Method for detecting luminous efficiency of fluorescent protein based on two-color co-localization
Through dual-label probes and single-molecule two-color colocalization imaging technology, the accuracy problem of fluorescent protein luminescence efficiency measurement is solved, and high accuracy and wide applicability of fluorescent protein luminescence efficiency measurement is achieved.
Patent Information
- Application Number
- CN202510313629.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-08-12
AI Technical Summary
The luminescence efficiency determination method of fluorescent proteins in the prior art is affected by factors such as dynamic changes in the intracellular complexes and weak fluorescent signal, resulting in poor accuracy and it is difficult to accurately determine the actual number and aggregation status of fluorescent proteins.
A double-labeled probe, including a self-labeled tag and a target fluorescent protein, is used to release the first detectable signal through binding to the substrate by self-labeled tag, and the target fluorescent protein releases the second detectable signal. A single-molecular dual-color co-localization imaging is performed in conjunction with a total internal reflection fluorescent microscope, and the luminescence efficiency of fluorescent proteins is calculated using the principle of classical probability theory.
It achieves the determination of the absolute luminescence efficiency of multiple fluorescent proteins with high accuracy at the single molecule level, overcomes the influence of dynamic changes of complexes, has a wide range of application, can correct single molecule imaging data, and provides more accurate determination of the luminescence efficiency of fluorescent proteins.
Smart Images

Figure CN120468098A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection technology, and in particular to a method for detecting the luminous efficiency of fluorescent protein based on dual-color co-localization. Background Art
[0002] Since its invention, fluorescent protein has become one of the most commonly used fluorescent probes, playing an increasingly important role in life science research such as protein dosing determination, intracellular network construction, signal transduction elucidation, protein-protein or cell-cell interactions, etc. Although gene fusion ensures a one-to-one correspondence between fluorescent protein and target protein, which ensures that each fluorescent protein corresponds to a target protein in single-molecule imaging, due to unavoidable factors such as folding errors, incomplete maturation and photodamage, the fluorescence efficiency cannot reach 100%, and not every target protein will correspond to a fluorescent protein. The fluorescence efficiency here refers to the ratio of the number of observed fluorescent center molecules to the number of labeled target proteins. Incomplete fluorescence efficiency can lead to serious misestimation of the actual number of target proteins, their aggregation state and their interactions. In addition, the fluorescence efficiency of fluorescent proteins in different cellular environments is also different, making quantitative interpretation more complicated. Therefore, accurate determination of the fluorescence efficiency of fluorescent proteins helps to select suitable fluorescent proteins and recover true quantitative characteristics from single-molecule imaging data, which is particularly important for studying physiological processes of heterogeneity in cells.
[0003] Currently, the primary method for determining the luminescence efficiency of fluorescent proteins in situ within cells is through molecular counting. This involves labeling the subunits of a complex with a well-defined stoichiometry (a complex with a known subunit composition) with fluorescent proteins. Imaging is then used to count the number of fluorescent proteins actually observed in the complex. The luminescence efficiency of the fluorescent protein is calculated by dividing the number of subunits actually present by the number of subunits present.
[0004] However, the above methods have obvious problems, such as: (1) they require complexes with a clearly fixed compound ratio, while the complexes in actual cells are always in dynamic changes; (2) the fluorescent protein signal is weak, and it is currently difficult to accurately determine the number of fluorescent proteins by fluorescence intensity or changes in fluorescence intensity. Summary of the Invention
[0005] The purpose of the present invention is to provide a method for detecting the luminous efficiency of fluorescent proteins based on dual-color co-localization, which can determine the absolute luminous efficiency of multiple fluorescent proteins and has the advantages of simple operation, high accuracy and wide applicability.
[0006] To this end, in a first aspect, the present invention provides a method for detecting the luminous efficiency of a fluorescent protein, comprising providing a dual-labeled probe, wherein the dual-labeled probe is a fusion protein comprising a self-labeling tag, a transmembrane protein or a transmembrane region fragment thereof, and a target fluorescent protein connected in sequence; the self-labeling tag releases a first detectable signal after binding to a substrate, and the target fluorescent protein releases a second detectable signal, wherein the first detectable signal and the second detectable signal are different;
[0007] The host cell is made to express the dual-labeled probe, and the first detectable signal and the second detectable signal are detected to analyze and obtain the luminous efficiency of the target fluorescent protein.
[0008] In some embodiments, the self-labeling tag comprises at least one of the following: SNAP-tag, Halo-tag, CLIP-tag, Spy-tag, Sortase-tag, FIAsH-tag.
[0009] In some embodiments, the target fluorescent protein includes at least one of the following: GFP (green fluorescent protein), eGFP (enhanced green fluorescent protein), mGFP (membranebound form of eGFP), sfGFP (superfolder green fluorescent protein), mNeonGreen, StayGold, mStayGold, tdStayGold, EYFP (enhanced yellow fluorescent protein), ECFP (enhanced cyan fluorescent protein), EBFP2 (enhanced blue fluorescent protein2), tdTomato, MRFP (monomer red fluorescent protein), mRb3, mScarlet, DsRed, mCherry, Ypet, mKO, mkate, and iRFP.
[0010] In some embodiments, the self-labeling tag is a Halo-tag, and the target fluorescent protein is any one of eGFP, mNeonGreen, and tdStayGold.
[0011] In some embodiments, there is a first connecting peptide between the self-labeling tag and the transmembrane protein or its transmembrane region fragment; and / or,
[0012] There is also a second connecting peptide between the transmembrane protein or the transmembrane region fragment thereof and the target fluorescent protein.
[0013] In some embodiments, the first connecting peptide and the second connecting peptide are each independently selected from a flexible connecting peptide or a rigid connecting peptide.
[0014] In some embodiments, the host cell comprises a nucleic acid molecule that expresses the dual-labeled probe, and the nucleic acid molecule comprises a nucleotide sequence encoding the dual-labeled probe.
[0015] In some embodiments, the nucleic acid molecule further includes a nucleotide sequence encoding a signal peptide, and the nucleotide sequence encoding the signal peptide and the nucleotide sequence encoding the dual-labeled probe are located in the same open reading frame (ORF); the signal peptide can guide the protein expressed by the nucleic acid molecule to anchor to the cell membrane.
[0016] In some embodiments, the signal peptide comprises at least one of the following: IgK signal peptide, BM40 signal peptide, OSM signal peptide.
[0017] In some embodiments, the host cell is a mammalian cell.
[0018] In some embodiments, the first detectable signal and the second detectable signal are detected at the single molecule level.
[0019] In some embodiments, the host cell is imaged by total internal reflection fluorescence microscopy (TIRFM) to detect the first detectable signal and the second detectable signal at the single molecule level.
[0020] In some embodiments, the detection of the first detectable signal and the second detectable signal further comprises the following steps: fixing the host cells on a transparent support (e.g., a glass slide). It should be understood that those skilled in the art may choose whether to fix the host cells on a transparent support according to actual needs. In some embodiments, the host cells do not need to be fixed on a transparent support, but can be detected by real-time tracking of living cells in situ.
[0021] In some embodiments, multi-channel (e.g., dual-channel) imaging is performed on the host cell, wherein the multi-channel imaging includes channels for the first detectable signal and the second detectable signal to obtain a multi-channel image;
[0022] Analyze the multi-channel image to obtain the number n of single molecule spots in the first detectable signal channel tag1 , the number of single molecule spots n in the second detectable signal channel tag2By analyzing the distance between any two single molecule points between the first detectable signal channel and the second detectable signal channel, the number of co-localization points n is obtained. colocalized ;
[0023] Calculate the luminous efficiency of the target fluorescent protein: colocalized / n tag2 ×100%.
[0024] In some embodiments, the distance between any two single-molecule spots between the first detectable signal channel and the second detectable signal channel is analyzed, and a distance less than a threshold value (eg, 200 nm) is determined to be co-localized.
[0025] In some embodiments, the multi-channel image is analyzed and the single molecule spots therein are located using an image processing software tool (eg, an image processing software tool Trackmate), that is, the number n of single molecule spots in the first detectable signal channel is obtained. tag1 , the number of single molecule spots n in the second detectable signal channel tag2 Analyze the distance between any two single molecule points between the first detectable signal channel and the second detectable signal channel, and determine that they are co-localized if the distance is less than a threshold (e.g., 200 nm), thereby obtaining the number of co-localized points n between the first detectable signal channel and the second detectable signal channel. colocalized .
[0026] Compared with the prior art, the technical solution of the present invention has at least the following advantages:
[0027] The present invention provides a method for determining the luminous efficiency of fluorescent proteins, overcoming the challenges of existing techniques. This method requires only cloning the target fluorescent protein into a dual-labeled probe, transfecting cells for expression, and utilizing single-molecule two-color colocalization imaging, combined with classical probabilistic principles and colocalization analysis, to determine the luminous efficiency of the fluorescent protein tag. Compared to existing methods, this method is unaffected by the dynamic changes in intracellular complexes, offers higher accuracy, and has a wide range of applicability. It can determine the absolute luminous efficiency of a variety of fluorescent proteins and can also calibrate single-molecule imaging data, enabling more accurate acquisition of true information. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Various other advantages and benefits will become apparent to those skilled in the art by reading the detailed description of the preferred embodiment below. The accompanying drawings are only for the purpose of illustrating the preferred embodiment and are not to be considered as limiting the present invention. In the accompanying drawings:
[0029] Figure 1 : Schematic diagram of the dual-labeled probe in Example 1;
[0030] (a) is a schematic diagram of the nucleotide sequence encoding the dual-labeled probe; (b) is a schematic diagram of the dual-labeled probe anchored to the cell membrane, with the Halo tag and green fluorescent protein separated by the cell membrane, thus avoiding the occurrence of FRET; (c) is a schematic diagram of cell imaging, with Halo-JFX650 emitting red fluorescence and green fluorescent protein emitting green fluorescence;
[0031] Figure 2 : As the dye concentration increases, the probability of Halo-JFX650 binding to the Halo tag increases, thus increasing the labeling efficiency;
[0032] Figure 3 : Luminescence efficiency of three green fluorescent proteins in living cells;
[0033] (a) From top to bottom, two-color single-molecule images of living cells expressing Halo-TM-EGFP, Halo-TM-mNeonGreen, and Halo-TM-tdStayGold; from left to right, the 488nm channel of green fluorescent protein, the 637nm channel of Halo-JFX650, and the merged image; (b) Calculated luminous efficiency of the three fluorescent proteins;
[0034] Figure 4 : Luminescence efficiency of three green fluorescent proteins in fixed cells;
[0035] (a) From top to bottom, two-color single-molecule images of fixed cells expressing Halo-TM-EGFP, Halo-TM-mNeonGreen, and Halo-TM-tdStayGold; from left to right, the 488nm channel of green fluorescent protein, the 637nm channel of Halo-JFX650, and the merged image; (b) Calculated luminous efficiency of the three fluorescent proteins;
[0036] Figure 5 :Fluorescence properties of three green fluorescent proteins in living and fixed cells;
[0037] Among them, (a) is the single-molecule signal-to-noise ratio of the three fluorescent proteins in living cells and fixed cells; (b) is the anti-bleaching characteristics of the three fluorescent proteins in living cells and fixed cells (50ms / frame). DETAILED DESCRIPTION
[0038] Exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. Although exemplary embodiments of the present disclosure are shown in the accompanying drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments described herein. Rather, these embodiments are provided to enable a more thorough understanding of the present disclosure and to fully convey the scope of the present disclosure to those skilled in the art.
[0039] the term
[0040] As used herein, a "fusion protein" is a protein formed by linking two or more different proteins or fragments thereof through techniques such as genetic engineering. These linked proteins or fragments generally have some biological activity and retain their original functions in the fusion protein. In some embodiments, proteins or fragments thereof, including self-labeling tags, transmembrane proteins or transmembrane region fragments thereof, and target fluorescent proteins, are fused. The transmembrane protein in the fusion protein retains its original structure and function, and its transmembrane localization, shedding, and other behaviors are still retained, thereby allowing the shedding of the transmembrane protein to be analyzed based on the fusion protein.
[0041] As used herein, a "self-labeling tag" or "self-labeling protein (SLP)" can covalently bind to a specific labeling molecule (such as a fluorescent dye, capture tag, etc.), thereby releasing a detectable signal, thereby achieving protein labeling and tracking. In some embodiments, the self-labeling tag can be a Halo-tag. By providing a fluorescent ligand (such as JFX650) to the system, the Halo-tag covalently binds to the fluorescent ligand, thereby releasing a fluorescent signal. It has the advantages of high fluorescence brightness, photobleaching resistance, and suitability for long-term time series imaging.
[0042] As used herein, "transmembrane protein" refers to a protein that is partially or completely embedded in the cell membrane and can cross it. Its purpose is to position the self-labeling tag and the target fluorescent protein on the inner and outer sides of the cell membrane, thereby spatially separating them and minimizing the impact of fluorescence resonance energy transfer on their respective fluorescence intensities.
[0043] As used herein, "connector peptide" refers to a short peptide that acts as a linker. The length of the connecting peptide is generally 1-20 amino acids. Generally, the connecting peptide does not affect the normal folding and spatial conformation of the protein. In some embodiments, a flexible connecting peptide can be used, such as (G m S t G w )n、(G n S) m 、(G) n , (EA3K) n or (XP)n etc., wherein n, m, t, and w are each independently selected from integers ranging from 0 to 5. In some embodiments, the connecting peptide is (G3S)3.
[0044] As used herein, a "signal peptide" is a polypeptide that can guide the transfer of newly synthesized proteins within a cell to the cell membrane. During the protein maturation process, the signal peptide is usually enzymatically removed and is therefore not retained in the mature protein. In some embodiments, a nucleic acid sequence is constructed to construct a dual-labeled probe with a signal peptide at the N-terminus. During the protein maturation process, the signal peptide is removed, and thus the dual-labeled probe does not contain a signal peptide. In mammalian expression systems, commonly used signal peptides include: the signal peptide of mouse Ig heavy chain, the signal peptide of mouse Ig Kappa light chain (IgK signal peptide), BM40 signal peptide, OSM signal peptide, etc.
[0045] As used herein, "open reading frame" refers to a continuous nucleotide sequence starting from the start codon and ending at the stop codon, which encodes a continuous polypeptide or protein.
[0046] In some embodiments of the present invention, the principle of calculating the luminous efficiency of the target fluorescent protein is as follows:
[0047] n tag1 =n all ×p tag1
[0048] n tag2 =n all ×p tag2
[0049] n colocalized =n all ×p tag1 ×p tag2
[0050] Among them, n tag1 is: the number of single molecule spots determined based on the first detectable signal released from the label tag; n tag2 is: the number of single molecule spots determined based on the second detectable signal released by the target fluorescent protein; n colocalized is the number of colocalized single-molecule spots obtained by colocalization analysis; p tag1 is the luminescence efficiency of the self-labeling tag, p tag2 is the luminescence efficiency of the target fluorescent protein; n all is the number of total proteins expressed;
[0051] Solving the above system of equations yields:
[0052]
[0053] That is, the luminous efficiency of the target fluorescent protein = ncolocalized / n tag2 ×100%.
[0054] The following examples of the present invention are provided, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these examples are for illustrating the present invention, rather than for limiting the present invention.
[0055] Example 1
[0056] This example provides a dual-labeled probe. Figure 1 First, the DNA sequence of the dual-labeled probe is designed, which consists of a signal peptide, a holo-tag, a first connecting peptide, a transmembrane domain, a second connecting peptide, and a green fluorescent protein. The signal peptide is the leader sequence of the mouse immunoglobulin kappa light chain (Igk-leader), which can guide the translated protein to embed into the cell membrane. Once the protein is inserted into the internal omentum, the signal peptide is removed by a signal peptidase. After full expression and folding, the dual-labeled probe can be anchored to the cell membrane. The transmembrane domain separates the two tags, with the holo-tag located outside the cell and the green fluorescent protein located inside the cell. This can reduce diffusion and minimize the impact of fluorescence resonance energy transfer (FRET) on the fluorescence intensity of the two tags.
[0057] Specifically, this example provides three dual-labeled probes, each distinguished by the use of different green fluorescent proteins: EGFP, mNeonGreen, and tdStayGold. Accordingly, the three dual-labeled probes are named Halo-TM-EGFP, Halo-TM-mNeonGreen, and Halo-TM-tdStayGold, respectively.
[0058] Taking Halo-TM-EGFP as an example, the specific preparation method is as follows:
[0059] A nucleic acid sequence SEQ ID NO: 1 (hereinafter referred to as the target sequence) for encoding and expressing a dual-labeled probe Halo-TM-EGFP is provided. SEQ ID NO: 1 is composed of the following sequences connected in sequence.
[0060] SEQ ID NO: 2 (signal peptide):
[0061] ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCC AGGTTCCACTGGTGAC
[0062] SEQ ID NO: 3 (Halo-tag):
[0063] GCAGAAATCGGTACTGGCTTTCCATTCGACCCCCATTATGTGGAAGTCCTGGGCGAGCGCATGCACTACGTCGATGTTGGTCCGCGCGATGGCACCCCTGTGCTGTTCCTGCACGGTAACCCGACCTCCTCCTACGTGTGGCGCAACATCATCCCGCATGTTGCACCGACCCATCGCTGCATTGCTCCAGACCTGATCGGTATGGGCAAATCCGACAAACCAGACCTGGGTTATTTCTTCGACGACCACGTCCGCTTCATGGATGCCTTCATCGAAGCCCTGGGTCTGGAAGAGGTCGTCCTGGTCATTCACGACTGGGGCTCCGCTCTGGGTTTCCACTGGGCCAAGCGCAATCCAGAGCGCGTCAAAGGTATTGCATTTATGGAGTTCATCCGCCCTATCCCGACCTGGGACGAATGGCCAGAATTTGCCCGCGAGACCTTCCAGGCCTTCCGCACCACCGACGTCGGCCGCAAGCTGATCATCGATCAGAACGTTTTTATCGAGGGTACGCTGCCGATGGGTGTCGTCCGCCCGCTGACTGAAGTCGAGATGGACCATTACCGCGAGCCGTTCCTGAATCCTGTTGACCGCGAGCCACTGTGGCGCTTCCCAAACGAGCTGCCAATCGCCGGTGAGCCAGCGAACATCGTCGCGCTGGTCGAAGAATACATGGACTGGCTGCACCAGTCCCCTGTCCCGAAGCTGCTGTTCTGGGGCACCCCAGGCGTTCTGATCCCACCGGCCGAAGCCGCTCGCCTGGCCAAAAGCCTGCCTAACTGCAAGGCTGTGGACATCGGCCCGGGTCTGAATCTGCTGCAAGAAGACAACCCGGACCTGATCGGCAGCGAGATCGCGCGCTGGCTGTCGACGCTCGAGATTTCCGGC
[0064] SEQ ID NO: 4 (the first linker peptide):
[0065] GGTGGAGGAGGTTCTGGGGGAGGGGGGTCGGGGGGAGGGGGGTCG CGGCTGCAGGTCGAC
[0066] SEQ ID NO: 5 (Transmembrane domain):
[0067] GCTGTGGGCCAGGACACGCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTCCCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCACGT
[0068] SEQ ID NO: 6 (Second linker peptide):
[0069] GGCGGCGGAGGGAGTGGAGGAGGGGGAAGCGGAGGCGGAGGGAGT TCCGGA
[0070] SEQ ID NO: 7 (EGFP):
[0071] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCC TCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTG GTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCG CCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
[0072] The above fragments were amplified separately by PCR, and the target sequences were cloned into the mammalian expression vector pEGFP-C1 by molecular cloning, and then transformed into Escherichia coli. After verification of correctness, the recombinant expression plasmid was cultured and extracted, which expressed the dual-labeled probe Halo-TM-EGFP.
[0073] A similar method was used to prepare recombinant expression plasmids expressing the dual-labeled probes Halo-TM-mNeonGreen and Halo-TM-tdStayGold, respectively. The only difference was that SEQ ID NO: 7 was replaced with SEQ ID NO: 8 (mNeonGreen) to construct Halo-TM-mNeonGreen, and SEQ ID NO: 7 was replaced with SEQ ID NO: 9 (tdStayGold) to construct Halo-TM-tdStayGold.
[0074] SEQ ID NO: 8 (mNeonGreen):
[0075] GTGAGCAAGGGCGAGGAGGATAACATGGCCTCTCCCAGCGACACATGAGTTACACATCTTTGGCTCCATCAACGGTGTGGACTTTGACATGGTGGGTCAGGGCACCGGCAATCCAAATGATGGTTATGAGGAGTTAAACCTGAAGTCCACCAAGGGTGACCTCCAGTTCTCCCC CTGGATTCTGGTCCCTCATATCGGGTATGGCTTCCATCAGTACCTGCCCTACCCTGACGGGATGTCGCCTTCCAGGCCGCCATGGTAGATGGCCTCCGGCTACCAAGTCCATCGCACAATGCAGTTTGAAGATGGTGCCTCTTACTGTTAACTACCGCTACACCTACGAGGGAA GCCACATCAAAGGAGAGGCCCAGGTGAAGGGGACTGGTTTCCCTGCTGACGGTCCTGTGATGACCAACTCGCTGACCGCTGCGGACTGGTGCAGGTCGAAGAAGACTTACCCCAACGACAAAACCATCAGTACCTTTAAGTGGAGTTACACCACTGGAAATGGCAAGCGCTAC CGGAGCACTGCGCGGACCACCTACACCTTTGCCAAGCCAATGGCGGCTAACTATCTGAAGAACCAGCCGATGTACGTGTTCCGTAAGACGGAGCTCAAGCACTCCAAGACCGAGCTCAACTTCAAGGAGTGGCAAAAGGCCTTTACCGATGTGATGGGCATGGACGAGCTGTACAAG
[0076] SEQ ID NO:9(tdStayGold):
[0077]
[0078] Example 2
[0079] In this example, the dual-labeled probe in Example 1 is expressed in cells, and the cells are fixed and stained, etc., to facilitate imaging and analysis in subsequent examples.
[0080] The details are as follows:
[0081] 1. Prepare slides and cells
[0082] Place a 25 mm diameter, 0.17 mm thick circular glass slide in a beaker filled with a 5 mol / L sodium hydroxide solution. Then, place the beaker in an ultrasonic cleaner and clean the slide at 70% power for 1 hour to eliminate nonspecific adsorption sites. After cleaning, rinse the slide several times with deionized water and dry it in a 60°C oven. Place the slide in a biosafety cabinet in a 6-well plate and rinse three times with sterile DPBS to remove any residual sodium hydroxide.
[0083] After digestion, transfer SUM159 cells to a six-well plate with a glass slide at a dilution ratio of 1:200. Place the six-well plate in a cell culture incubator and wait 16-24 hours for the cells to adhere.
[0084] 2. Cell Transfection
[0085] The recombinant expression plasmid prepared in Example 1 was first incubated with a transfection reagent to form liposomes, and then the liposomes were incubated with cells for 6 hours to transfer the plasmid into the cells. Fresh culture medium was replaced after 6 hours.
[0086] 3. Dyeing
[0087] Continue to culture for 6 h, then replace with medium containing Halo-JFX650 (Promega HT1070) dye (set the gradient of dye concentration, the specific concentration and labeling efficiency are as follows Figure 2 The slides were incubated at 37°C for 5 minutes to stain. Preheated fresh culture medium was then replaced to wash away excess dye. This incubation was repeated three times, each lasting 5 minutes. After a 30-minute interval, the incubation was repeated three more times, each lasting 5 minutes. This resulted in a cell-laden glass slide, which served as a fixed cell sample for future use.
[0088] Example 3
[0089] In this example, the dual-labeled probe of Example 1 was expressed in cells, and the cells were fixed and stained, etc., and used as living cell samples for imaging and analysis in subsequent examples.
[0090] The same procedures as in Example 2 were followed except that the step of fixing the cells on the glass slide was omitted.
[0091] Example 4
[0092] 1. Single-molecule imaging
[0093] Take the samples prepared by 100nm Halo-JFX650 dye in Example 2 and Example 3, and first use four-color fluorescent beads (TetraSpeck TM Multicolor imaging was performed using microspheres (0.1 μm, blue / green / orange / deep red fluorescence, Thermofisher T7279). The following steps were included:
[0094] Two-color single-molecule imaging was performed on fixed and live cell samples using total internal reflection fluorescence microscopy (TIRFM). Cells with moderate expression density were selected and illuminated simultaneously with 488nm and 637nm lasers. Fluorescence was collected simultaneously with an exposure time of 50ms. 400 frames of images were collected for each cell for subsequent photobleaching analysis. The 637nm laser channel detected red fluorescence, designated as the first channel; the 488nm laser channel detected green fluorescence, designated as the second channel.
[0095] 2. Data Analysis
[0096] (1) Analysis of luminescence efficiency of fluorescent proteins
[0097] Draw the cell area in the image obtained by imaging, and use the image processing software tool Trackmate to locate the single molecule points in it. Use the four-color labeled fluorescent microbead image to analyze the aberration between the two channels, and then calibrate the channels. The number of single molecule points in the first channel is n tag1 , the number of single molecule points in the second channel is n tag2 Then, by analyzing the distance between any points in the two channels, if it is less than the threshold of 200 nm, it is determined to be co-localized, and the number of co-localized single molecule points n is obtained. colocalized The principle of calculating the labeling efficiency is Equation 1-3. Solving Equation 1-3 yields the luminescence efficiency of the two channels and the total number of proteins (Equation 4-6).
[0098] n tag1 =n all ×p tag1 (Equation 1),
[0099] n tag2 =n all ×p tag2 (Equation 2),
[0100] n colocalized =n all ×ptag1 ×p tag2 (Equation 3);
[0101] Among them, p tag1 is the luminescence efficiency of Halo-tag, p tag2 is the luminescence efficiency of the target fluorescent protein; n all is the number of total proteins expressed;
[0102] Solving the above system of equations yields:
[0103]
[0104]
[0105] Examples of images of fixed and living cell samples are shown below. Figure 3 (a) and Figure 4 As shown in (a), the calculated fluorescent protein luminescence efficiency histogram is as follows Figure 3 (b) and Figure 4 (b) shown.
[0106] (2) Analysis of the photobleaching characteristics of fluorescent proteins
[0107] Single-molecule signal-to-noise ratios of three fluorescent proteins in living and fixed cells Figure 5 (a) shows the anti-bleaching characteristics of the three fluorescent proteins analyzed based on 400 consecutive frames (50ms / frame). Figure 5 As shown in (b), it can be seen that the relative number of single molecules decreases with the extension of laser irradiation time.
[0108] The foregoing description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications or substitutions that can be readily conceived by a person skilled in the art within the technical scope disclosed herein are intended to be encompassed within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be subject to the scope of protection of the claims.
Claims
1. A method for detecting the luminous efficiency of a fluorescent protein, characterized in that: The method includes providing a dual-labeled probe, wherein the dual-labeled probe is a fusion protein comprising a self-labeling tag, a transmembrane protein or a transmembrane region fragment thereof, and a target fluorescent protein connected in sequence; the self-labeling tag releases a first detectable signal after binding to a substrate, and the target fluorescent protein releases a second detectable signal, wherein the first detectable signal and the second detectable signal are different; The host cell is made to express the dual-labeled probe, and the first detectable signal and the second detectable signal are detected to analyze and obtain the luminous efficiency of the target fluorescent protein.
2. The detection method according to claim 1, wherein The self-labeling tag comprises at least one of the following groups: SNAP-tag, Halo-tag, CLIP-tag, Spy-tag, Sortase-tag, FIAsH-tag.
3. The detection method according to claim 1, wherein The target fluorescent protein includes at least one of the following groups: GFP, eGFP, mGFP, sfGFP, mNeonGreen, StayGold, mStayGold, tdStayGold, EYFP, ECFP, EBFP2, tdTomato, MRFP, mRb3, mScarlet, DsRed, mCherry, Ypet, mKO, mkate, and iRFP.
4. The detection method according to claim 1, wherein The self-labeling tag is Halo-tag, and the target fluorescent protein is any one of eGFP, mNeonGreen and tdStayGold.
5. The detection method according to claim 1, wherein There is also a first connecting peptide between the self-labeling tag and the transmembrane protein or its transmembrane region fragment; and / or, There is also a second connecting peptide between the transmembrane protein or its transmembrane region fragment and the target fluorescent protein; Preferably, the first connecting peptide and the second connecting peptide are each independently selected from a flexible connecting peptide or a rigid connecting peptide.
6. The detection method according to claim 1, wherein The host cell comprises a nucleic acid molecule for expressing the dual-labeled probe, wherein the nucleic acid molecule comprises a nucleotide sequence encoding the dual-labeled probe.
7. The detection method according to claim 6, wherein The nucleic acid molecule further comprises a nucleotide sequence encoding a signal peptide, wherein the nucleotide sequence encoding the signal peptide and the nucleotide sequence encoding the dual-labeled probe are located in the same open reading frame; the signal peptide can guide the protein expressed by the nucleic acid molecule to be anchored to the cell membrane; Preferably, the signal peptide comprises at least one of the following groups: IgK signal peptide, BM40 signal peptide, OSM signal peptide.
8. The detection method according to claim 1, wherein The method further includes the following steps between detecting the first detectable signal and the second detectable signal: fixing the host cell on a transparent carrier.
9. The detection method according to any one of claims 1 to 8, wherein detecting the first detectable signal and the second detectable signal at a single molecule level; Preferably, said host cells are imaged by total internal reflection fluorescence microscopy.
10. The detection method according to claim 9, wherein Performing multi-channel imaging on the host cell, wherein the multi-channel imaging includes a channel for the first detectable signal and a channel for the second detectable signal, to obtain a multi-channel image; Analyze the multi-channel image to obtain the number n of single molecule spots in the first detectable signal channel tag1 , the number of single molecule spots n in the second detectable signal channel tag2 By analyzing the distance between any two single molecule points between the first detectable signal channel and the second detectable signal channel, the number of co-localization points n is obtained. colocalized ; Calculate the luminous efficiency of the target fluorescent protein = n colocalized / n tag2 ×100%; Preferably, the distance between any two single-molecule spots between the first detectable signal channel and the second detectable signal channel is analyzed, and if the distance is less than a threshold, it is determined to be co-localized; Preferably, the threshold is 200 nm.