Construction method and application of targeted GINS1 RNAi lentiviral vector
By constructing an RNAi lentiviral vector targeting the GINS1 gene, the problem of insufficient targeted GINS1 treatment in the prior art was solved, efficient and stable breast cancer cell inhibition effect was achieved, and a treatment plan for breast cancer was provided.
Patent Information
- Application Number
- CN202510498440.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-21
- Publication Date
- 2025-08-12
- Estimated Expiration
- Not applicable · inactive patent
Smart Images

Figure CN120464682A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a method for constructing an RNA interference (RNAi) lentiviral vector targeting the GINS1 gene, and its application in inhibiting the proliferation and migration of breast cancer cells. Background Art
[0002] Breast cancer is one of the most common malignant tumors in women worldwide, and its occurrence and development are closely related to the abnormal expression of multiple genes. GINS1 (GINS complex subunit 1) is a key regulatory factor in the initiation and elongation of DNA replication and plays an important role in the S phase of the cell cycle. Studies have shown that GINS1 is highly expressed in various tumors and is significantly associated with tumor cell proliferation, invasion, and poor prognosis. However, currently, there are limited targeted therapeutic options for GINS1, especially gene therapy based on RNAi technology, which remains to be developed.
[0003] Lentivirus vectors have become an important tool in gene therapy due to their efficient transfection and long-term stable expression. Lentivirus vectors are a type of retrovirus modified from the human immunodeficiency virus (HIV). Their genome is RNA, with its toxic genes deleted and replaced by the exogenous gene of interest. These pseudotyped viruses can integrate exogenous genes into their genome for stable expression, and are capable of infecting both dividing and non-dividing cells. After entering the cell, the lentiviral genome is reverse-transcribed into DNA in the cytoplasm, forming a pre-DNA integration complex. After entering the nucleus, the DNA integrates into the cellular genome. The integrated DNA is transcribed into mRNA, which returns to the cytoplasm to express the target protein or produce small RNAs. Lentivirus-mediated gene expression or small RNA interference is sustained and stable, and replicates with cell division. Furthermore, the integration properties of lentivirus infection enable efficient integration of exogenous genes into host chromosomes, achieving persistent expression. This allows the construction of stable cell lines for studying gene function in cells. Summary of the Invention
[0004] The present invention provides a method for constructing an RNAi lentiviral vector targeting the GINS1 gene, and verifies its effect in inhibiting the malignant phenotype of breast cancer cells through in vitro and in vivo experiments.
[0005] Specifically, a method for constructing an RNAi lentiviral vector targeting the GINS1 gene comprises the following steps:
[0006] (1) Based on the human GINS1 gene mRNA sequence, two specific RNAi target sequences were designed, as shown in SEQ ID NO: 1-2 respectively; for each target sequence, the corresponding shRNA oligonucleotide single strand was designed and chemically synthesized;
[0007] (2) annealing the two pairs of synthesized shRNA oligonucleotide single strands to form two double-stranded shRNAs containing RNAi target sequences;
[0008] (3) The double-stranded shRNA was inserted into an expression vector linearized by restriction endonuclease and connected by DNA ligase; the two double-stranded shRNAs were respectively inserted into the expression vector, transformed into competent Escherichia coli DH5α, and after culture, single clones were picked for PCR identification and sequencing verification to obtain a lentiviral vector containing GINS1 shRNA.
[0009] The two specific RNAi target sequences are:
[0010] SEQ ID NO: 1: ACCGGCAAGTTCTGGAGGATGAAA;
[0011] SEQ ID NO: 2: ACCGGGCGTCTTGCCAAATGCATTAC.
[0012] The expression vector is PLKO.
[0013] After step (3), the method further includes step (4): co-transfecting the lentiviral vector constructed in step (3), the three plasmids in the three-plasmid transfection system, and a transfection reagent into HEK293T cells, changing the medium, and collecting the virus liquid to obtain a recombinant lentiviral vector.
[0014] After step (4), the method further includes: filtering the collected virus liquid using a syringe and a filter.
[0015] The specific operation of inserting into the expression vector in step (3) is: using two enzyme cutting sites to cut the expression vector and recover the vector backbone part; using ligase to connect the double-stranded shRNA and the recovered vector backbone part.
[0016] In the step (4), the three plasmids are VSVG, PMD2.G and RRE, and the ratio thereof is 4:3:1. The ratio of the interference vector to the three plasmids is 1:1, and the transfection reagent is PEI.
[0017] The present invention also provides an RNAi lentiviral vector targeting the GINS1 gene, comprising two double-stranded shRNAs containing RNAi target sequences shown in SEQ ID NOs: 1-2, which are constructed using the above-mentioned construction method.
[0018] The present invention also provides an application of an RNAi lentiviral vector targeting the GINS1 gene in knocking down the expression of the GINS1 gene, and the lentiviral vector is used to infect cells.
[0019] The cells are breast cancer cells.
[0020] The present invention also provides an application of an RNAi lentiviral vector targeting the GINS1 gene in gene therapy for breast cancer. The lentiviral vector is used to infect breast cancer cells to knock down GINS1 expression and thereby exert a therapeutic effect.
[0021] Specifically, it relates to the use of an RNAi lentiviral vector targeting the GINS1 gene in the preparation of a gene therapy drug for breast cancer.
[0022] Specifically, it relates to a pharmaceutical composition for inhibiting the proliferation of breast cancer cells, comprising the above-mentioned lentiviral vector and a pharmaceutically acceptable carrier.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] The present invention analyzes and screens the bioinformatics database, screens out the therapeutic target gene GINS1, and uses it as a target. A recombinant lentiviral vector for RNA interference targeting GINS1 was designed, with a cell infection efficiency of over 80%, and the cells remain in a normal state. It has high safety and stability, and can effectively knock down the expression of the target gene GINS1. Through various experimental verifications, including cell proliferation and metastasis, it was determined that it can affect the occurrence and development of breast cancer, thereby achieving a therapeutic effect on breast cancer. By carrying a specific RNAi target sequence, the present invention effectively inhibits the occurrence and development of breast cancer cells, providing new guidance for symptom relief and subsequent treatment of breast cancer patients. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 To analyze the expression of GINS1 in breast cancer for bioinformatics.
[0026] Figure 2 To analyze the expression of GINS1 in breast cancer for bioinformatics.
[0027] Figure 3 These are the results of qPCR target screening after MDA-MB-231 cells were infected with lentivirus.
[0028] Figure 4 These are the results of qPCR target screening after BT549 cells were infected with lentivirus.
[0029] Figure 5 This is the result of CCK8 experiment detecting cell proliferation of MDA-MB-231 cells after infection with lentivirus.
[0030] Figure 6 This is the result of CCK8 experiment detecting cell proliferation of BT549 cells after infection with lentivirus.
[0031] Figure 7 The results of cell apoptosis were detected by flow cytometry (MDA-MB-231).
[0032] Figure 8 The results of cell apoptosis were detected by flow cytometry (BT549).
[0033] Figure 9 The results are for cell scratching (MDA-MB-231).
[0034] Figure 10 The results are for cell scratching (BT549). DETAILED DESCRIPTION
[0035] In order to make the purpose, technical scheme and advantages of the embodiment of the present application clearer, the technical scheme in the embodiment of the present application will be fully described below in conjunction with the accompanying drawings in the embodiment of the present application, so as to fully understand the purpose, effect and application prospect of the present invention. The following examples are only used to illustrate the present invention and are not used to limit the scope of application of the present invention. However, without departing from the spirit and essence of the present invention, the modification or replacement of the inventive method, step or culture condition made belongs to the scope of the present invention.
[0036] Example 1 Screening the expression of GINS1 in breast cancer using the gene bioinformatics database
[0037] The expression of GINS1 in breast cancer was screened through the bioinformatics database. The results are as follows Figure 1 and 2 As shown, the results showed that the expression of GINS1 in breast cancer was higher than that in adjacent tumors, and the expression of GINS1 gene was significantly correlated with the overall survival of breast cancer, that is, as the expression of GINS1 gene in patients increased, the survival period was shortened.
[0038] Example 2 Construction and identification of GINS1 RNAi lentiviral vector
[0039] According to the full-length sequence of GINS1 mRNA, RNAi target sequences were designed. The RNAi target sequences are RNAi-1 and RNAi-2, and their fragment coding sequences are:
[0040] SEQ ID NO: 1
[0041] ACCGGCAAGTTCTGGAGGAGATGAAA;
[0042] SEQ ID NO:2
[0043] ACCGGGCGTCTTGCCAAATGCATTAC.
[0044] According to each RNAi target sequence, a pair of corresponding shRNA oligonucleotide single strands were designed and synthesized. The two pairs of shRNA oligonucleotide single strands were annealed to form double-stranded shRNAs. The two double-stranded shRNAs were inserted into the expression vector pLKO to construct lentiviral vectors containing GINS1 shRNA, and the competent cells DH5α were transformed.
[0045] Two pairs of shRNA oligonucleotides targeting the GINS1 gene:
[0046] 1:GCCTGCCTTCAACGAGGAT
[0047] TCGTCCACCTGACTTTGCTT;
[0048] 2: GATCCCCGCAGTACATCTAC
[0049] TTCTCGTAGATGTACTGCTT.
[0050] The specific methods of annealing and connection are as follows:
[0051] 1. Oligonucleotide annealing:
[0052] First, dissolve two pairs of synthetic oligonucleotides in double-distilled water (ddH2O) to 100 μM each. Take 5 μL of each complementary single strand and mix them two by two. Add 2 μL of oligo annealing buffer and top up with ddH2O to a total reaction volume of 20 μL. Heat the reaction mixture of the two shRNA oligonucleotide pairs at 95°C for 5 minutes and then allow to cool naturally at room temperature.
[0053] 2. PLKO vector ligation
[0054] Use restriction endonucleases to cut the two restriction sites (AgeI and EcoRI) on the expression vector and recover the vector backbone. Dilute the shRNA recovered from the gel to a concentration of 10 nM and prepare the reaction system according to Table 2 below. Perform the ligation reaction at room temperature for 30 minutes.
[0055] Table 2 Ligation PLKO vector system
[0056] Connection system Dosage (μL) Ligation buffer 2 pLKO-U6-shRNA-EGFP-puro vector backbone X(≥50ng) Double-stranded shRNA 4 T4 ligase 1 <![CDATA[ddH2O]]> 13-X
[0057] Note: X is 2 when the carrier skeleton recovery concentration is 50 ng / u.
[0058] Three single clones were picked from each transformation plate after transformation, and the cells were shaken for colony PCR to verify whether there were positive clones. The positive clones obtained from the bacterial test were sequenced to verify whether the insert sequence in the recombinant clone was consistent with the designed oligonucleotide sequence, thereby obtaining a lentiviral vector containing GINS1 shRNA.
[0059] Example 3 Packaging of Lentiviral Vectors Containing GINS1 shRNA
[0060] HEK293T cells in the logarithmic growth phase were digested and counted, and 3 × 106 cells were seeded into each 10 cm cell culture dish and cultured overnight in a 37°C, 5% CO2 incubator.
[0061] The target plasmid obtained in Example 1 was prepared with the backbone plasmid at a ratio of 1:1 to obtain a transfection plasmid, wherein the backbone plasmid was the three plasmids VSVG, PMD2.G, and RRE of the three-plasmid transfection system, which were prepared at a ratio of 4:3:1. The total mass of the transfection plasmid was calculated as 20 μg / well, and PEI was added in an amount of 2.5-3 times that of the transfection plasmid. Then, 500 μL of DMEM serum-free and double-antibody-free medium / 20 μg of transfection plasmid was added, which was recorded as solution A;
[0062] Take 50-60 μg (i.e. 50-60 μL) of PEI (generally prepared at 1 μg / mL) and add it to a total volume of 500 μL of DMEM serum-free and double-antibody-free medium, recorded as solution B, and mix by pipetting 20 times;
[0063] Add solution B dropwise to solution A, mix gently 6 times with a pipette, and let it stand at room temperature for 15-20 minutes. Slowly add the transfection reagent (A+B) to the cells that have recovered for 20 hours.
[0064] Medium change: 18 hours after transfection, replace the HEK293T supernatant containing the transfection reagent with 10 mL of DMEM complete medium;
[0065] Virus fluid collection: Virus production peaks 48-72 hours after transfection. Collect the virus fluid 48 hours after transfection (30 hours after medium exchange and 30 hours after virus production) for use in experiments. Collect the virus in a 15 mL centrifuge tube and centrifuge at 500g for 5 mL to remove cell debris and impurities. Then filter using a syringe and filter. The collected viral supernatant can be used for infection and storage.
[0066] Example 4 Selection of infected cells
[0067] qPCR was used to detect the expression of GINS1 in breast cancer cell lines. The specific method is as follows:
[0068] RNA was extracted using the Trizol method and reverse transcribed to obtain cDNA, which was then subjected to qPCR. The upstream primer, Primer F, had a sequence of GCCTGCCTTCAACGAGGAT, and the downstream primer, Primer R, had a sequence of TCGTCCACCTGACTTTGCTT. The reaction system was prepared according to Table 3. Real-time PCR was performed in two steps, and a melting curve was generated. The procedure was shown in Table 4.
[0069] Table 3 qPCR reaction system
[0070] ID Name Volume(uL) 1 Tag Pro Universal SYBR qPCR Master Mix 10 2 Primer F (10 μM) 0.4 3 Primer R (10μM) 0.4 4 Non-nuclear water 7.2 5 cDNA template 2 6 Total volume 20
[0071] Table 4 Real-Time PCR Program
[0072]
[0073] The results showed that compared with the shNC group, the expression levels of shGINS1-1 and shGINS1-2 groups were downregulated.
[0074] Example 5 Lentivirus infection of breast cancer cells
[0075] In order to detect the infection of the target gene GINS1, breast cancer cells were infected with the virus solution obtained in Example 3 to knock down the expression of GINS1. The specific method is as follows:
[0076] a) MDA-MB-231 and BT549 cells in the logarithmic growth phase were trypsinized and prepared into cell suspensions;
[0077] b) The cell suspension was plated on a 6-well plate, and MDA-MB-231 and BT549 cell suspensions were added, with 1×10 cells per well. 5 about.
[0078] c) After 24 hours, the cells were in good condition. The culture medium was discarded, and infection solution was added, along with the virus solution obtained in Example 3 for infection.
[0079] d) 18-20 hours after infection, replace the culture medium with freshly prepared medium;
[0080] e) After 72 h, the cells were photographed under an inverted fluorescence microscope.
[0081] Example 6 Screening of effective targets of GINS1 in breast cancer cell lines
[0082] Lentivirus (two targets) was infected in MDA-MB-231 cells and BT549 cells, and the expression of GINS1 was detected by qPCR 48 hours later (for specific operations, refer to the qPCR detection in Example 4). Figure 3-4. Figure 3 The results of lentiviral infection of MDA-MB-231 cells. Figure 4 These are the results of lentiviral infection of BT549 cells, where shNc is the negative group, which is a group infected with an empty lentivirus (i.e., a lentivirus without the target gene sequence). The following shNc is the same. The shGINS1-1 group is infected with a lentivirus carrying the RNAi target sequence RNAi-1, and the shGINS1-2 group is infected with a lentivirus carrying the RNAi target sequence RNAi-2.
[0083] from Figure 3 The results showed that in MDA-MB-231 cells, after lentivirus infection of the cells, the shGINS1-1 group and shGINS1-2 group had a significant knockdown efficiency on the GINS1 gene compared with the shNC group.
[0084] from Figure 4 The results showed that in BT549 cells, after lentivirus infection, the shGINS1-1 group and shGINS1-2 group had a significant knockdown efficiency on the GINS1 gene compared with the shNC group.
[0085] Example 7 Evaluation of the effect of GINS1 on breast cancer cell activity
[0086] To investigate the effect of GINS1 on breast cancer cell proliferation, the inventors infected breast cancer cell lines (MDA-MB-231 and BT549) with the virus solution obtained in Example 3 to knock down GINS1 expression. The CCK-8 assay was used to detect the effect of GINS1 on breast cancer cell activity. The specific procedures were as follows:
[0087] (1) After trypsinization of cells in the logarithmic growth phase of each experimental group, resuspend them in complete culture medium to form a cell suspension, and count them using a cell counter;
[0088] (2) Determine the cell density (2000 cells / well) based on the cell growth rate, add 100 μl per well, repeat 3-5 wells per group, and plate five 96-well plates;
[0089] (3) After the cells are uniformly laid and completely settled, the cell density of each experimental group is observed under a microscope and the cells are cultured in a cell culture incubator;
[0090] (4) Starting from the second day after plating, add 10 μL of CCK-8 reagent to each well before terminating the culture. No need to change the medium;
[0091] (5) After 1-3 hours, the 96-well plate was placed on an oscillator for 2-5 minutes, and the OD value was measured by a microplate reader at 450 nm.
[0092] The results show (such as Figure 5-6 In MDA-MB-231 cells, the shGINS1-1 knockdown group and the shGINS1-2 knockdown group were significantly downregulated compared with the shNC group.
[0093] In BT549 cells, the shGINS1-1 knockdown group and the shGINS1-2 knockdown group were significantly downregulated compared with the shNC group.
[0094] It can be seen that compared with the shNC group, the cell proliferation in the shGINS1-1 and shGINS1-2 groups was inhibited.
[0095] Example 8 Effect of GINS1 on apoptosis of breast cancer cells
[0096] Having previously explored its effect on cell proliferation, the inventors further verified whether GINS1 affects the growth of breast cancer by flow cytometry. Breast cancer cells (MDA-MB-231 and BT549) were infected with the virus solution obtained in Example 3 to knock down GINS1 expression. Flow cytometry was then used to detect the effect of GINS1 on breast cancer cell apoptosis. The specific procedures were as follows:
[0097] (1) After trypsinization of cells in the logarithmic growth phase of each experimental group, resuspend them in complete culture medium to form a cell suspension, and count them using a cell counter;
[0098] (2) When the cells grow to a confluence of 70% and cell death is observed under a microscope;
[0099] (3) Collect the culture supernatant in a 5 ml centrifuge tube, wash the cells once, and collect them in the same 5 ml centrifuge tube. Digest the cells with trypsin, stop the digestion with the culture supernatant, and collect the cells in the same 5 ml centrifuge tube.
[0100] (4) Centrifuge at 1500 rpm for 5 min and discard the supernatant;
[0101] (5) Wash the cell pellet once with PBS, centrifuge at 1500 rpm for 3 min, and collect the cells;
[0102] (6) Wash the cell pellet once with 1× binding buffer and centrifuge at 1500 rpm for 3 min to collect the cells;
[0103] (7) 1 ml (to make the final density of cell suspension 1×10 6 -1×10 7 Resuspend the cell pellet in 1× cell staining buffer (cell / ml);
[0104] (8) Take 200 μL of cell suspension (1×10 5 -1×10 6cells), 5 μL annexin V-APC and 5 μL PI staining (40× PI staining solution diluted 10 times) were added for cell staining;
[0105] (9) Protect the sample from light and load it onto the flow cytometer within 15 minutes.
[0106] The results showed that in terms of cell apoptosis, in MDA-MB-231 cells ( Figure 7 ), compared with the shNC group, the shGINS1-1 knockdown group and the shGINS1-2 knockdown group significantly promoted cell apoptosis. Figure 8 ), compared with the shNC group, the shGINS1-1 knockdown group and the shGINS1-2 knockdown group also significantly promoted cell apoptosis.
[0107] The results showed that compared with the shNC group, cell apoptosis in the shGINS1-1 and shGINS1-2 groups was increased.
[0108] Example 9 Effect of GINS1 on breast cancer cell scratching
[0109] To explore the mechanisms of cancer development and progression, the inventors conducted a metastasis experiment to investigate the effect of GINS1 on cell metastasis. Breast cancer cells were infected with the virus solution obtained in Example 3 to knock down GINS1 expression. A wound wound test was then performed to examine the effect of GINS1 on breast cancer cell proliferation. The specific procedures were as follows:
[0110] (1) First, use a marker pen to draw horizontal lines evenly across the back of the 6-well plate, using a ruler to measure the lines. Draw horizontal lines approximately every 0.5 to 1 cm across the wells. Draw at least 5 lines across each well. Be careful not to make the lines too thick.
[0111] (2) After trypsinization of the cells in each experimental group in the logarithmic growth phase, resuspend them in complete culture medium to form a cell suspension, and count them using a cell counter;
[0112] (3) Determine the cell density based on cell size (most cell plating density is set at 500,000 cells / well), and consider that the cells reach a confluence of more than 90% the next day;
[0113] (4) On the second day, use the tip of a pipette, perpendicular to the cell plane, to scratch the cell layer along the line drawn on the back of the plate on the first day (it is best to use the same pipette tip or toothpick between different wells);
[0114] (5) After the scratching is completed, wash the cells three times with sterile PBS to remove the non-adherent cells, that is, the cells that are scratched during the scratching process, so that the gaps left after the scratching are clearly visible, and then replace with fresh serum-free culture medium;
[0115] (6) Place the cells in a 37°C, 5% CO2 incubator and culture. Then, remove the cells after 24 hours, observe and measure the width of the scratch under a microscope, and take photos.
[0116] (7) After opening the image using Image J software, 6 to 8 horizontal lines were randomly drawn, the mean of the intercellular area was calculated, and data analysis was performed.
[0117] The results of the scratch test showed that in MDA-MB-231 cells ( Figure 9 ), compared with the shNc group, the 24h cell migration rate of the shGINS1-1 group and the shGINS1-2 group was significantly reduced. Figure 10 ), compared with the shNC group, the 24h cell migration rates of the shGINS1-1 and shGINS1-2 groups were significantly decreased.
[0118] The above results demonstrate that GINS1 not only affects breast cancer cell proliferation but also cell metastasis. Infection with the virus solution obtained in Example 3 can reduce the expression of GINS1, thereby affecting breast cancer cell proliferation and cell metastasis.
[0119] The above embodiment merely represents one embodiment of the present invention. While the description is relatively specific and detailed, it should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make various modifications and improvements without departing from the scope of the present invention, and all such modifications and improvements fall within the scope of protection of the present invention.
Claims
1. A method for constructing an RNAi lentiviral vector targeting the GINS1 gene, characterized in that: The following steps are involved: (1) Based on the human GINS1 gene mRNA sequence, two specific RNAi target sequences were designed, as shown in SEQ ID NOs: 1-3 respectively; for each target sequence, a corresponding shRNA oligonucleotide single strand was designed and chemically synthesized; the two specific RNAi target sequences were: SEQ ID NO: 1: ACCGGCAAGTTCTGGAGGATGAAA; SEQ ID NO:2:ACCGGGCGTCTTGCCAAATGCATTAC; (2) annealing the two pairs of synthesized shRNA oligonucleotide single strands to form three double-stranded shRNAs containing RNAi target sequences; (3) The double-stranded shRNA was inserted into an expression vector linearized by restriction endonuclease and connected by DNA ligase; the two double-stranded shRNAs were respectively inserted into the expression vector, transformed into competent Escherichia coli DH5α, and after culture, single clones were picked for PCR identification and sequencing verification to obtain a lentiviral vector containing GINS1 shRNA.
2. The method for constructing the RNAi lentiviral vector targeting the GINS1 gene according to claim 1, wherein: The expression vector is PLKO.
3. The method for constructing the RNAi lentiviral vector targeting the GINS1 gene according to claim 1, wherein: The specific operation of inserting into the expression vector in step (2) is: using two enzyme cutting sites to cut the expression vector and recover the vector backbone part; using ligase to connect the double-stranded shRNA and the recovered vector backbone part.
4. The method for constructing the RNAi lentiviral vector targeting the GINS1 gene according to claim 1, wherein: After step (3), the method further includes step (4): co-transfecting the lentiviral vector constructed in step (3), the three plasmids in the three-plasmid transfection system, and a transfection reagent into HEK293T cells, changing the medium, and collecting the virus liquid to obtain a recombinant lentiviral vector.
5. The method for constructing the RNAi lentiviral vector targeting the GINS1 gene according to claim 4, wherein: After step (4), the method further includes: filtering the collected virus liquid using a syringe and a filter.
6. The method for constructing the RNAi lentiviral vector targeting the GINS1 gene according to claim 4, wherein: In step (4), the three plasmids are VSVG, PMD2.G and RRE, and the ratio thereof is 4:3:
1. The ratio of the interference vector to the three plasmids is 1:1, and the transfection reagent is PEI.
7. An RNAi lentiviral vector targeting the GINS1 gene, characterized in that: The double-stranded shRNA comprises two RNAi target sequences shown in SEQ ID NO: 1-3 of claim 1, and is constructed using the above-mentioned construction method.
8. Use of the RNAi lentiviral vector targeting the GINS1 gene according to claim 7 in the preparation of a gene therapy drug for breast cancer.
9. A pharmaceutical composition for inhibiting the proliferation of breast cancer cells, characterized in that: Comprising the lentiviral vector according to claim 7 and a pharmaceutically acceptable carrier.
Citation Information
Patent Citations
Construction method of KLK5 RNAi lentiviral vector and application of KLK5 RNAi lentiviral vector in bladder cancer gene therapy
CN118127055A
PSF1 gene expression inhibitor
JP2015038060A