified fragment 2817 bp;

[0124] Fragment 4: Upstream primer op-41Ura-F, downstream primer: op-uradown-loxP-R, amplified fragment 1263bp.

[0125] The above four fragments and vectors, the three genes of the synthetic pathway and their expression cassettes, the Ura3 gene truncated to 41bp in length, and the universal vector pUC19 were connected by Gibson assembly to form the recombinant plasmid pBE04. (Plasmid genetic characteristics: pUC19

[0126] P TEFin -EvTYH W13I -pex20t-P EXP1 -MjDOD-xpr2t-P FBAin -BvSGT2-octt-loxP-P 41bp -Ura-loxP), and amplified using the upstream primer: op-PTEFin-F and the downstream primer: lacza-up-R to obtain a fragment length of 8398 bp.

[0127] Transformation was then performed using BE00 as the substrate. A total of 500 μL of the resulting bacterial suspension was divided into two parts: one-third was plated onto SC-URA screening plates, and the remaining two-thirds was transferred to fresh YPD liquid medium and cultured overnight. Each round was performed in triplicate, yielding three plates of transformants per round. The following day, transformation was repeated for the next round, resulting in a total of seven rounds of iterative screening.

[0128] During the screening process, we observed the following phenomenon: no transformants appeared on the SC-URA plates in the first and second rounds, which indicates that truncating the promoter of the Ura3 gene does indeed lead to increased growth pressure, and it is possible that introducing only a single copy of the fragment cannot meet the growth requirements. Starting from the third round, transformants appeared on the plates, and some of the colonies showed light pink, indicating that betacyanin had been produced, but the yield was low. The results of the fourth round were similar to those of the third round. By the fifth round, a deep red transformant appeared, and its phenotype was obviously different from other colonies. It is speculated that the strain may have acquired multiple copies of the target gene. The number of transformants increased significantly in the sixth and seventh rounds, but no deep red transformants appeared in the three parallel plates of the sixth round, and most of the transformants showed the same color as the bottom plate. Taking into account the possible contingency, we increased the number of parallel plates from three to ten parallel plates in the seventh round, and decided to terminate the iteration in this round. After all the bacterial liquid in the seventh round was spread on the SC-URA plate, the status of the transformants on all plates was consistent with the results of the third and fourth rounds. See the schematic diagram Figure 3 .

[0129] Through the above-mentioned multiple rounds of iterative screening experiments based on NHEJ library construction technology, we successfully constructed a library of Yarrowia lipolytica strains with different betalain biosynthesis capabilities, and screened out candidate strains that may carry high-copy pathway genes. To further verify the metabolic production capacity of the target strain, we used a visual method to select 24 strains with visible betalain accumulation (colonies were pink to dark red) from each round of screening plates and named them BE01-BE24. The standard curve of betalain under the liquid phase method used is as follows Figure 4 The representative strain phenotypes are shown in Figure 5 After 48 hours of culture in SC medium, the extracellular betalain production was detected by high performance liquid chromatography. It was found that the extracellular betalain production of the most red strain BE12 during multiple iterations was 11.0 mg / L (see the data in the figure). Figure 6 The yeast genomic DNA extraction kit (Beijing Tiangen) was used to extract the genomic DNA of the representative strains of each round (BE04, BE08, BE12, BE14, BE24) as templates for real-time fluorescence quantitative PCR to detect the copy numbers of the three pathway genes (such as Figure 7 ), demonstrating that the copy number of pathway genes was significantly increased in the BE12 genome.

[0130] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Carrying YlARO4 K221L and YlARO7 G139S The recombinant plasmid pBE00 of the minimum transcription unit is characterized in that: The nucleotide sequence of the recombinant plasmid pBE00 is shown in SEQ ID No.

1.

2. The method for constructing the recombinant plasmid pBE00 according to claim 1, characterized in that: The following steps are involved: (1) Using CYRIN002 as a template, the upstream primer Gib-IN002-aro4-F and the downstream primer PTEFin-R were used to amplify the linear YlARO4 K221L vector; the nucleotide sequence of CYRIN002 is shown in SEQ ID No. 2, the nucleotide sequence of the upstream primer Gib-IN002-aro4-F is shown in SEQ ID No. 3, and the nucleotide sequence of the downstream primer PTEFin-R is shown in SEQ ID No. 4; (2) Using the genome of Saccharomyces lipolytica Po1f as a template, fragment 1 was amplified using the upstream primer op-IN002YL-aro4-up-F and the downstream primer op-aro4-K221L-R; fragment 2 was amplified using the upstream primer overlap-aro4-K221L-F and the downstream primer YL-aro4-down-R; wherein the nucleotide sequence of op-IN002YL-aro4-up-F is shown in SEQ ID No. 5, the nucleotide sequence of op-aro4-K221L-R is shown in SEQ ID No. 6, the nucleotide sequence of overlap-aro4-K221L-F is shown in SEQ ID No. 7, and the nucleotide sequence of YL-aro4-down-R is shown in SEQ ID No. 8; (3) Linear YlARO4 K221L The vector and fragments 1 and 2 were assembled by Gibson to obtain plasmid pSA01; (4) Using the Po1f genome of Saccharomyces lipolytica as a template, fragment 3 was amplified using the upstream primer bsaI-aro7-F and the downstream primer op-aro7-G139S-R; fragment 4 was amplified using the upstream primer op-aro7-G139S-F and the downstream primer bsa1-aro7-R; fragments 3 and 4 were connected to form a YlARO7 with a BsaI restriction site. G139S fragment; the nucleotide sequence of bsaI-aro7-F is shown in SEQ ID No.12, the nucleotide sequence of op-aro7-G139S-R is shown in SEQ ID No.13, the nucleotide sequence of op-aro7-G139S-F is shown in SEQ ID No.14, and the nucleotide sequence of bsa1-aro7-R is shown in SEQ ID No.15; (5) YlARO7 G139S The fragment and CYRIN003 were assembled into plasmid pSA02 by Golden Gate reaction; the nucleotide sequence of CYRIN003 is shown in SEQ ID No. 16; (6) Using the universal vector pUC19 as a template, the linearized vector pUC19 vector was amplified using the primer pair linerized-puc19-F and linerized-puc19-R, wherein the nucleotide sequence of linerized-puc19-F is shown in SEQ ID No. 20, and the nucleotide sequence of linerized-puc19-R is shown in SEQ ID No. 21; (7) Using the Po1f genome as a template, a fragment rDNAup was amplified using the primer pair Gib-puc19-rDNAup-F and rDNAup-R; the nucleotide sequence of Gib-puc19-rDNAup-F is shown in SEQ ID No. 22, and the nucleotide sequence of rDNAup-R is shown in SEQ ID No. 23; (8) Using pSA01 as a template, the primer pair op-rDNAup-TEFin-aro4-F and IN002-TR were used to amplify the fragment YlARO4 K221L The nucleotide sequence of op-rDNAup-TEFin-aro4-F is shown in SEQ ID No. 24, and the nucleotide sequence of IN002-TR is shown in SEQ ID No. 25; (9) Using pSA02 as a template, the primer pair op-aro4-aro7-F and op-octt-Hph-R were used to amplify the fragment YlARO7 G139S The nucleotide sequence of op-aro4-aro7-F is shown in SEQ ID No. 26, and the nucleotide sequence of op-octt-Hph-R is shown in SEQ ID No. 27; (10) Fragments 1, 2, and 3 were connected by Overlap PCR to obtain fragment A; (11) Using CYRIN005 as a template, fragment B was amplified using the primer pair loxp-Hph-up-F and Gib-hph-down-loxp-R; the nucleotide sequence of CYRIN005 is shown in SEQ ID No. 28, the nucleotide sequence of loxp-Hph-up-F is shown in SEQ ID No. 29, and the nucleotide sequence of Gib-hph-down-loxp-R is shown in SEQ ID No. 30; (12) Using CYRIN013 as a template, fragment C was amplified using the primer pair loxp-rDNAdown-F and Gib-rDNAdown-puc19-R; the nucleotide sequence of CYRIN013 is shown in SEQ ID No. 31, the nucleotide sequence of loxp-rDNAdown-F is shown in SEQ ID No. 32, and the nucleotide sequence of Gib-rDNAdown-puc19-R is shown in SEQ ID No. 33; (13) Linearized pUC19 was assembled with fragments A, B, and C, and the plasmid pBE00 was obtained by screening for a hygromycin resistance marker with loxP sites in the same direction on both sides.

3. A method for constructing a recombinant bacterium BE00, characterized in that: The method comprises the following steps: using the recombinant plasmid pBE00 described in claim 1 as a template, amplifying the fragment using the primer pair rDNAup-F and rDNAdown, and transforming it into the chassis cell lipolytic yeast Po1f to obtain the recombinant bacteria BE00; the nucleotide sequence of the rDNAup-F is shown in SEQ ID No.34, and the nucleotide sequence of rDNAdown is shown in SEQ ID No.

35.

4. A method for constructing high-yield betalain chassis cells, characterized in that: The following steps are involved: (1) Using pUC19 as a template, the linearized vector was amplified using the primer pair linerized-puc19-F and linerized-puc19-R; the nucleotide sequence of the linerized-puc19-F is shown in SEQ ID No. 36, and the nucleotide sequence of the linerized-puc19-R is shown in SEQ ID No. 37; (2) Using pBE02 as a template, fragment 1 was amplified using the primer pair Gib-puc19-BE12-F and op-IN002-R; the nucleotide sequence of pBE02 is shown in SEQ ID No. 38, the nucleotide sequence of Gib-puc19-BE12-F is shown in SEQ ID No. 39, and the nucleotide sequence of op-IN002-R is shown in SEQ ID No. 40; (3) Using pBE01 as a template, fragment 2 was amplified using the primer pair op-EvTYH-MjDod-F and op-MjDod-BvSGT2-R. The nucleotide sequence of pBE01 is shown in SEQ ID No. 41, the nucleotide sequence of op-EvTYH-MjDod-F is shown in SEQ ID No. 42, and the nucleotide sequence of op-MjDod-BvSGT2-R is shown in SEQ ID No.

43. (4) Using pBE03 as a template, fragment 3 was amplified using the primer pair op-PFBAin-F and Gib-octt-loxP-Ura-R. The nucleotide sequence of pBE03 is shown in SEQ ID No. 44, the nucleotide sequence of op-PFBAin-F is shown in SEQ ID No. 45, and the nucleotide sequence of Gib-octt-loxP-Ura-R is shown in SEQ ID No.

46. (5) Using CYRIN014 as a template, fragment 4 was amplified using the primer pair op-41Ura-F and op-uradown-loxP-R. The nucleotide sequence of CYRIN014 is shown in SEQ ID No. 47, the nucleotide sequence of op-41Ura-F is shown in SEQ ID No. 48, and the nucleotide sequence of op-uradown-loxP-R is shown in SEQ ID No.

49. (6) The linearized vector, fragment 1, fragment 2, fragment 3, fragment 4, and the Ura3 gene truncated to 41 bp in length were ligated into the recombinant plasmid pBE04; (7) Using the recombinant plasmid pBE04 as a template, primers op-PTEFin-F and lacza-up-R were amplified to obtain a transformation fragment. The nucleotide sequence of op-PTEFin-F is shown in SEQ ID No. 50, and the nucleotide sequence of lacza-up-R is shown in SEQ ID No. 51; (8) The transformation fragment was transformed into BE00 constructed using the construction method described in claim 5, and the obtained bacterial liquid was divided into two parts: one-third was coated on SC-URA screening plates, and the remaining two-thirds was transferred to fresh YPD liquid culture medium for overnight culture, and then iterative screening was performed to obtain high-yield betalain chassis cells.

Images