Blocking ITGB8 in neurodegenerative disease
By blocking ITGB8-TGFb signaling, using ITGB8 inhibitors to intervene in microglia function, addressing the negative regulation of APOE4 in Alzheimer's disease and amyotrophic lateral sclerosis, restoring neuronal protection and plaque clearance, and improving the pathology of neurodegenerative diseases.
Patent Information
- Application Number
- CN202380078551.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-09-29
- Filing Date
- 2023-09-25
- Publication Date
- 2025-08-12
AI Technical Summary
The prior art has failed to effectively explain the role of APOE4 in microglia in Alzheimer's disease and amyotrophic lateral sclerosis, leading to accelerated progress in neurodegenerative diseases, and traditional treatments have failed to effectively block the negative regulation of ITGB8-TGFb signaling.
By blocking the signaling of the integrin subunit β8 (ITGB8), using ITGB8 inhibitors such as antibodies or targeting oligonucleotides that reduce ITGB8 expression, intervene in the function of microglia, restore the MGnD phenotype, and reduce the pathology of neurodegenerative diseases.
The normal function of microglia is restored, neuronal loss and amyloid protein plaques are reduced, neuroprotein is improved, neuroprotein clearance is enhanced, astrocytes and plaques are eliminated, and the symptoms of neurodegenerative diseases are alleviated.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
[0001] Priority claim
[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 411,585, filed September 29, 2022. The entire contents of the foregoing are incorporated herein by reference.
[0003] Federally funded research or development
[0004] This invention was made with government support under Grant Nos. AG051812, AG054672, AG075509, AG076982, AG080992, EY027921, NS088137, NS104609, and NS101673 awarded by the National Institutes of Health. The government has certain rights in this invention. Technical Field
[0005] Provided herein are methods and compositions for blocking integrin subunit β8 (ITGB8, also known as integrin αvβ8) to treat neurodegenerative diseases associated with microglial damage, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS). Background Art
[0006] Microglia play a crucial role in maintaining normal brain function 1 , but may lead to neurodegeneration in disease 2 Recently, genome-wide association meta-analysis studies (GWAS) 3, 4 and interactome studies 5 We found that the gene expression pattern of microglia is closely related to late-onset Alzheimer's disease (AD). We found that neurodegenerative microglia (MGnD) 6 , also known as disease-associated microglia (DAM) 7 , including AD 6 In different neurodegenerative models, including AD, AD is regulated by the mutual inhibition of transforming growth factor beta (TGFβ) and the induction of apolipoprotein E (APOE) signaling. There are three major variants of human APOE: e2, e3, and e4. APOE e4 is the main genetic risk factor for late-onset AD, and previous studies have shown that it can accelerate the progression of AD in humans and mouse models. 8, 9, 10, 11, 12, 13 In the central nervous system (CNS), APOE is expressed in astrocytes, reactive microglia, oligodendrocytes, endothelial cells, and choroid plexus epithelial cells. 14, 15However, the role of APOE4 in regulating microglial phenotype and function in vivo is unclear. APOE is a multifunctional protein in the CNS and peripheral systems, primarily expressed in the liver and to a lesser extent in immune cells. 16, 17 Although APOE4 deletion in hepatocytes does not affect amyloid deposition in APP / PS1 mice 18 However, liver-specific expression of APOE4 in an Apoe knockout (KO) background enhances AD pathology and impairs cognitive ability in amyloid precursor protein (APP) transgenic mice. 19 Furthermore, APOE4 deletion in astrocytes significantly reduced tauopathy 20 Neurodegeneration in mouse models. Multiple studies have investigated the molecular characteristics of microglia in mice expressing APOE4 globally. 12, 13 However, the cell-autonomous role of APOE4 expressed by microglia in regulating AD pathology has not been elucidated. Summary of the Invention
[0007] APOE e4 is the strongest genetic risk factor for late-onset Alzheimer's disease (AD). Although the contribution of microglial APOE4 to AD pathogenesis remains unclear, APOE is most enriched for gene expression in neurodegenerative microglia (MGnD). Here, we show that microglial APOE4 plays a negative role in the MGnD response that induces neurodegeneration in mice and humans. Microglial APOE4 deletion restores the MGnD phenotype, is associated with neuroprotection in P301S tau transgenic mice, and reduces pathology in APP / PS1 mice. Mechanistically, APOE4-mediated induction of ITGB8-TGFb signaling impairs the MGnD response by upregulating microglial homeostatic checkpoints, including INPP5D in mice. Microglial INPP5D deletion restores MGnD-astrocyte crosstalk and promotes plaque clearance in APP / PS1 mice. We identified the microglial APOE4-ITGB8-TGFb pathway as a negative regulator of microglial responses to AD pathology; as shown here, restoring the MGnD phenotype by blocking ITGB8-TGFb signaling could be used as a therapeutic intervention for neurodegenerative diseases including AD and ALS.
[0008] Therefore, provided herein are methods for treating subjects with neurodegenerative diseases associated with microglial damage, comprising administering a therapeutically effective amount of an integrin subunit β8 (ITGB8) inhibitor. Also provided herein are methods for treating subjects with neurodegenerative diseases associated with microglial damage using an inhibitor of ITGB8.
[0009] In some embodiments, the inhibitor of ITGB8 is an antibody that binds to ITGB8. In some embodiments, the antibody that binds to ITGB8 is ADWA11, ADWA16, C6D4, 37E11, HuC6D4F12, CL7290, or a humanized form thereof. In some embodiments, the humanized form is ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, ADWA11-2.4, ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16 hugraft, Abl, Ab2, or Ab3.
[0010] In some embodiments, the ITGB8 inhibitor is an inhibitory oligonucleotide targeting human ITGB8 that reduces ITGB8 expression. In some embodiments, the oligonucleotide is 15 to 21 nucleotides in length. In some embodiments, at least one nucleotide of the oligonucleotide is a nucleotide analog. In some embodiments, the oligonucleotide is a gapmer or a mixmer.
[0011] In some embodiments, the neurodegenerative disorder is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS).
[0012] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) shall prevail.
[0013] Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figures 1A to 1M APOE4 impairs the response of microglia to acute neurodegeneration. A, Heat map of differentially expressed genes (DEGs) in 4-month-old APOE4-KI versus APOE3-KI microglia and DEGs identified using DESeq2 analysis and LRT (n = 11-14 mice / group, P < 0.05). B, Normalized counts of Spi1. C, Schematic diagram of the injection of apoptotic neurons into the cortex and hippocampus of 8-month-old APOE3-KI and APOE4-KI mice; sorting strategy for labeled apoptotic neurons 16 hours after injection of phagocytic and non-phagocytic microglia; created using Biorender.com. D, CD11b from the injection site of apoptotic neurons (AN) in APOE3-KI and APOE4-KI mice + / Fcrls + Gating strategy for microglia. E, Bar graph showing CD11b + / Fcrls + Percentage of cells (n = 7-9 mice / group). F, Principal component analysis (PCA) of each group. G, Heat map of phagocytic and non-phagocytic microglia from APOE3-KI and APOE4-KI mice. DEGs were identified using DESeq2 analysis and LRT (n = 4-6 mice / group, P < 0.05). H, Gene ontology analysis of DEGs for phagocytosis, autophagosome maturation, IFNg signaling, and antigen presentation (P < 0.05). I, Confocal microscopy images of Iba1, Lamp1, and AN at the injection site. J, Each Iba1 + Quantification of Lamp1 immunoreactivity of cells (n = 6-7 mice / group). K, Schematic diagram of tamoxifen administration at 1.5 months of age and AN injection into the cortex and hippocampus of 8-month-old APOE3-KI, APOE4-KI, APOE3-cKO, and APOE4-cKO mice. L, CD11b at the injection site of APOE4-KI and APOE4-cKO mice (n = 4 mice / group). + / Fcrls + Percentage of microglia. M, Heatmap of non-phagocytic and phagocytic microglia isolated from APOE3-KI, APOE3-cKO, APOE4-KI, and APOE4-cKO mice injected with AN. DEGs were identified using DESeq2 analysis and LRT (n = 3-6 mice / group, P < 0.05). Two-tailed Student's t-test. Data are expressed as mean ± sem.
[0015] Figure 2A to Figure 2M APOE4 impairs microglial responses to neurodegeneration via PU.1. A, Spi1 fl / fl Schematic diagram of brain injection of Tat-Cre or PBS followed by AN injection; created using Biorender.com. B, Volcano plot showing the changes in the expression of Tat-Cre or PBS in Spi1 cells. fl / fl DEGs in phagocytic microglia isolated from mice. DEGs were identified using DESeq2 analysis and LRT (n = 5 mice / group, P < 0.05). C, Scatter plot comparing DEGs in microglia from Spi1-cKO and APOE4-cKO mice. DEGs were identified using DESeq2 analysis and LRT (P < 0.05, Log2FC > 0.25 or <-0.25). D, DEGs from Tmem119 WT / WT :Spi1 fl / WT :APP / PS1 and Tmem119 CreERT2 / WT :Spi1 fl / WT : Representative images of APP / PS1 mouse brain sections stained for HJ3.4B. E, HJ3.4B + Quantification of regions / ROIs (n = 3-6 mice / group). F, Tmem119 WT / WT :Spi1 fl / WT :APP / PS1 and Tmem119 CreERT2 / WT :Spi1 fl / WT : Confocal images of Clec7a, HJ3.4B, and Iba1 in APP / PS1 mice. G, Clec7a per plaque + and Iba1 + Quantification of area (n = 3-6 mice / group). H, Heat map of microglia isolated from APP / PS1:APOE4-KI mice injected with PU.1 inhibitor and control. DEGs were identified using DESeq2 analysis and LRT (n = 4-5 mice / group, P < 0.05). I, Confocal images of Iba1 and Clec7a in APP / PS1:APOE4-KI mice injected with PU.1 inhibitor and control. J, Clec7a immunoreactivity and Iba1 in each ROI + Quantification of area (n = 4-5 mice / group). K, Normalized counts of serpin a3n in astrocytes isolated from APP / PS1:APOE4-KI mice injected with PU.1 inhibitor and control mice (n = 4-5 mice / group). L, Confocal images of Gfap and serpin a3n in APP / PS1:APOE4-KI mice injected with PU.1 inhibitor and control mice. M, serpin a3n per ROI + / Gfap +Quantification of area (n = 4-5 mice / group). Two-tailed Student's t-test. Data are expressed as mean ± sem.
[0016] Figure 3A to Figure 3H APOE4 deletion in microglia restores MGnD responses to chronic neurodegeneration and promotes neuroprotection. A, Schematic diagram of tamoxifen administration at 1.5 months of age and analysis of P301S mice at 9 months of age; created using Biorender.com. B, qPCR validation of human APOE expression in sorted microglia (n = 6-9 mice / group). C, DEGs in aggregated samples analyzed for WT and Tau (P301S) with the APOE variant. DEGs were identified using DESeq2 analysis and LRT (n = 3-11 mice / group, P < 0.01). D, Confocal images of Clec7a, phosphorylated tau (AT-100), and Iba1. Arrows indicate Clec7a associated with phosphorylated tau in the cortex of P301S:APOE3-KI, P301S:APOE3-cKO, P301S:APOE4-KI, and P301S:APOE4-cKO mice. + Microglia. E, Quantification of Clec7a and AT-100 positive areas in the cortex (n = 7-16 ROI / group). F, Volcano plot of DEGs in P301S:APOE4-cKO and P301S:APOE4-KI mice. DEGs were identified using DESeq2 analysis and LRT (n = 3-8 mice / group, P < 0.05). G, Representative images of cresyl violet staining of P301S mice carrying different APOE variants. Dashed squares indicate regions of interest. H, Quantification of cortical neurons in WT and P301S mice carrying different APOE variants (n = 7-10 mice / group). One-way analysis of variance. Data are expressed as mean ± sem.
[0017] Figure 4A to Figure 4E Targeting APOE4 to microglia limits Ab pathology in APP / PS1 mice. A, Schematic diagram of tamoxifen administration at 1.5 months of age and analysis of APP / PS1 mice at 4 months of age; created using Biorender.com. B, qPCR validation of human APOE expression in sorted microglia (n = 3-12 mice / group). C, Heat map showing the top 100 DEGs in microglia isolated from APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice. DEGs were identified using DESeq2 analysis and LRT (n = 5-9 mice / group, P < 0.01). D, Cortical HJ3.4B +Quantification of plaque number / ROI (n = 7-14 mice / group). E, Quantification of Lamp1 region in the cortex (n = 7-14 mice / group). One-way ANOVA. Data are expressed as mean ± sem.
[0018] Figure 5A to Figure 5M. Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. a, UMAP plot of scRNA-seq analysis of astrocytes showing clusters 3 and 5. Violin plots of key activated genes: Gfap, Vim, Fabp7, and Cd9 representing clusters 3 and 5. b, Volcano plot of cluster 3 comparing APP / PS1:APOE4-cKO and APP / PS1:APOE4-KI mice. FindMarkers Seurat function was used to identify DEGs (P < 0.05). c, Ring plot showing Gfap in APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice. + Apoe 低 and Gfap + Apoe 高 Percentage of astrocyte clusters. d, Typical pathways with the largest upregulation in astrocytes in cluster 3 identified using IPA. DEGs for pathway enrichment analysis (P < 0.05) were identified using the FindMarkers Seurat function and pathways selected at P < 0.05. e, Confocal images of Gfap, Iba1, and human APOE in the cortex of 4-month-old APP / PS1:APOE3-KI, APP / PS1:APOE3-cKO, APP / PS1:APOE4-KI, and APP / PS1:APOE4-cKO mice. Yellow arrows indicate human APOE immunoreactivity or its expression in Gfap. + and Iba1 + Loss of Gfap in cells. f, Gfap + Quantification of regions (n = 39-61 plaques / group). g, Gfap associated with plaques + Apoe + Quantification of immunoreactivity (n = 39-61 plaques / group). h, Confocal images of serpin a3n, Gfap, and HJ3.4B. i, Gfap + Serine protease inhibitor a3n +Quantification of immunoreactivity (n = 30-44 plaques / group). j, Schematic diagram of the experimental design for adoptive transfer of phagocytic microglia showing isolation of MGnD from APOE3-KI, APOE4-KI, and APOE4-cKO mice and injection into 2-month-old WT recipient mice, followed by isolation of astrocytes from the recipient mice 16 hours later; created using Biorender.com. k, Volcano plot showing DEGs in astrocytes isolated from WT recipient mice injected with MGnD microglia, which were sorted from APOE4-KI mice compared to APOE3-KI mice. DEGs were identified using DESeq2 analysis and LRT (n = 3 mice / group, P < 0.05). l, Volcano plot showing DEGs in astrocytes isolated from WT recipient mice injected with MGnD microglia, which were sorted from APOE4-KI mice compared to APOE4-KI mice. DEGs were identified using DESeq2 analysis and LRT (n = 3 mice / group, P < 0.05). m, IPA analysis of the most affected upstream regulators in WT astrocytes isolated from recipient mice after injection of APOE4-cKO MGnD cells and APOE4-KI MGnD cells. DEGs for upstream analysis were identified using DESeq2 analysis and LRT (n = 3 mice / group, P < 0.05). Upstream regulators were selected at P < 0.05. One-way ANOVA. Data are expressed as mean ± sem.
[0019] Figure 6A to Figure 6LImpaired MGnD signature induction and astrocyte activation in APOE e4 AD carriers. Volcano plots of bulk RNAseq analysis of total brain tissue isolated from males (a) and females (b), showing selected DEGs induced (red dots) and repressed (blue dots) in AD APOE e3 / 4 carriers compared to AD APOE e3 / 3 carriers. DEGs were identified using DESeq2 analysis and LRT (n = 5-7 donors for males and n = 6-7 donors for females, P < 0.05). c, Comparison of the top 100 DEGs in female AD:APOE e3 / 4 carriers with those in AD:APOE e3 / 3 carriers. DEGs were identified using DESeq2 analysis and LRT (P < 0.05, n = 6-7 donors / group). d, Normalized counts of key affected genes. e, The most affected KEGG pathways in female AD:APOE e3 / 3 carriers compared to AD:APOE e3 / 4 carriers. DEGs for pathway analysis were identified using DESeq2 analysis and LRT. f, Volcano plot of microglial DEGs analyzed from the dataset by Zhou et al. in AD:APOE e3 / 4 carriers compared to APOE e3 / 3 carriers. 49 The FindMarkers Seurat function was used to identify DEGs (n = 6 AD:APOE e3 / 3 carriers, n = 4 AD:APOE e3 / 4 carriers, P < 0.05). g, Confocal images of brain sections from APOE e3 / 3 and e3 / 4 AD females stained for pSmad3, IBA1, and HJ3.4B analysis. h, IBA1 + Quantification of pSMAD3 immunoreactivity in cells (n = 27-33 cells / group). i, Confocal microscopy images of GFAP in AD brains carrying APOE e3 / 3 and e3 / 4. j, Quantification of GFAP immunoreactivity per plaque (n = 43-52 plaques / group). k, Annular plots represent the analysis of the dataset by Zhou et al. 49 , showing GFAP in AD:APOE e3 / 4 and APOE e3 / 3 carriers Hi Serpin A3 + and GFAP Hi Serpin A3 – Percentage of astrocyte clusters (mean expression cutoffs were GFAP > 4 and serpin A3 > 0). Volcano plot of astrocyte DEGs analyzed from the dataset by Zhou et al. in AD:APOE e3 / 4 carriers compared with APOE e3 / 3 carriers. 49. The FindMarkers Seurat function was used to identify DEGs (n = 6 AD:APOE e3 / 3 carriers, n = 4 AD:APOE e3 / 4 carriers, P < 0.05). White arrows indicate the magnified ROI of ig. Two-tailed Student's t-test. Data are expressed as mean ± sem.
[0020] Figure 7A to Figure 7P . Blocking ITGB8-TGFb signaling enhances MGnD responses and reduces AD pathology in APP / PS1 mice. a, Representative images of Tmem119 immunoreactivity in sagittal brain sections of Itgb8-cKO mice and control littermates. The affected area (cortex) is indicated in blue. White arrows indicate magnified ROIs. b, Confocal microscopy images of Clec7a, Gfap, and Apoe in Itgb8-cKO and control mice. (c) Clec7a in the cortex + and (d) Gfap + Quantification of immunoreactivity (n = 12 ROI / group). e, Heat map of microglia isolated from Itgb8-KO and control mice. DEGs were identified using DESeq2 analysis and LRT (n = 4-5 mice / group, P < 0.05). f, Top KEGG pathways in Itgb8-KO microglia compared with control microglia. DEGs for pathway analysis were identified using DESeq2 analysis and LRT with P < 0.05 and pathways selected at P < 0.05. g, Confocal images of pSmad3, Apoe, and Iba1 in Itgb8-cKO and control mice. White arrows indicate magnified ROIs. h, Iba1 + Quantification of pSmad3 immunoreactivity in cells (n = 45-47 cells / group). i, Iba1 + Quantification of Apoe immunoreactivity in cells (n = 45–47 cells / group). j, Scatter plot comparing DEGs in microglia from Itgb8-cKO and Tgfbr2-cKO mice as described by Lund et al. 75. DEGs were identified using DESeq2 analysis and LRT (n = 3 mice / group for Lund et al.; n = 4 / 5 mice / group for Itgb8-cKO; P < 0.05, Log2FC > 0.25 or < -0.25). k, Schematic diagram of administration of anti-ITGB8 neutralizing antibody or IgG isotype control to the brains of APP / PS1 mice and analysis 3 days later. l, Heat map of microglia isolated from APP / PS1 mice treated with anti-ITGB8 neutralizing antibody and IgG isotype control, and the top GO pathways affected. DEGs were identified using DESeq2 analysis and LRT (n = 5 mice / group, P < 0.05). m, HJ3.4B at the injection site of APP / PS1 mice 14 days after treatment with anti-ITGB8 neutralizing antibody and IgG isotype control. + Confocal images of plaques. n, HJ3.4B at the injection site + Quantification of plaques (n = 8-9 mice / group). o, Gfap, Clec7a, and HJ3.4B at the injection site of APP / PS1:APOE4 KI mice 14 days after treatment with anti-ITGB8 neutralizing antibody and IgG isotype control. + Confocal images of plaques. p, HJ3.4B in each ROI at the injection site + Plaque area, Gfap + Region and Clec7a + Quantification of regions (n = 11 ROIs, from 6-7 mice / group). Two-tailed Student's t-test. Data are expressed as mean ± sem.
[0021] Figure 8A to Figure 8E. Impaired MGnD signature induction and astrocyte activation in APOE e4 AD brains. a, Confocal images of GFAP and HJ3.4B immunoreactivity in AD:APOE e3 / 4 males compared to AD:APOE e3 / 3 males and ITGB8 gene expression detected using RNAscope. b, ROIs and GFAP in AD:APOE e3 / 4 males compared to AD:APOE e3 / 3 males. + Quantification of ITGB8 fluorescence in astrocytes (c) (n = 7-8 donors / group). d, Confocal images of GFAP and HJ3.4B immunoreactivity in APP / PS1:APOE4-cKO mice compared to APP / PS1:APOE4-KI mice and detection of Itgb8 mRNA expression using RNAscope. e, GFAP +Quantification of ITGB8 fluorescence in astrocytes (3-5 mice / group, n = 10-18 ROIs). Two-tailed unpaired Student's t-test. Data are expressed as mean ± sem.
[0022] Figures 9A to 9B Blocking Itgb8 signaling enhances MGnD responses and reduces AD pathology in APP / PS1 mice. A, Quantification of the percentage of Ab-42-phagocytic microglia in WT and Itgb8-cKO mice (n = 5-10 mice / group). B, MHC II, Iba1, and HJ3.4B in APP / PS1 mice injected with anti-ITGB8 neutralizing antibodies and IgG isotype controls. The figure shows the expression of MHC II at the injection site. + Quantification of immunoreactivity (n = 4 mice / group). Two-tailed Student's t-test. Data are expressed as mean ± sem.
[0023] FIG. 10A to FIG. 10B Smad2 / 3 deficiency in microglia induces an MGnD phenotype. a, Expression of key homeostatic and MGnD genes in microglia from Itgb8-cKO mice (n = 4-5 mice / group) relative to non-transgenic control mice. b, Expression levels of key AD risk factor genes (Inpp5d, Havcr2, and Bin1) in microglia from Itgb8-cKO mice (n = 4-5 mice / group) relative to non-transgenic control mice. Two-tailed Student's t-test. Data are expressed as mean ± sem.
[0024] Figures 11A-11D. Targeting ITGB8-TGFb signaling with ADWA-11 alleviates cognitive decline in 5xFAD mice. A, Schematic diagram of anti-ITGB8 treatment and behavioral testing (n = 15). B, T-maze assessment. C, Latency in the water maze was assessed in WT and 5xFAD mice over a five-day trial. Univariate analysis was performed using the area under the curve. D, Quantification of time spent in the target quadrant on each water maze day (%). Univariate analysis. Data are expressed as mean ± sem. *P < 0.05, **P < 0.01. DETAILED DESCRIPTION
[0025] Several mechanisms have been proposed by which APOE4 increases the risk of AD, most involving models with global APOE4 expression or astrocyte-specific deletion. 12, 13, 20, 58Here we demonstrate a cell-autonomous negative regulation of microglial APOE4 in the acquisition of the MGnD phenotype in response to neurodegeneration. In mice with tau and amyloid pathology, microglial APOE4 deletion restored the induction of the MGnD response, resulting in improved neuronal survival, reduced plaque pathology, and increased association of microglia and astrocytes with Aβ plaques. Microglial APOE3 deletion reduced Clec7a expression to levels comparable to APOE4-KI in P301S mice. Our recent studies showed that APOE4-KI glaucoma mice have impaired MGnD responses, consistent with Apoe - / - mice 22 Thus, microglial expression of APOE3 is essential for inducing the MGnD response to neurodegeneration, and its deletion accelerates neuronal loss, whereas microglial APOE4 deletion favors neuroprotection in tau mice. In addition to APOE's classic role in cholesterol trafficking, APOE4 has been shown to have acquired a novel function in the nucleus, where it can translocate and directly bind to DNA to influence the transcription of genes associated with AD. 59, 60 Furthermore, microglia expressing APOE4 exhibited increased nuclear localization in AD brain tissue. 59 These results suggest that APOE4 nuclear localization may directly repress MGnD gene transcription, a function that is absent in APOE3 microglia and that is abrogated by APOE4 deletion. Thus, APOE may have a dual role in controlling MGnD responses based on its subcellular localization, a role that may be altered in APOE4-expressing microglia, explaining the differential effects on neurodegeneration observed in tau mice following microglial APOE3 deletion compared with APOE4 deletion. Consistent with these findings, we found that the transcription factor PU.1 is upregulated in APOE4-KI microglia, and its microglial deletion results in robust MGnD gene induction. Furthermore, Liu et al., utilizing microglial-specific expression of human APOE variants, demonstrated that microglial APOE3 elicits a transcriptomic signature of an activated immune response, whereas APOE4 attenuates activation of the inflammatory response to amyloid pathology. This APOE4 microglial phenotype is associated with reduced expression of genes involved in antigen presentation and interferon responses, as well as increased Aβ plaque deposition. In the brains of AD patients carrying the APOE e4 allele, we found that MGnD signatures were impaired in a sex-dependent manner, with significantly reduced astrocyte activation in females. In the brains of APOE e4 AD females, expression of proteins including CD33, BIN1, ABCA7, CR1, INPP5D, and HAVCR2 was significantly upregulated. 4, 61 Several AD risk genes, including MGnD, were enriched and associated with downregulation of the key MGnD gene. 6, 21, 22These results support previous reports demonstrating that higher PU.1 expression in humans may lead to earlier onset of AD. 29, 62 In female AD brains with the APOE e4 allele, PU.1 expression is associated with increased SMAD3 expression, which would enhance microglial homeostasis as a downstream molecule of TGFb signaling. 21, 28, 50 Furthermore, immunoreactive phosphorylated SMAD3 (pSMAD3), a marker of TGFb signaling, was increased in microglia in the brains of female AD patients with the APOE e4 allele, suggesting that microglial homeostasis characteristics were promoted. The TGFb-rich environment in the brains of AD patients with APOE e4 carriers inhibits astrocyte activation, which is consistent with the finding that astrocytes respond to TGFb ligands to suppress TGFb activation. 63 and Tgfbr2 44 Consistent with previous reports, the loss of APOE4 in microglia in APP / PS1 mice promotes astrocyte activation and Ab plaque encapsulation. Furthermore, reactive astrocytes have been shown to play a beneficial role in limiting AD pathology, and their depletion in AD mice leads to increased plaque burden, synaptic dysfunction, and memory loss. 64 These findings in mice and humans suggest that APOE4 may mediate TGFb-dependent microglial homeostasis in part by inducing 21 Leading to AD pathology, the regulators impair microglia-astrocyte crosstalk in response to neurodegeneration. In line with these findings, Liu et al. demonstrated that APOE4 reduced activated microglial responses characteristic of AD pathology in the human brain and in microglia derived from human induced pluripotent stem cells harboring the APOE e4 allele.
[0026] Although studies have shown that TGFb signaling plays both beneficial and detrimental roles in AD 72 However, its overproduction in astrocytes can promote cerebral vascular fibrosis and amyloidosis. 73 Furthermore, TGFb1 has been implicated in vascular dementia, promoting abnormal vascular remodeling, and has been proposed as a therapeutic target for AD. 74 We detected upregulation of ITGB8 in APOE e4 carriers with AD males, suggesting that ITGB8 plays a key role in the activation of latent TGFb1. 51. In the AD brains of females carrying the APOE e4 allele, we found that induction of SMAD3 and INPP5D signaling was associated with downregulation of the MGnD gene. Mechanistically, genetic deletion of Itgb8 or Inpp5d was sufficient to restore MGnD responses and astrocyte activation, concomitantly reducing plaque burden in AD mice. Furthermore, pharmacological blockade of ITGB8-TGFb signaling enhanced MGnD responses associated with increased plaque clearance in AD mice. These data support a beneficial role for MGnD-microglia in limiting AD pathology and identify the ITGB8-TGFb axis as a therapeutic intervention for AD.
[0027] Treatment
[0028] Provided herein are methods for reducing the microglial damage response to neurodegeneration in a subject and methods for treating neurodegenerative diseases associated with microglial damage. The methods can be used in any mammalian subject, such as a human subject. Accordingly, provided herein are methods for treating a subject in need thereof, such as a subject suffering from microglial damage and / or a neurodegenerative disease associated with microglial damage, comprising administering to the subject an effective amount of an ITGB8 inhibitor.
[0029] In some embodiments, the neurodegenerative disease relevant to microglial injury is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS).In some embodiments, experimenter suffers from Alzheimer's disease or another tau disease, such as frontotemporal dementia, frontotemporal dementia with Parkinson's disease, frontotemporal dementia, multisystem tau disease, multisystem tau disease with pre-senile dementia, Wilhelmsen-Lynch disease, disinhibition-dementia-Parkinson's disease-amyotrophic dystrophy syndrome, Pick's disease or Pick's disease-like dementia, corticobasal degeneration, frontotemporal dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS) or multiple sclerosis (MS), for example, progressive MS.In some embodiments, the disease is or is not the neurodegenerative disease associated with eyes, such as glaucoma and age-related macular degeneration.
[0030] As used herein, a "therapeutically effective amount" is an amount sufficient to alleviate disease signs or symptoms, reduce (slow down) disease progression, reduce disease severity in a subject diagnosed with the disease. A "prophylactic effective amount" is an amount that reduces the incidence or risk of disease signs or symptoms in a subject at risk of the disease, or delays the appearance of disease signs or symptoms in a subject at risk (e.g., a subject with a genetic mutation associated with a disease as described herein). Signs or symptoms may include dementia, forgetfulness / memory loss. A subject as described herein can be a human being diagnosed with a neurodegenerative disease as described herein or with a mutation associated with a neurodegenerative disease as described herein.
[0031] An effective amount can be administered in one or more administrations, applications or dosages. The therapeutically effective amount (i.e., effective dose) of a therapeutic compound depends on the selected therapeutic compound. The composition can be administered once or more daily to once or more weekly; including once every other day. It will be understood by those skilled in the art that certain factors may affect the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or condition, previous treatment, the overall health and / or age of the subject, and the presence of other diseases. In addition, treating a subject with a therapeutically effective amount of a therapeutic compound described herein can include a single treatment or a series of treatments.
[0032] The dosage, toxicity and therapeutic efficacy of therapeutic compounds can be determined by standard drug procedures in cell culture or experimental animals, such as determining LD50 (50% population lethal dose) and ED50 (50% population effective therapeutic dose). The dose ratio between toxic effect and therapeutic effect is the therapeutic index and it can be expressed as the LD50 / ED50 ratio. Preferably, the compound showing a high therapeutic index. Although compounds showing toxic side effects can be used, the delivery system at the position of the affected tissue of the compound target should be taken with caution to design, thereby the potential damage to uninfected cells will be minimized and the side effect will be reduced thus.
[0033] Data obtained from cell culture assays and animal studies can be used in formulating dosage ranges for humans. The dosage of the compound is preferably within a range of circulating concentrations that includes the ED50 while having minimal or no toxicity. The dosage may vary within this range depending on the dosage form employed and the route of administration utilized. For any compound used in the methods described herein, a therapeutically effective dose can initially be estimated by cell culture assays. Doses can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound that achieves half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.
[0034] ITGB8 inhibitors
[0035] Many ITGB8 inhibitors are known in the art, including antibodies and inhibitory oligonucleotides.
[0036] Anti-ITGB8 antibody
[0037] Antibodies and antigen-binding fragments thereof that bind to human ITGB8 include CL7290 (described in WO2022268644); the 37E1 antibody described in US9290572; ADWA-2, ADWA-8, ADWA-10, ADWA-11, ADWA-13, ADWA-15, ADWA-16, ADWA-25, and ADWA-20 (described in US20160046717); C6D4 and other antibodies such as B13C4 15-8, B13C4 15-10, B13H3.2, B13C1231015, B15B11VH, B2B2 15-9, R11D12715.3, RSDLVH-1, RSDLVH-3, RSDLVH-16, both 29 and 44, A1=B4=F9, A5=C6 and D4=E6 (described in WO2018064478); HuC6D4F12 (described in US20210277125) and variants thereof, including humanized and chimeric forms thereof. In some embodiments, the antibody is a humanized ADWA11 antibody described in WO2020051333 (including ADWA11 VH01 / VK01, ADWA11 VH02 / VK01, ADWA11 VH03 / VK01, ADWA11 VH03 / VK02, ADWA11 VH05 / VK01, ADWA11 VH05-2 / VK01, ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, and ADWA11-2.4) and a humanized ADWA16 antibody (including ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16 hugraft, Abl, Ab2, or Ab3 described in WO2022164816). Additional antibodies may be known in the art or obtained using methods known in the art, including those described in the above references.
[0038] In some embodiments, the antibody or antigen-binding fragment thereof specifically binds to humans and blocks binding of the TGFβ peptide to ανβ8.
[0039] Inhibitory oligonucleotides targeting ITGB8
[0040] As described above, the methods can include administering inhibitory oligonucleotides ("oligonucleotides") that target ITGB8 (i.e., ITGB8 mRNA or DNA) to reduce ITGB8 expression. Oligonucleotides that can be used in the present methods and compositions include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single-stranded or double-stranded RNA interference (RNAi) compounds (such as siRNA compounds), molecules containing modified bases, locked nucleic acid molecules (LNA molecules), miRNA antagonists (antagomirs), peptide nucleic acid molecules (PNA molecules), mixed oligomers, gapmers, and other oligomeric compounds or oligonucleotide mimetics that hybridize to at least a portion of ITGB8 and modulate its function. In some embodiments, the oligonucleotides include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides containing modified linkages, interfering RNA (RNAi), short interfering RNA (siRNA); or short hairpin RNA (shRNA); or combinations thereof. See also WO 2015 / 051239.
[0041]
[0042] An exemplary genomic sequence of human ITGB8 is located at NC_000007.14, ranging from 20329766 to 20415754.
[0043] In some embodiments, the oligonucleotide hybridizes to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the target sequence.
[0044] In some embodiments, the method comprises introducing an oligonucleotide that specifically binds to or is complementary to ITGB8 into a cell. A nucleic acid that "specifically" binds primarily to its target, i.e., to ITGB8 RNA, but does not bind to other non-target RNAs. Thus, the specificity of a nucleic acid interaction refers to its function (e.g., inhibiting ITGB8) rather than its ability to hybridize. The oligonucleotide may exhibit nonspecific binding to other sites in the genome or other mRNAs without interfering with the binding of other regulatory proteins or causing degradation of the nonspecifically bound RNA. Thus, such nonspecific binding does not significantly affect the function of other non-target RNAs and does not produce significant adverse effects. These methods can be used to treat a subject, e.g., a subject at risk for neurodegeneration after an acute injury or with evidence of a chronic neurodegenerative disease, by administering to the subject a composition comprising an oligonucleotide that binds to ITGB8 (e.g., as described herein). Examples of ITGB8 target sequences are provided above. Exemplary sequences include commercially available sequences, such as shRNA from Santa Cruz Biotechnology, and the following siRNAs: AATTCTCCCGAACGTGTCACGT, AACGTCTATTGTCAAATCGACA, and CAGCCTGTTTGCAGTGGTCGA (5′-3′), or the following shRNAs shB8-1 or shB8-4: GGAATCTCATTCGATGCATAC, CCAAGCTACTTGAGAATATTT, and TCTCGCTCTTGATAGCAAATT (5′-3′) (Malric et al., Mol Cancer Res. 2019 Feb;17(2):384-397).
[0045] In some embodiments, the methods described herein include administering a composition, such as a sterile composition, comprising an oligonucleotide complementary to an ITGB8 sequence described herein. The oligonucleotide used to practice the methods described herein can be an antisense RNA or a small interfering RNA, including but not limited to shRNA or siRNA. In some embodiments, the oligonucleotide is a modified nucleic acid polymer (e.g., a locked nucleic acid (LNA) molecule), a gapmer, or a mixed polymer.
[0046] Oligonucleotides have been used as therapeutic moieties for treating diseases in animals, including humans.Oligonucleotides can be useful therapeutic modalities that can be formulated into therapeutic regimens for treating cells, tissues, and animals, particularly humans.
[0047] For therapeutics, an animal (preferably a human) suspected of having a neurodegenerative disease or at risk of developing a neurodegenerative disease is treated by administering an oligonucleotide according to the present disclosure. For example, in one non-limiting embodiment, the method comprises the step of administering a therapeutically effective amount of an oligonucleotide as described herein to an animal in need of treatment.
[0048] In some embodiments, the oligonucleotide is 10 to 50, 13 to 50, or 13 to 30 nucleotides in length. One of ordinary skill in the art will appreciate that this includes oligonucleotides having antisense (complementary) portions that are 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therein. It should be understood that such oligonucleotides may contain non-complementary bases; for example, an oligonucleotide that is 30 nucleotides in length may have a portion that is 15 bases complementary to the target ITGB8 RNA. In some embodiments, the oligonucleotide is 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds described herein are 12 or 13 to 30 nucleotides in length. One of ordinary skill in the art will understand that this encompasses oligonucleotides having antisense (complementary) portions that are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, or any range therein.
[0049] Preferably, the oligonucleotide comprises one or more modifications including: modified sugar moieties, and / or modified internucleoside linkages, and / or modified nucleotides, and / or combinations thereof. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact, more than one modification described herein may be incorporated into a single oligonucleotide or even into a single nucleoside within an oligonucleotide.
[0050] In some embodiments, the oligonucleotide is a chimeric oligonucleotide containing two or more chemically different regions, and each region is composed of at least one nucleotide. These oligonucleotides generally contain the region of at least one modified nucleotide, and the region gives one or more beneficial properties (such as, for example, the nuclease resistance increased, the cellular absorption increased, the target binding affinity increased) and a region as the substrate of the enzyme that can cut RNA: DNA or RNA: RNA hybrid. Chimeric oligonucleotide as herein described can be formed into the composite structure of two or more oligonucleotides as above, modified oligonucleotides, oligonucleoside and / or oligonucleotide mimetics. Such compounds are also referred to as hybrids or gap polymers in the art. Representative U.S. patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Patent Nos. 5,013,830, 5,149,797, 5,220,007, 5,256,775, 5,366,878, 5,403,711, 5,491,133, 5,565,350, 5,623,065, 5,652,355, 5,652,356, and 5,700,922, each of which is incorporated herein by reference.
[0051] In some embodiments, the oligonucleotide comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'-fluoro modified nucleotide. In other preferred embodiments, RNA modifications include 2'-fluoro, 2'-amino and 2'-O-methyl modifications on pyrimidine ribose, abasic residues or inverted bases at the 3' end of the RNA. Such modifications are typically incorporated into oligonucleotides, and these oligonucleotides have been shown to have higher Tm (i.e., higher target binding affinity) than 2'-deoxy oligonucleotides for a given target.
[0052] Many nucleotide and nucleoside modifications have been shown to render the incorporated oligonucleotides more resistant to nuclease digestion than native oligodeoxynucleotides; these modified oligonucleotides can survive longer than unmodified oligonucleotides. Specific examples of modified oligonucleotides include oligonucleotides containing modified backbones such as phosphorothioate, phosphotriester, methylphosphonate, short-chain alkyl or cycloalkyl sugar linkages, or short-chain heteroatom or heterocyclic sugar linkages. Most preferred are oligonucleotides having phosphorothioate backbones and oligonucleotides having heteroatom backbones, particularly CH2-NH-O-CH2, CH1-N(CH3)-O-CH2 (referred to as methylene(methylimino) or MMI backbones], CH2--O--N(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2 and ON(CH3)-CH2-CH2 backbones, where the natural phosphodiester backbone is represented as OP--O-CH1); amide backbones (see DeMesmaeker et al. Ace. Chem. Res. 1995, 28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Patent No. 5,034,506); peptide nucleic acid (PNA) backbones (in which the phosphodiester backbone of the oligonucleotide is replaced by a polyamide backbone to which the nucleotides are directly or indirectly bound, see Nielsen et al., Science 1991, 254, 1497).Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl esters (including 3'alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (including 3'-aminophosphoramidate and aminoalkylphosphoramidate), thiophosphoramidates, thioalkylphosphonates, thioalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, 2'-5' linkage analogs of these esters, and those with inverted polarity where adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see U.S. Pat. Nos. 3,687,808, 4,469,863, 4,476,301, 5, No. 023,243, No. 5,177,196, No. 5,188,897, No. 5,264,423, No. 5,276,019, No. 5,278,302, No. 5,286,717, No. 5,321,131, No. 5,399,676, No. 5,405,939, No. 5,453,496, No. No. 5,455,233, No. 5,466,677, No. 5,476,925, No. 5,519,126, No. 5,536,821, No. 5,541,306, No. 5,550,111, No. 5,563,253, No. 5,571,799, No. 5,587,361 and No. 5,625,050.
[0053] Morpholino-based oligomeric compounds are described in the following literature: Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, Vol. 30, No. 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Patent No. 5,034,506, issued July 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are herein incorporated by reference in their entireties).
[0054] Pharmaceutical compositions and methods of administration
[0055] The methods described herein may include administering pharmaceutical compositions and formulations comprising ITGB8 inhibitors and / or oligonucleotides designed to target ITGB8.
[0056] In some embodiments, the composition is formulated with a pharmaceutically acceptable carrier. Pharmaceutical compositions and preparations can be administered parenterally, topically, orally or by topical application (such as by aerosol) or transdermally. Pharmaceutical compositions can be formulated in any manner and can be administered in a variety of unit dosage forms, depending on the illness or disease and degree of illness, the general medical condition of each patient, the preferred method of administration, etc. Detailed information on drug formulation and administration techniques is described in detail in science and patent literature, for example, in Remington: The Science and Practice of Pharmacy (21st edition, 2005).
[0057] The oligonucleotides can be administered alone or as a component of a pharmaceutical formulation (composition). The compound can be formulated for administration in any convenient manner for human or veterinary use. Wetting agents, emulsifiers, and lubricants (such as sodium lauryl sulfate and magnesium stearate) as well as colorants, release agents, coating agents, sweeteners, flavorings and fragrances, preservatives, and antioxidants may also be present in the composition.
[0058] The formulations of the compositions described herein include formulations suitable for intradermal, inhalation, oral / nasal, topical, parenteral, rectal and / or intravaginal administration. The formulations can be conveniently present in unit dosage form and can be prepared by any method known in the pharmaceutical field. The amount of the active ingredient (e.g., nucleic acid sequence of the present invention) that can be combined with a carrier material to produce a single dosage form will vary depending on the host being treated, the specific mode of administration (e.g., intradermal or inhalation). The amount of the active ingredient that can be combined with a carrier material to produce a single dosage form is typically the amount of the compound that produces a therapeutic effect (e.g., antigen-specific T cells or humoral response).
[0059] The pharmaceutical preparations of the present invention can be prepared according to any method known in the art for producing drugs. Such drugs may contain sweeteners, flavorings, colorants and preservatives. The preparations can be mixed with pharmaceutically acceptable non-toxic excipients suitable for manufacture. The preparations may contain one or more diluents, emulsifiers, preservatives, buffers, excipients, etc., and can be provided in forms such as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, patches, implants, etc.
[0060] Pharmaceutical preparations for oral administration can be formulated with appropriate and suitable dosages using pharmaceutically acceptable carriers well known in the art. Such carriers can prepare drugs in unit dosage forms suitable for patient intake, such as tablets, pills, powders, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc. The pharmaceutical preparations for oral use can be formulated into solid excipients, the resulting mixture is optionally ground, and the granular mixture is processed after adding suitable additional compounds (if necessary) to obtain tablets or lozenge cores. Suitable solid excipients are carbohydrates or protein fillers, including, for example, sugars, including lactose, sucrose, mannitol or sorbitol; starch from corn, wheat, rice, potato or other plants; cellulose, such as methylcellulose, hydroxypropyl methylcellulose or sodium carboxymethylcellulose; and gums, including gum arabic and tragacanth; and proteins, such as gelatin and collagen. Disintegrants or solubilizers such as cross-linked polyvinyl pyrrolidone, agar, alginic acid or its salts, such as sodium alginate, can be added. Push-fit capsules may contain the active agent mixed with fillers or binders (such as lactose or starches), lubricants (such as talc or magnesium stearate), and optionally stabilizers. In soft capsules, the active agent may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol (with or without stabilizers).
[0061] Aqueous suspensions can contain the active agent (e.g., an inhibitory nucleic acid sequence described herein) in a mixture with excipients suitable for making aqueous suspensions (e.g., for aqueous intradermal injection). Such excipients include suspending agents (such as sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth, and gum arabic), and dispersants or wetting agents (such as naturally occurring phospholipids (e.g., lecithin)), condensation products of alkylene oxides with fatty acids (e.g., polyoxyethylene stearate), condensation products of alkylene oxide with long-chain aliphatic alcohols (e.g., heptadecaethyleneoxycetanol); condensation products of alkylene oxide with partial esters derived from fatty acids and hexitols (e.g., polyoxyethylene sorbitan monooleate), or condensation products of alkylene oxide with partial esters derived from fatty acids and hexitols (e.g., polyoxyethylene sorbitan monooleate). Aqueous suspensions may also contain one or more preservatives (such as ethyl or n-propyl p-hydroxybenzoate), one or more coloring agents, one or more flavoring agents, and one or more sweetening agents (such as sucrose, aspartame, or saccharin). The osmolarity of the formulation may be adjusted.
[0062] In some embodiments, oil-based medicines are used to administer inhibitory nucleic acid sequences as described herein. Oil-based suspensions can be prepared by suspending the active ingredient in a vegetable oil (such as peanut oil, olive oil, sesame oil, or coconut oil) or a mineral oil (such as liquid paraffin) or a mixture of these oils. See, for example, U.S. Patent No. 5,716,928, which describes the use of essential oils or essential oil components to improve bioavailability and reduce inter- and intra-individual variability (see also U.S. Patent No. 5,858,401) of administering hydrophobic drug compounds. Oily suspensions can contain thickeners, such as beeswax, hard paraffin, or cetyl alcohol. Sweeteners can be added to provide a palatable oral formulation, such as glycerol, sorbitol, or sucrose. These preparations can be preserved by adding antioxidants such as ascorbic acid. Examples of injectable oil vehicles are shown in Minto (1997) J. Pharmacol. Exp. Ther. 281:93-102.
[0063] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oil phase can be a vegetable oil or mineral oil as described above, or a mixture of these oils. Suitable emulsifiers include naturally occurring gums such as gum arabic and gum tragacanth; naturally occurring phospholipids such as soy lecithin; esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan monooleate; and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. As in the formulation of syrups and elixirs, the emulsion may also contain sweeteners and flavorings. The formulation may also contain a demulcent, a preservative, or a colorant. In some embodiments, these injectable oil-in-water emulsions contain paraffin oil, sorbitan monooleate, ethoxylated sorbitan monooleate, and / or ethoxylated sorbitan trioleate.
[0064] The pharmaceutical compounds can also be administered by intranasal routes, including insufflation, powders, and aerosol formulations (for examples of steroid inhalers, see, e.g., Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111).
[0065] In some embodiments, the drug compound can also be delivered in the form of microspheres for slow release in vivo. For example, the microspheres can be administered via intradermal injection for slow release of the drug subcutaneously; see Rao (1995) J. Biomater Sci. Polym. 7th ed.: 623-645; as a biodegradable and injectable gel formulation, see, for example, Gao (1995) Pharm. Res. 12: 857-863 (1995); or as microspheres for oral administration, see, for example, Eyles (1997) J. Pharm. Pharmacol. 49: 669-674.
[0066] In some embodiments, the pharmaceutical compound can be administered parenterally, such as by intravenous (IV) administration or intrathecal administration. These preparations can include a solution of the active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be used are water and Ringer's solution (isotonic sodium chloride). In addition, sterile fixed oils can be used as solvents or suspension media. For this purpose, any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. In addition, fatty acids (such as oleic acid) can also be used in the preparation of injectables. These solutions are sterile and generally do not contain undesirable substances. These preparations can be sterilized by conventional, well-known sterilization techniques. The preparations can contain pharmaceutically acceptable auxiliary substances required to approach physiological conditions, such as pH regulators and buffers, toxicity regulators, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The concentration of the active agent in these preparations can vary widely and will be selected based on the specific mode of administration selected and the patient's needs, mainly based on fluid volume, viscosity, body weight, etc. For IV administration, the preparation can be a sterile injectable preparation, such as a sterile injectable aqueous or oily suspension. Suitable dispersants or wetting agents and suspending agents can be used to prepare such suspensions. The sterile injectable preparation can also be a suspension in a non-toxic parenterally acceptable diluent or solvent, such as a solution of 1,3-butanediol. Administration can be by bolus or continuous infusion (e.g., introduction into a blood vessel substantially uninterrupted over a specified period of time).
[0067] In some embodiments, the pharmaceutical compound and preparation can be lyophilized. The stable lyophilized preparation comprising oligonucleotide can be prepared by lyophilizing a solution comprising medicine described herein and a filler (e.g., mannitol, trehalose, raffinose and sucrose or a mixture thereof). The process for preparing the stable lyophilized preparation can include lyophilizing about 2.5 mg / mL protein, about 15 mg / mL sucrose, about 19 mg / mL NaCl and a solution of sodium citrate buffer solution greater than 5.5 but less than 6.5 for pH. See, for example, US 20040028670.
[0068] Compositions and formulations can be delivered using liposomes. By using liposomes, particularly when ligands specific to target cells are carried on the surface of the liposomes or otherwise targeted to specific organs, one can concentrate the delivery of active agents to target cells in vivo. See, for example, U.S. Patents Nos. 6,063,400 and 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46:1576-1587. As used herein, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in one or more bilayers. Liposomes are unilamellar or multilamellar vesicles having a membrane formed by a lipophilic substance and an aqueous interior containing the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form stable complexes. pH-sensitive or negatively charged liposomes are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
[0069] Liposomes can also include "sterically stabilized" liposomes, i.e., liposomes that contain one or more specialized lipids. When these specialized lipids are incorporated into liposomes, the resulting liposomes have an increased circulation life compared to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are liposomes in which a portion of the vesicle-forming lipid portion of the liposome contains one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Liposomes and their uses are further described in U.S. Patent No. 6,287,860.
[0070] The formulations described herein can be administered for prophylactic and / or therapeutic treatment. In some embodiments, for therapeutic applications, the composition is administered to a subject at risk of or suffering from a disorder described herein in an amount sufficient to cure, alleviate, or partially arrest the clinical manifestations of the disorder or its complications; this can be referred to as a therapeutically effective amount.
[0071] The amount of the pharmaceutical composition sufficient to achieve this purpose is a therapeutically effective dose. The dosage schedule and amount effective for this use, i.e., the administration regimen, will depend on a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the patient's general health, the patient's physical condition, age, etc. When calculating the dosage regimen for a patient, the mode of administration should also be taken into account.
[0072] Dosage regimens also take into account pharmacokinetic parameters well known in the art, i.e., absorption rate, bioavailability, metabolism, clearance rate, etc. of the active agent (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51:337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24:103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art enables the clinician to determine a dosage regimen for each individual patient, active pharmaceutical ingredient, and disease or condition being treated. The guidelines provided for similar compositions used as pharmaceuticals can be used as a guide to determine the dosage regimen, i.e., dosage schedule and dosage level, that is correct and appropriate for practicing the methods described herein.
[0073] Single or multiple administrations of the formulation may be given, depending on, for example, the dosage and frequency required and tolerated by the patient, the extent and amount of therapeutic effect produced after each administration (e.g., effect on tumor size or growth), etc. The formulation should provide sufficient active agent to effectively treat, prevent or ameliorate the disorder, disease or symptom.
[0074] In some embodiments, the methods described herein may include co-administration with other drugs or pharmaceuticals. For example, an inhibitor of ITGB8 may be co-administered with a drug used to treat or reduce the risk of a condition described herein.
[0075] Example
[0076] The present invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0077] Materials and methods
[0078] The following materials and methods were used in the following examples.
[0079] Human brain tissue and neuropathology
[0080] Frozen brain tissue blocks from the apical region of the brain for RNA sequencing and chromatin immunoprecipitation DNA sequencing (ChIPseq) were obtained from the Netherlands Brain Bank (NBB). The donors provided informed consent to donate their brains to NBB. The postmortem interval was limited to 10 hours to ensure tissue quality. Paraffin brain tissue sections were obtained from NBB and the Alzheimer's Disease Resource Center (ADRC) in Massachusetts, USA. This study was approved by the Ethics Committee of Brigham and Women's Hospital, University of California, San Francisco, USA, and conformed to the World Medical Association's Declaration of Helsinki on the Ethical Principles of Medical Research Involving Human Subjects. Tissue selection and neuropathological staging of the brains were performed by NBB and the ADRC.
[0081] mice
[0082] B6.129P2(Cg)-Cx3cr1 tm2.1(cre / ERT2)Litt / WganJ mice (Cx3cr1-Cre ERT2 , stock number 021160) 26 、C57BL / 6-Tmem119 em1(cre / ERT2)Gfng / J (Tmem119-CRE ERT2 , stock number 031820) 76 、B6.129S6-Inpp5d tm1Wgk / J mice (Inpp5d flox , stock number 028255) 77 、Smad2 tm1.1Epb / J mice (Smad2 flox , stock number 022074) 78 and Smad3 tm1Zuk Mouse (Smad3 flox , MGI: 3822465) 79 All were purchased from Jackson Laboratory. ERT2 Mice were compared with human APOE knock-in mice, APOE3 fl / fl and APOE4 fl / fl Mouse hybrids 18 These transgenic mice were then crossed with APP / PS1 34 or P301S 32 Mice were triple-crossed. B6.Cg-Tg(Thy1-APPSw,Thy1-PSEN1*L166P)21Jckr (APP / PS1) 34Mice were kindly provided by Dr. Mathias Jucker (University of Tübingen). B6;C3-Tg(Prnp-MAPT*P301S)PS19Vle / J (P301S, stock number 008169) 32 The mice have been backcrossed with C57BL / 6 mice for more than ten generations. tm2(APOE*3)Mae N8 (MGI #4838571) 80 and B6.129P2-Apoe tm3(APOE*4)Mae N8 (MGI # 4838572) 81 Obtained from Taconic. Spi1 fl / fl mice 82 Generously provided by Daniel Tenen and Junyan Zhang of Beth Israel Deaconess Medical Center. fl / fl mice 83 Itgb8-tdT mice were kindly provided by Dr. Thomas Arnold of the University of California, San Francisco. Itgb8-tdT mice were provided by Dr. Helen Paidassi of the Université Claude Bernard Lyon 1. 84 Provided. Cx3cr1-CRE ERT2 Mice and Inpp5d fl / fl Mice were crossed on WT and APP / PS1 backgrounds. Cx3cr1-CRE (stock Tg(Cx3cr1-cre)MW126Gsat / Mmucd, MMRRC_036395-UCD) mice were used. 85, 86 was obtained from the Mouse Resource and Research Center (MMRRC) at the University of California, Davis, and was cross-linked with Smad2 flox and Smad3 flox All experimental procedures using animals were approved by the Institutional Animal Care and Use Committee of Brigham and Women's Hospital, Harvard Medical School.
[0083] Tamoxifen treatment
[0084] At six weeks of age, mice were injected intraperitoneally (ip) with 75 mg / kg tamoxifen (Sigma Aldrich, T5648-5G) dissolved in corn oil daily for five consecutive days.
[0085] Microglial cell isolation
[0086] Mice were euthanized in a CO2 chamber and perfused intracardially with ice-cold Hanks' balanced salt solution (HBSS, Thermo Fisher, 14175103). The entire brain was removed from the skull and divided into sections with sagittal brain matrix for further processing. The left hemisphere was used for sorting, and the right hemisphere was used for immunohistochemistry. The left hemisphere was homogenized to form a single cell suspension, which was then resuspended and centrifuged at 800 g for 25 minutes in HBSS at 23°C with a 37% / 70% Percoll Plus (GE Healthcare, 17-5445-02) gradient, with an acceleration of 3 and a deceleration of 1. Mononuclear cells were removed from the interface layer. Anti-mouse Fcrls (1:1000, clone 4G11, Butovsky Lab) coupled to rat APC was used. 21 The cells were stained with PE-Cy7-conjugated anti-mouse CD11b (1:300, eBioscience, 50-154-54) and PerCP / Cy5.5-conjugated anti-mouse Ly-6C (1:300, Biolegend, 128012). After staining, Ly-6C was washed and sorted using a BD FACSAria™ II (BD Bioscience). – CD11b + Fcrls + Cells. Analysis was performed using FlowJo™ 10. For mice stereotaxically injected with apoptotic neurons (AN), a 3 × 6 mm area around the injection site was imaged. 2 Coronal sections were cut. Microglia were enriched using the same method as above. Apoptotic neurons were labeled with Alexa Flour™ 405 dye. During the sorting process, phagocytic microglia (AN-Alexa Fluor 405) were collected as described previously. + Ly-6C – CD11b + Fcrls + ) and non-phagocytic microglia (AN-Alexa Fluor 405 – Ly-6C – CD11b + Fcrls + ) 6 .
[0087] Primary neuronal cultures
[0088] Primary neurons were obtained from embryonic day 18 (E18) mouse embryos. The cerebral hemispheres were isolated. The meninges were then removed from the hemispheres under a dissecting microscope. The hemispheres were digested in 10 U / mL papain solution at 37°C for 15 minutes and then triturated using a fire-polished glass pipette in 19 mL of Neurobasal medium (Gibco, 21103-049), 133 μL of BSA (Sigma, A-9576), 0.5 mL of penicillin / strep / glucose / pyruvate, and 200 μL of DNase (Sigma, D-5025) until a single-cell suspension was achieved. The suspension was filtered through a 40 μm cell strainer, spun at 400 g for 5 minutes, and resuspended in 1 mL of HBSS. Cells were counted using trypan blue stain (Gibco™, 15-250-061) and a cell counter (Nexcelom). Cells were seeded onto 6-well poly-D-lysine-coated plates at a density of approximately 1 million cells per well in a minimum volume of 2 mL of growth medium consisting of Neurobasal medium, 1:50 B-27 supplement (Gibco 17504-044), 1:200 penicillin / streptomycin (Gibco, 15140-122), 1:400 glutamine (Gibco, 35050-061), and 1:50 fetal bovine serum (FBS, Gibco, 10-438-026). After incubation at 37°C for 24 hours, cell viability and contamination were examined microscopically. Half of the growth medium was replaced with fresh growth medium containing 5 μM Ara-C (Sigma-Aldrich, C1768-100MG) and lacking FBS. Five days later, half of the medium was removed and replaced with fresh growth medium lacking FBS.
[0089] Induction of apoptotic neurons
[0090] Primary neurons (d7-d10) are usually cultured one week after the start of culture. Neurons are removed from the surface of the plate by washing with PBS multiple times. The neurons are then incubated for 20 minutes under ultraviolet light (302 nm) at an intensity of 6315 W to induce cell apoptosis. After this step, the neurons are kept on ice. The cells are collected, spun by centrifugation, and resuspended in 1 mL PBS. Next, they are stained with a labeled dye (Alexa Fluor™ 405 NHS Ester, Invitrogen, A3000) at 37°C in the dark for 15 minutes. The neurons are then washed, spun, and resuspended. The number of apoptotic cells is determined using trypan blue staining and a cell counter. The neurons are resuspended at a density of 25,000 dead cells per microliter of PBS.
[0091] RT-qPCR
[0092] According to the manufacturer's protocol, RNeasy Plus Micro Kit (Qiagen, 74034) was used to extract total RNA from mouse tissue. According to the manufacturer's protocol, mirVana miRNA isolation kit (Invitrogen, AM1560) was used to extract total RNA from human tissue. For quantitative reverse transcription polymerase chain reaction (RT-qPCR), RNA (high capacity cDNA reverse transcription kit; Applied Biosystems, 436884) was used after reverse transcription reaction. Total mRNA amplification was performed using the Taqman probes of commercially available FAM-labeled people APOE (Thermo Fisher Scientific, Hs00171168_m1) and mouse Gapdh (ThermoFisher Scientific, Mm9999915_g1). Real-time PCR reactions were performed using QuantStudio™ 7 (Applied Biosystems). All RT-qPCRs were repeated twice, and mRNA levels were expressed as the relative expression normalized to Gadpdh, which was mean ± SEM.
[0093] Stereotaxic injection
[0094] Mice were anesthetized by intraperitoneal injection of ketamine (100 mg / kg) and xylazine (10 mg / kg). To induce the MGnD paradigm, 2 μl of the apoptotic neuron mixture was injected bilaterally into the hippocampus (ML: ±1.5 mm, AP: -2 mm, DV: -2 mm) and cortex (ML: ±1.5 mm, AP: -2 mm, DV: -1 mm) using a stereotaxic injection apparatus. Animals were processed 16 hours after injection. To knock out PU.1 in microglia, TAT-Cre (MilliporeSigma, SCR508) was stereotaxically injected into PU.1 cells of 6- to 8-week-old mice. flox / floxThe MGnD paradigm was induced by intracerebroventricular (ICV) injection of TAT-Cre into the cerebral ventricle of mice (ML: ±1 mm, AP: -1 mm, DV: -2.5 mm; 2 μl per injection site, 10 μg / μl, 40 μg per brain). Five days after intracerebroventricular (ICV) injection of TAT-Cre, Alexa Flour™ 405 dye-labeled apoptotic neurons (premixed with TAT-Cre) were injected into the cortex and hippocampus as described above. Phagocytic and non-phagocytic microglia were sorted from the brain region narrowing down to the injection site, followed by SmartSeq2 analysis. To investigate the role of PU.1, PU.1 inhibitors (DB1876, MCE, HY-135797A) were used to inhibit PU.1. The PU.1 inhibitor was dissolved in 10% DMSO (Invitrogen, D12345) according to the manufacturer's instructions to a concentration of 2.08 mg / ml (4 mM). A 10% DMSO control was used. As described above, PU.1 inhibitors or controls were injected into the cortex and hippocampus. Seven days later, microglia and astrocytes were isolated from a brain region restricted to the injection site and then subjected to IHC and Smart-seq2 analysis. To investigate the role of MGnD in regulating astroglial responses in mice carrying different APOE alleles, apoptotic neurons were injected into the cortex and hippocampus of APOE3-KI, APOE4-KI, and APOE4-cKO mice to induce the MGnD paradigm as described above. 16 hours later, phagocytic microglia were sorted from the brain and then injected into the hippocampus and hippocampus of WT mice (ML: ±1.5 mm, AP: -2 mm, DV: -1 and -2 mm; 2 μl per injection site), with 3,000 microglia per injection site. 16 hours later, astrocytes were isolated from a brain region restricted to the injection site and then subjected to Smart-seq2 analysis. To investigate the role of Itgb8, an anti-ITGB8 antibody (ADWA11) was used to block mouse Itgb8. Mouse IgG1 was used as an isotype control (BioXCell, catalog number BP0083). Both ADWA11 and IgG1 were diluted to 0.5 μg / μl in sterile PBS. Anti-ITGB8 antibody or isotype control was injected into the cortex and hippocampus (ML: ±1.5 mm, AP: -2 mm, DV: -1 and -2 mm; 2 μl per injection site). 14 days later, microglia were isolated from brain regions restricted to the injection site and then subjected to IHC and Smart-seq2 analysis. Fluorescently labeled amyloid-β peptide (1-42) (Anaspec, AS-60480-01) was reconstituted with NH4OH and then diluted to 1 μg / μL in sterile PBS.Ab was injected into the cortex and hippocampus (ML: ±1.5 mm, AP: -2 mm, DV: -1 and -2 mm; 2 μl per injection site). Six hours later, phagocytic and non-phagocytic microglia were isolated from the brain region restricted to the injection site and subjected to FACS analysis.
[0095] scRNA sequencing
[0096] As previously described 87Brain tissue was isolated from mice after perfusion. Briefly, tissue was minced and incubated in 10 mL of enzyme digestion solution, consisting of 75 μL of papain suspension (Worthington, LS003126) diluted in enzyme stock solution (ESS) and equilibrated to 37°C. ESS medium (200 mL) contained 20 mL of 10× EBSS (Sigma-Aldrich, E7510), 2.4 mL of 30% D(+)-glucose (Sigma-Aldrich, G8769), 5.2 mL of 1M NaHCO₃ (VWR, AAJ62495-AP), 200 μL of 500 mM EDTA (Thermo Fisher Scientific, 15575020), and 168.2 mL of ddH₂O, sterilized by filtration through a 0.22 μm filter. Samples were shaken at 80 rpm at 37°C for 40 minutes. Enzymatic digestion was terminated with 1 mL of 10× hi-ovomucoid inhibitor solution and 20 μL of 0.4% DNase (Worthington, LS002007), diluted in 10 mL of inhibitor stock solution (ISS). 10 mL of 10× hi-ovomucoid inhibitor stock solution contains 300 mg of BSA (Sigma-Aldrich, A8806) and 300 mg of ovomucoid trypsin inhibitor (Worthington, LS003086) diluted in 10 mL of 1× PBS and sterilized by filtration using a 0.22 μm filter. ISS medium contains 50 mL 10× EBSS (Sigma-Aldrich, E7510), 6 mL 30% D(+)-glucose (Sigma-Aldrich, G8769), and 13 mL 1M NaHCO₃ (VWR, AAJ62495-AP), diluted in 170.4 mL ddH₂O and sterilized by filtration through a 0.22 μm filter. Tissue was mechanically dissociated using a 5 mL serological pipette and filtered through a 70 μm cell strainer (Thermo Fisher Scientific, 22363548) into a fresh 50 mL conical tube. The tissue was centrifuged at 500 g for 5 minutes and resuspended in 10 mL 30% Percoll solution (2.7 mL Percoll Plus (GE Healthcare Biosciences, 17-5445-01), 1 mL 10× PBS, and 6.3 mL ddH₂O). The samples were centrifuged at 800 g, 23°C for 25 min, with an acceleration of 4 and a deceleration of 3.Samples were loaded onto the 10X Genomics Chromium platform for GEM and cDNA generation, which carries cell- and transcript-specific barcodes and sequencing libraries constructed using the Chromium SingleCell 3′ Library & Gel Bead Kit v3. Libraries were sequenced on Illumina. A NovaSeq S1 was used with a target depth of 100,000 reads per cell. Gene counts were obtained by aligning reads to the mm10 genome (refdata-gex-GCRm38-2020-A) using CellRanger software (v.4.0.0) (10x Genomics). Seurat (v.4.0.6) (satijalab.org / Seurat / index.html) was used. 88Single-cell clustering and differential expression analysis were performed. Cells with more than 200 sequencing reads and less than 20% mitochondrial transcripts were selected, and genes with more than two reads in all samples were entered into downstream analysis. Expression counts were normalized by the "LogNormalize" method, and mitochondrial read counts were scaled using linear regression implemented in Seurat's "Regress Out" function. Variable genes were identified using the "vst" selection method. The data were then centralized and scaled, analyzed by principal component analysis (PCA), and its dimensionality was reduced to the first 30 principal components. Cells were clustered in PCA space using gene expression data as implemented by the FindNeighbors and FindClusters commands in Seurat-v4. The method returned 27 cell clusters, which were then visualized on a UMAP created from the first 30 principal components. Differentially expressed genes in each cluster were output by FindAllMarkers. Clusters were identified based on key signature genes specific to cell types. All 26 clusters were reliably assigned, with one cluster showing no reliable cell type signature. For identified astrocytes (clusters 3 and 5), the FindMarkers function was used to identify differentially expressed genes in the comparison between clusters 3 and 5. A donut plot of astrocytes was created using the following cutoffs: Gfap > 2, Apoe > 3, Vim > 1, Serpin a3n > 0.9, and Cd9 > 0.9. For identified microglia (clusters 1, 4, 9, and 26), cells were re-clustered to extract any missing variation from the original clusters of all cells. The data was pooled and scaled, analyzed using principal component analysis (PCA), and its dimensionality reduced to the first 26 principal components. This method returned 11 cell clusters, which were then visualized on a UMAP created from the first 26 principal components. The FindMarkers function was used to identify differentially expressed genes in the comparison between homeostatic and MGnD samples using cell type-specific key signature genes. Gene expression was visualized using the FeaturePlot, DittoHeatmap, and VlnPlot functions of Seurat-v4. Downloaded from AD Knowledge Portal Zhou et al. 49 and Olah et al. 48 The processed data were processed using the workflow described above with some adjustments. 49 For example, cells with 5% or more mitochondria were removed. 89 Annotate cell types. For Olah et al., select only cells with less than 10% mitochondrial transcripts. (See "Code availability" for detailed steps).
[0097] Bulk RNA sequencing
[0098] Smart-Seq2 libraries were prepared by Broad Technology Labs and sequenced by the Broad Genomics Platform using the Smart-seq2 protocol. 90 cDNA libraries were generated from sorted cells. RNA sequencing was performed using the Illumina NextSeq500 and High Output v2 kit to generate 2 × 25 bp reads. Count files (fastq) were downloaded and aligned to the mm10 genome using Salmon (v1.7), and sequencing quality was checked using Multiqc (v1.11). Potential technical outliers were removed for further analysis. All analyses were performed using DESeq2 (v.1.34.00). 91 Biological outliers were identified using PCA plots and heatmap visualizations and removed for final analysis. Low-abundance genes with less than 5 reads per sample were filtered out. Comparisons were made using LRT, and the cutoff for significant genes was P < 0.01 or P < 0.05. Heatmaps were visualized using the pheatmap package (v.1.0.12), volcano plots were generated using the EnhancedVolcano package (v1.12.0), and violin plots were generated using the geom_violin function in the ggplot2 package (v3.3.5) (see "Code Availability" for detailed steps).
[0099] Astrocyte sorting
[0100] Astrocytes were isolated using enzymatic digestion after perfusion as described in the Mouse Brain Cell Isolation for scRNA-Seq protocol. Cells were stained on ice in the dark for 30 minutes. The following antibodies were used for negative selection: PE anti-CD45R / B220 (BD, 553089, 1:100), PE anti-Ter119 (Biolegend, 116207, 1:100), PE anti-Olig4 (R&D Systems, FAB1326P, 1:100), PE anti-CD105 (eBioscience, 12-1051-82, 1:100), PE anti-CD140a (eBioscience, 12-1401-81, 1:100), PE anti-Ly6G (Biolegend, 127608, 1:100), PE-Cy7 anti-CD11b (eBioscience, 50-154-54, 1:300), BV421™ anti-CD45 (Biolegend, 103133, 1:100) and Alexa Fluor® Sorted astrocytes were positively selected using 700 anti-O1 (R&D Systems, FAB1327N, 1:100). APC anti-ACSA2 (Miltenyi Biotec, 130-117-535, 1:100) was used.
[0101] Comparison across datasets
[0102] We will Lund et al. 75 The bulk RNA sequencing data from the study were cross-compared with the Itgb8-KO data from our WT mice. DEGs (P < 0.05, Log2 fold change (FC) > (0.25)) were selected from both studies and plotted on a scatter plot. MGnD-related genes were reported by Kraseman et al., 2017. 6 Use geom_smooth() to calculate the linear regression of the MGnD gene and the M0 gene (see "Code Availability" for detailed steps).
[0103] Originality pathway analysis
[0104] Pathway analysis was performed using Gene Ontology (GO) enrichment analysis (geneontology.org). Differentially expressed genes were used to detect pathways associated with biological processes. Differentially expressed genes were combined with corresponding fold changes and adjusted p-values for gene set enrichment analysis (GSEA, gsea-msigdb.org / gsea / index.jsp). 92, 93 and Ingenuity Pathway Analysis (IPA, digitalinsights.qiagen.com / products-overview / discovery-insights-portfolio / analysis-and-visualization / qiagen-ipa / ). In IPA, canonical pathways and biological functions were tested to generate biological networks, as previously described. 21 .
[0105] Nuclei isolation
[0106] According to the previously developed method 96 Brain nuclei were isolated from frozen human brains with minor modifications. Briefly, approximately 100 mg of brain tissue was dissected on dry ice and immediately homogenized in 10 ml of 1% formaldehyde. The homogenate was fixed with shaking for exactly 10 minutes and then quenched by adding glycine to a final concentration of 0.125 M. The cells were then washed with NF1 buffer. 96The fixed brain homogenate was washed twice and lysed on ice for 60 minutes. After further dissociation using a Dounce homogenizer and filtration through a 70 μm cell strainer, the nuclei were placed on a sucrose cushion and centrifuged to remove myelin. The nuclear pellet was then washed twice with FACS buffer (HBSS containing 0.2% BSA) and snap-frozen for future use.
[0107] Anti-H3K9ac ChIP-seq
[0108] Anti-H3K9ac ChIP analysis was performed using the iDeal ChIP-seq Kit for Histones (diagenode, C01010059) according to the manufacturer's instructions with minor modifications. Ultrasonication was performed for 20 cycles (30 seconds on, 30 seconds off) at a high A power setting. Two ml of anti-H3K9ac antibody (Millipore, 07-352) was added to each IP reaction. DNA libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB, E7103S) according to the manufacturer's instructions. DNA libraries were analyzed using the Qubit 4 Fluorometer (Invitrogen, Q33238) and the 2100 Bioanalyzer DNA System (Agilent). Pooled libraries were sent to Genewiz, Inc. and sequenced at 2 × 150 bp on an Illumina HiSeq platform.
[0109] ChIP-seq data analysis
[0110] The quality of the original fastq files was first checked using Multiqc sequence analysis. The adapters were cut using Cutadapt (v.4.0) (-a AGATCGGAAGAGCACACGTCTGAACTCCAGTC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT) and then analyzed using bowtie2 (2.3.4.3). 97 The reads were aligned to the mouse genome (mm10). Subsequently, Sambamba (v.0.8.2) was used. 98 SAM files were sorted and filtered. We discarded unmapped and duplicate fragments. samtools (v.1.15.1) was used. 99 The sorted BAM files were indexed. Then deeptools (v.3.5.0) was used to 100BAM files were converted to BigWig files for visualization. All BigWig files were normalized to the effective genome size (2652783500 for mouse H3K9ac ChIP-seq). The data were analyzed using Macs2 (v. 2.2.7) using stringent parameters (-f BAMPE --mfold 550 -p 0.001). 101 Peak analysis was performed. A master peak file was created and used to extract counts from the BAM files. For mouse H3K9ac, microglia isolated from three mice were pooled for ChIP. The peak stack threshold for both samples was set to > 10, and the fold change cutoff was set to > 2 or < 0.5 to identify significantly different peaks (see "Code Availability" for details). Peaks were visualized using IGV (v.2.11.4), exported as .png, and edited in Adobe Illustrator.
[0111] Lipidomics
[0112] Polar and nonpolar lipids were analyzed using a liquid chromatography / mass spectrometry (LC-MS) system consisting of a Shimadzu Nexera X2U-HPLC (Shimadzu Corp.) coupled to an Exactive™ Plus orbitrap mass spectrometer (Thermo Fisher Scientific). 30K sorted microglia were prepared in 50 µl of isopropanol. After centrifugation, 10 µl of the supernatant was directly injected onto a 100 × 2.1 mm, 1.7 µm ACQUITY BEH C8 column (Waters). The column was isocratically eluted with 80% mobile phase A (95:5:0.1 vol / vol / vol 10 mM ammonium acetate / methanol / formic acid) for 1 minute, followed by a linear gradient to 80% mobile phase B (99.9:0.1 vol / vol methanol / formic acid) over 2 minutes, followed by a linear gradient to 100% mobile phase B over 7 minutes, and then eluted at 100% mobile phase B for 3 minutes. Mass spectrometry (MS) analysis was performed using electrospray ionization in positive ion mode, using full scan analysis from 200–1100 m / z, a resolution of 70,000, and a data acquisition rate of 3 Hz. Other MS settings were: sheath gas 50, source CID 5 eV, makeup gas 5, spray voltage 3 kV, capillary temperature 300°C, S-lens RF 60, heater temperature 300°C, microscan 1, automatic gain control target 1e6, and maximum ion time 100 ms. Raw data were processed using TraceFinder software (Thermo Fisher Scientific) for targeted peak integration and manual review of a subset of identified lipids, and Progenesis QI (NonlinearDynamics) was used for peak detection and integration of known and unknown lipids. Lipid identity was determined based on comparison with reference extracts and expressed as the total number of carbons in one or more lipid acyl chains and the total number of double bonds in one or more lipid acyl chains. All analyses were performed using R (v.4.1.1). The total number of metabolites was reduced from 199 to 170 by removing metabolites with missing data in one or more samples. The data were normalized using the z-score method. Heat maps of the 170 metabolites were plotted using the pheatmap package (v.1.0.12).
[0113] Immunohistochemistry
[0114] Mice were perfused intracardially with cold HBSS prior to tissue removal and fixation. Tissue that was not adequately perfused was not analyzed further to eliminate autofluorescence associated with blood contamination. Two different tissue preparation protocols (paraffin-embedded human brain tissue or microtome free-floating sections) were used as previously described. 33Briefly, sections were blocked in PBS containing 20% horse serum (Thermo Fisher Scientific, NC9909742) and 0.3% Triton X-100 (Sigma) for 1 hour at room temperature. Primary antibodies were incubated in PBS containing 2% horse serum and 0.3% Triton X-100 at 4°C overnight. The following primary antibodies were mouse anti-Aβ (1:300, BioLegend, 803001), chicken anti-GFAP (1:400, Abcam, 4674), mouse anti-phospho-Tau (1:50, Thermo Fisher Scientific, AT-100, MN1060), goat anti-Iba1 (1:100, Abcam 5076), rabbit anti-Iba1 (1:200, Wako, 019-19741), mouse anti-HJ3.4B ... mouse anti-Iba1 (1:100, Abcam 5076), mouse anti-Iba1 (1:200, Wako, 019-19741), mouse anti-HJ3.4B (1:50, Thermo Fisher Scientific, AT-100, MN106 102(1:600, Holtzman Lab), rat anti-LAMP1 (1:100, DSHB, 1D4B), rat anti-Dectin1 (1:100, Invivogen, clone: R1-8g7), rabbit anti-APOE (1:400, Cell Signaling Technology, 13366S), rabbit anti-pSmad3 (1:100, Abcam, ab52903), guinea pig anti-Plin2 (1:200, Fitzgerald industriesinternational, 20R-AP002), goat anti-serpin a3n (1:200, R&D systems, AF4709), and anti-MHC II (1:200, BioLegend, IA / IE, 107601). Secondary antibodies included Cy2 / Cy3 / Cy5-conjugated donkey anti-mouse / goat / rabbit / rat / chicken / guinea pig antibodies (1:200; all from Jackson Immunoresearch). Sections were imaged on a Zeiss LSM710 confocal microscope using a 20x or 40x objective. Two negative controls were routinely used during immunostaining procedures: staining with an isotype control antibody followed by secondary antibody staining, or staining with the secondary antibody alone. Tissues were mounted on slides with ProLong™ Gold Antifade Mountant with DAPI (Thermo Scientific, P36931) or VECTASHIELD® Antifade Mounting Medium (Vector Laboratories, H-1000), and sealed with a coverslip. Brains from Itgb8-tdT and Smad2 / 3-cKO mice were harvested after transcardial perfusion with 20 mL of cold PBS and 20 mL of cold 4% formaldehyde. Tissues were fixed in 4% formaldehyde overnight at 4°C and then incubated in 30% sucrose overnight. Samples were embedded (Tissue-Plus™ OCT Compound, Fisher Scientific, 23-730-571) and cryosectioned at 20 µm thickness. Sections were mounted on glass and blocked with PBS containing 1–2% BSA, 5% donkey serum, and 0.5% Triton X-100. Primary and secondary antibodies were diluted in PBS containing 1% BSA and 0.25%–0.5% Triton X-100.The primary antibodies were goat anti-Sox9 (1:300, R&D systems, AF3075), rabbit anti-Olig2 (1:300, Millipore, AF2418), mouse anti-NeuN (1:300, Millipore, MAB377), rabbit anti-GFAP (1:300, DAKO, Z0334), rat anti-GFAP (1:300, Invitrogen 13-0300), goat anti-Pdgfra (1:300, R&D Systems, AF1062), goat anti-Iba1 (1:300, Novus, NB100-1028), rat anti-Cd68 (1:300, Bio-Rad, MCA1957), and rabbit anti-Apoe (1:300, Abcam, ab183596). Secondary antibodies included: Cy2 / Cy3 / Cy5-conjugated donkey anti-mouse / goat / rabbit antibodies (1:200; all from Jackson Immunoresearch).
[0115] Thioflavin-S staining and quantification
[0116] Free-floating brain sections, 30 µm thick, were incubated in filtered 1% aqueous Thioflavin-S (Sigma T1892) at room temperature for 8 minutes. Sections were then washed sequentially with 80%, 95% ethanol, and distilled water. Whole-cortical images were acquired using a Leica Microsystems DMi8 microscope with tile scanning technology. Thioflavin-S-positive areas were quantified using the automated thresholding method "Otsu" in Fiji. Seven animals were analyzed per group.
[0117] Cresyl violet staining and neuron counting
[0118] Free-floating brain sections, sliced 30 µm thick, were stained with cresyl violet (Sigma) to assess neuronal survival. Staining was performed to visualize neurons. Sample sections were incubated in 100% ethanol for 6 minutes, defatted in xylene for 15 minutes, and then incubated in 100% ethanol for an additional 10 minutes. After rinsing in distilled water, slides were stained with 0.5% cresyl violet acetate for 15 minutes and then rinsed again in distilled water. Sections were then placed in differentiation buffer (0.2% acetic acid in 95% ethanol) for 2 minutes, dehydrated in ethanol and xylene, and mounted with Depex medium. Pyramidal neurons were counted in serial sections 30 µm apart within each brain and analyzed using one-way analysis of variance with Fisher's LSD post hoc test. Percent neuronal survival was quantified relative to the number of pyramidal neurons in age-matched APOE3-KI mice.
[0119] RNAscope
[0120] RNAscope was used according to the manufacturer's instructions. ® Multiplex Fluorescent Reagent Kit (v2, ACD, 323100), ITGB8 human probe (Hs-ITGB8-XMfa, ACD, 515881), Itgb8 mouse probe (Mm-Itgb8, ACD, 407931), INPP5D probe (Hs-INPP5D, ACD, 465051), negative control probe DapB (ACD, 321831), and positive control probe (Hs-PPIB, ACD, 313901) were used for RNAscope. ® ISH was performed on formalin-fixed paraffin-embedded (FFPE) sections from humans and 4% PFA-fixed (fixed-frozen) sections from mice. Sections were further blocked with 5% BSA, 5% normal donkey serum, and 0.3% Triton in PBS for 1 hour and then incubated with primary antibodies overnight at 4°C (anti-GFAP, 1:400, Abcam, 4674; anti-IBA1, 1:200, Wako, 019-19741; anti-HJ3.4B 102 , 1:600, Holtzman Lab). Secondary antibodies (AlexaFluor 488 donkey anti-mouse, 1:300; AlexaFluor 546 donkey anti-goat, 1:300; AlexaFluor 546 donkey anti-rabbit, 1:300; AlexaFluor 647 donkey anti-mouse, 1:300) were applied for 2 hours. After washing with PBS, sections were mounted with Fluoromount-G™ mounting medium containing DAPI (Thermo Fisher, 00-4958-02) and sealed with coverslips.
[0121] Image Visualization
[0122] Images were cropped, merged, and optimized using Fiji, Photoshop CS6 13.0 (Adobe), and arranged using Adobe Illustrator CS5 15.1.
[0123] Image analysis
[0124] To assess the extent of MGnD and neurodystrophy, randomly selected images at 40x magnification were taken near the injection site of APOE3-KI, APOE4-KI, and APOE4-cKO mice. The Lamp1-positive area in APOE3-KI and APOE4-KI mice was quantified using the automatic thresholding method "Otsu" in Fiji. The Lamp1-positive area was further normalized to each Iba1 + 5-7 animals were analyzed per experimental group. CreERT2 / WT :Spi1 fl / wt :APP / PS1 and Tmem119 WT / WT :Spi1 fl / wt :HJ3.4B in APP / PS1 mice +Plaque burden, 10x magnification images were taken from the cortex. The positive area for HJ3.4B was quantified using the automatic thresholding method "RenyiEntropy" in Fiji. The positive area for Clec7a and Iba1 was quantified using the automatic thresholding method "Moments" in Fiji. 3-6 mice were analyzed per experimental group. To assess the amount of Clec7a, Iba1 and serine protease inhibitor a3N, 10x and 40x magnification images were taken from the cortex of APP / PS1:APOE4-KI mice injected with PU.1 inhibitor or control. The integrated density of Clec7a was measured using Fiji. The automatic thresholding method of Fiji was used to quantify the positive area ("Moments" for Iba1 and "Triangle / Triangle" for serine protease inhibitor a3N / Gfap). To assess the amount of Clec7a and phosphorylated Tau (AT-100), 40x magnified images were taken from the cortex of P301S:APOE3-KI, P301S:APOE3-cKO, P301S:APOE4-KI, and P301S:APOE4-cKO mice. The positive areas for Clec7a and AT-100 were quantified using the automatic thresholding method in Fiji with "Triangle". 7-16 ROIs from 4 animals were analyzed in each experimental group. To assess the amount of APOE, 40x magnified images were taken from the cortex of P301S:APOE4-KI and P301S:APOE4-cKO mice. The APOE-positive areas were quantified using the automatic thresholding method "Triangle" in Fiji. Five mice / group were analyzed for each experimental group. To measure the area of Clec7a, Gfap, Apoe, serine protease inhibitor a3n and Plin2 in plaque area, 20x or 40x magnification images were taken from the cortex of APP / PS1:APOE3-KI, APP / PS1:APOE3-cKO, APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice. These images were exported to Fiji, and individual plaques were selected and cropped for analysis. The positive areas of Clec7a and Gfap in each plaque were quantified using the automatic thresholding method in Fiji ("RenyiEntropy" for Clec7a and "Otsu" for Gfap). In each image, the positive areas of Clec7a and Gfap were further normalized to the plaque size. 55-73 Clec7a plaques and 39-61 Gfap plaques were analyzed in each experimental group. In order to quantify Gfap + Apoe + Serine protease inhibitor a3n +Percentage of area, 39-61 Apoe plaque areas and 30-44 Serpin a3n plaque areas were analyzed for each experimental group. Automatic thresholding in Fiji was used to quantify positive areas (“Otsu / Otsu” for Apoe / Gfap; “RenyiEntropy / Triangle” for Serpin a3n / Gfap). Coverage areas were calculated using a custom macro in Fiji. To calculate the percentage of Plin2 in Iba1+ cells, Iba1+ cells and Plin2+ areas were selected by hand-drawing and measured in Fiji. 8-24 cells / group were analyzed. To quantify HJ3.4B + Plaque burden and Lamp1 area. 10x magnification images were obtained from the cortex of APP / PS1:APOE3-KI, APP / PS1:APOE3-cKO, APP / PS1:APOE4-KI, and APP / PS1:APOE4-cKO mice. HJ3.4B- and Lamp1-positive areas were quantified using the automated thresholding methods "Otsu" and "Triangle," respectively, in Fiji. The mean positive area was calculated for each animal. The number of plaques was quantified using a custom macro in Fiji. Three to six images were acquired per animal, and 7 to 14 mice were quantified per group. To quantify GFAP and pSMAD3 in the human brain, 40x magnification images were obtained from cortical sections of human AD patients carrying the APOE e3 / 3 and APOE e3 / 4 alleles. For GFAP quantification, individual plaques were selected and cropped for analysis in Fiji. The GFAP-positive area of each plaque was quantified using the automated thresholding method "Otsu" in Fiji. 43-52 plaques / group were analyzed. For pSMAD3 quantification, individual IBA1 + The cells were analyzed in Fiji. The automatic thresholding method "Otsu" in Fiji was used to identify each Iba1 + The pSMAD3-positive area of cells was quantified. The pSMAD3-positive area was further normalized to Iba1 + To quantify IBA1 + INPP5D and GFAP in cells +For fluorescence of ITGB8 in cells, 2-3 images per sample were collected in the gray matter. Automatic thresholding in Fiji was used to quantify positive areas ("RenyiEntropy / Triangle" for INPP5D / IBA1 and "Otsu / Triangle" for ITGB8 / GFAP). Overlapping areas were calculated using a custom macro in Fiji. For INPP5D, 7-8 samples per sex were analyzed per group, and for ITGB8, 7-8 male samples were analyzed per group. To quantify GFAP, 7-8 samples were analyzed per group. + Fluorescence of Itgb8 in cells was measured in the cortex of APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice. 3-4 images were collected for each sample. For Itgb8 / Gfap, the automatic thresholding method "RenyiEntropy / Triangle" in Fiji was used to identify Gfap. + Itgb8 in astrocytes +Positive areas were quantified. Coverage areas were calculated using a custom macro in Fiji. 3-5 mice / group were analyzed. To measure Clec7a and Gfap immunoreactivity, 20x magnification images were taken from the cortex of control and Itgb8-cKO mice. Integrated density was measured in Fiji. 12 ROIs / group were analyzed. Images were exported to Fiji for analysis. HJ3.4B-positive areas were quantified using the automatic thresholding method "Intermodes" in Fiji. 8-9 ROIs from 5 mice were analyzed per experimental group. Positive areas were quantified using the automatic thresholding methods "Moments" (for Gfap) and "RenyiEntropy" (for HJ3.4B) in Fiji. 8 ROIs from 5 mice were analyzed per experimental group. To quantify plaque burden and MHC II area in APP / PS1 brains injected with anti-ITGB8 antibodies, 20x and 40x magnification images were taken from cortical sections near the injection site. Images were exported to Fiji, and the positive areas for HJ3.4B or MHC II were quantified using the automatic thresholding method "Otsu" in Fiji. For MHC II, 4-7 mice / group were analyzed. For HJ3.4B, 8-9 mice / group were analyzed (two independent experiments combined and normalized to the control group). To quantify the areas of plaques, Clec7a, and Gfap in the APP / PS1:APOE4-KI brains injected with anti-ITGB8 antibodies, 20x and 40x magnification images were taken from cortical sections near the injection site. The positive areas were quantified using the automatic thresholding methods "Otsu" (for Clec7a), "Triangle" (for HJ3.4B), and "RenyiEntropy" (for Gfap) in Fiji. 11 ROIs from 6-7 mice per group were analyzed. To measure the loading of Clec7a, Iba1, Lamp1, Tmem119, and Gfap in plaque area, 10x or 20x magnification images were taken from the cortex of APP / PS1 and APP / PS1:Inpp5d-cKO mice. Integrated density was measured using Fiji. For each experimental group, 115–218 plaques of Clec7a and Iba1, 126–138 plaques of Lamp1 and Tmem119, and 127–154 plaques of Gfap were analyzed. To quantify HJ3.4B in the cortex, 115–218 plaques of Clec7a and Iba1, 126–138 plaques of Lamp1 and Tmem119, and 127–154 plaques of Gfap were analyzed. + Plaque burden. 10x magnification images were taken from the cortex of APP / PS1 and APP / PS1:Inpp5d-cKO mice. HJ3.4B-positive areas were quantified using the automatic thresholding method "Otsu" in Fiji. Seven mice were analyzed per experimental group (three ROIs per mouse).
[0125] Statistical analysis
[0126] The sample size for the experiment was selected based on previous publications using APP / PS1, P301S mice, and humans, which limited expectations for effect size and variance. Statistical analyses were performed using GraphPad Prism statistical software. All comparisons were assessed for normal distribution. Comparisons were made using Student's t-tests for only two groups, and one-way analysis of variance with Fisher's LSD post hoc tests for multiple groups.
[0127] Example 1. APOE4 Impairs Microglial Response to Acute Neurodegeneration
[0128] Our recent studies have shown that APOE expression by microglia is a marker of microglial phenotypes regulated by TGFb signaling. 21 Regulated homeostatic microglial transition to neurodegeneration 6 To investigate the role of APOE variants in regulating microglial characteristics, we isolated microglia from 4-month-old APOE3-KI and APOE4-KI nude mice. Bulk RNA sequencing (RNAseq) analysis of isolated microglia revealed that homeostatic genes, including Tgfbr2, Inpp5d, Spi1, and Smad3, were significantly upregulated in APOE4 microglia compared to 4-month-old APOE3 microglia (Figure 1A, Figure 1B). Epigenetic analysis of genomic DNA bound to lysine 9 acetylated histone 3 (H3K9ac) by anti-H3K9ac chromatin immunoprecipitation (ChIP) sequencing analysis of isolated microglia revealed that APOE4 microglia displayed reduced chromatin acetylation compared to APOE3 microglia. Furthermore, genomic regions associated with homeostatic microglial signatures, such as Inpp5d, Havcr2, and Smad3, showed enrichment of H3K9ac in APOE4 microglia compared to APOE3 microglia. To investigate the effects of APOE variants on microglial responses to acute neurodegeneration, we injected apoptotic neurons into the brains of APOE3 and APOE4 KI mice and isolated phagocytic and non-phagocytic microglia from the injection site (Figure 1C). FACS analysis of the injection site was performed using the microglia-specific marker Fcrls. 6, 21, 22 , the results showed that compared with APOE3 microglia, Fcrls + / CD11b +APOE4 microglia were impaired in phagocytosis of dying neurons (Figure 1D, Figure 1E). Using bulk RNAseq analysis of isolated microglia, APOE3 phagocytic microglia exhibited induction of MGnD signatures compared to non-phagocytic microglia isolated from the same mice (Figure 1F, Figure 1G). However, APOE4 phagocytic microglia failed to induce MGnD responses in key genes, including Clec7a, Itgax, Lilr4b, Lpl, and Spp1 (Figure 1G). Furthermore, APOE4 microglia failed to upregulate the expression of genes associated with phagocytosis, antigen presentation, interferon-γ (IFNg) signaling, and autophagosome maturation in response to phagocytosis of apoptotic neurons (Figure 1H). Ingenuity pathway analysis (IPA) comparing phagocytic and non-phagocytic APOE3 and APOE4 microglia revealed that APOE4 microglia had a dysfunctional response to phagocytosis and antigen presentation of dying neurons. APOE4 promotes enlarged late endosomes in phagocytic cells 23 and microglia 24 accumulation in AD transgenic mice, leading to impaired clearance of amyloid plaques 25 Therefore, we immunostained microglia at the injection site and detected Lamp1 expression in APOE3 microglia compared to APOE3 microglia. + Lysosomes in Iba1 + Furthermore, APOE4 microglia were impaired in their response to acute neurodegeneration and phagocytosed Iba1 at the injection site compared to APOE3 microglia. + To investigate the cell-autonomous role of APOE4 expressed in microglia in regulating microglial phenotype and function, we induced Cx3cr1 CreERT2 mice 26 with APOE3-KI fl / fl (APOE3-cKO) and APOE4-KI fl / fl (APOE4-cKO) mice, which were recently described and used to investigate the role of APOE variants expressed by astrocytes in regulating multiple cellular phenotypes in neurodegeneration and tauopathies. 20 Expression of Cx3cr1 CreERT2 / WT and Cx3cr1 WT / WT APOE3-KI gene fl / fl and APOE4-KI fl / flMice were treated with tamoxifen (TAM) at 1.5 months of age to conditionally delete the APOE variant in microglia. At 8 months of age, mice were injected with apoptotic neurons in the cortex and hippocampus (Figure 1M). FACS analysis of cells isolated from the injection site showed that Fcrls was expressed in the APOE4-KI mice compared to the APOE4-KI mice. + / Cd11b + Microglial recruitment was increased in APOE4-cKO mice (Figure 1N). Conditional deletion of APOE4 in microglia restored expression of the key MGnD gene and downregulated homeostatic genes in response to phagocytosis of apoptotic neurons (Figure 1O).
[0129] Example 2. APOE4 impairs microglial responses to neurodegeneration via PU.1
[0130] It has been previously reported that SMAD3 promoter acetylation is lower in the prefrontal cortex of human AD patients compared with controls. 27 Spi1 (also known as PU.1) binds to SMAD3 to establish a homeostatic gene regulatory landscape in microglia 28 Importantly, recent GWAS studies have shown that low PU.1 expression may protect against AD 29 To investigate whether the high expression of Spi1 in APOE4 microglia (Figure 1A) maintains homeostatic characteristics, we conditionally deleted microglial Spi1 in 2-month-old mice that underwent intracranial injection of fluorescently labeled apoptotic neurons as an acute neurodegenerative stimulus. 6 model (Figure 2A). Deletion of Spi1 in microglia enhanced the expression of MGnD genes, including Clec7a, while homeostatic genes, including Tgfb1, Cd33, and Inpp5d, were downregulated (Figure 2B). Furthermore, by comparing Spi1 deletion with APOE4 deletion in phagocytic microglia (Figure 1O), we found common MGnD and homeostatic genes that were induced and downregulated under the two conditions, respectively (Figure 2C). To validate the enhanced MGnD response to amyloid pathology, we co-expressed APP / PS1:Tmem119 in the APP / PS1:Tmem119 CreERT2 With Spi1 fl / WT The mice were crossed to assess plaque pathology at 4 months of age following tamoxifen administration at 1.5 months of age (Figure 2D, Figure 2E). Microglial Spi1 deletion in APP / PS1 mice resulted in reduced plaque burden and Clec7a expression around amyloid plaques. +MGnD was enhanced (Figure 2D to Figure 2G). This was further confirmed by RNAseq analysis of microglia isolated from APP / PS1:APOE4-KI mice treated with a pharmacological inhibitor of PU.1, showing induction of MGnD signature and repression of homeostatic genes (Figure 2H). Immunohistochemical analysis of mouse brains showed that Clec7a was upregulated, as determined by expression of the serine protease inhibitor a3n around amyloid plaques. + MGnD responses were enhanced and astrocyte activation was increased (Figure 2I to Figure 2M). Taken together, these findings suggest that APOE4 perturbs microglial responses to acute neurodegeneration by skewing microglia toward homeostatic characteristics, whereas targeting microglial APOE4 or PU.1 can restore MGnD induction.
[0131] Example 3. APOE4 deficiency in microglia restores MGnD responses to chronic neurodegeneration and promotes neuroprotection
[0132] Neurodegeneration is a pathological hallmark of AD pathology 30 , which is exacerbated in the APOE4-expressing tauopathy mouse model 20, 31 To analyze the effects of microglial APOE variants on tau-induced neurodegeneration, Cx3cr1 CreERT2 / WT :APOE3-KI fl / fl and Cx3cr1-CRE ERT2 / WT :APOE4-KI fl / fl Mice were crossed with P301S mice, which develop tau pathology and neurodegeneration between 6 and 9.5 months of age. 32 These mice were treated with tamoxifen at 1.5 months of age and evaluated at 9 months of age (Figure 3A). qPCR analysis confirmed that Cx3cr1 expression in CreERT2When human APOE gene was deleted in microglia of WT:APOE3-KI mice (Figure 3B), no significant difference in APOE immunoreactivity was found when comparing P301S:APOE3-KI and P301S:APOE4-KI mice. For example, compared with microglia isolated from WT:APOE3-KI mice, microglia isolated from the brains of 9-month-old P301S:APOE3-KI mice upregulated key MGnD genes, including Clec7a and Itgax, while downregulating TGFb signaling molecules, including Smad3 and Tgfb1 (Figure 3C). In contrast, microglia from P301S:APOE4-KI mice exhibited reduced MGnD and increased TGFb signaling signatures compared with microglia from age-matched P301S:APOE3-KI mice (Figure 3C). Immunohistochemical analysis confirmed reduced Clec7a immunoreactivity in cortical microglia of P301S:APOE4-KI mice, which exhibited increased tau hyperphosphorylation compared with age-matched P301S:APOE3-KI mice (Figure 3D, Figure 3E In a previous study, P301S:APOE4-KI mice showed significant neurodegeneration in these brain regions compared to 9.5-month-old P301S:APOE3-KI mice, but the MGnD phenotype was similar between the two groups. 20, 31 We found that conditional deletion of APOE4 in microglia was sufficient to restore the Clec7a immunoreactivity and MGnD expression signatures in P301S mice, which was associated with reduced tau hyperphosphorylation (Figures 3D to Figure 3F To determine the effect of microglial APOE variant deletion on neurodegeneration, we quantified neurons in cortical layer 5 stained with cresyl violet as previously described in tau mice. 33 P301S:APOE4-KI mice showed increased neuronal loss in cortical layer 5 compared with P301S:APOE3-KI mice, and P301S mice lacking microglial APOE4 showed significantly reduced neuronal loss compared with age-matched P301S:APOE4-KI mice ( Figure 3G 、 Figure 3H These results suggest that APOE4 expression in microglia is important for the MGnD response to tau-mediated neurodegeneration in the cortex and that APOE4 deletion in microglia delays neuronal loss.
[0133] Example 4. APOE4 deletion in microglia restores MGnD microglia and promotes Ab plaque clearance in APP / PS1 mice
[0134] APOE4 promotes Ab plaque pathology in mouse models and the brains of AD patients, study suggests8, 9, 10, 11, 12, 13 To investigate the cell-intrinsic regulation of APOE4 in microglia, we used the APP / PS1 mouse model, which is expressed in the presence of Cx3cr1. CreERT2 / WT :APOE3-KI fl / fl and Cx3cr1 CreERT2 / WT :APOE4-KI fl / fl When mice are crossed (referred to as APP / PS1:APOE3-cKO and APP / PS1:APOE4-cKO, respectively) as early as 2 months of age 34 Plaque pathology appeared. These mice were treated with tamoxifen at 1.5 months of age and evaluated at 4 months of age to verify the loss of human APOE in microglia (Figure 4A, Figure 4B). RNAseq analysis of sorted microglia showed that MGnD characteristics were restored in APP / PS1:APOE4-cKO mice compared with APP / PS1:APOE4-KI mice (Figure 4C). To characterize the microglial response in APP / PS1 mice in more detail, we utilized single-cell RNAseq of brain cells isolated from APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice. We applied unsupervised clustering and identified 6 clusters that showed microglia-like expression profiles. To distinguish peripherally recruited myeloid cells and limbic-associated macrophages (BAMs) from microglia, we re-clustered all microglia-like cells and identified Ms4a7 + and Mrc1 + macrophages 35, 36 and Lyve1 + BAM cells 37, 38 Among all microglia, we identified three major subtypes, marked by 1) M0 (homeostatic microglia) expressing Tmem119, P2ry12, and Gpr34, 2) MGnD microglia expressing Clec7a and Spp1, and 3) IFN-positive microglia enriched in Stat1, Irf7, and Ilfit1 expression. Restoration of the MGnD phenotype in APP / PS1:APOE4-cKO is accompanied by HJ3.4B + Aβ plaque pathology ( Figure 4D ) and Lamp1 + Dystrophic neurites ( Figure 4E Notably, in APOE3-deficient microglia, Lamp1 + Increased immunoreactivity of dystrophic neurites ( Figure 4E The study showed that APOE4 microglia derived from induced pluripotent stem cells accumulate lipid droplets, disrupting the coordinated microglia-neuron crosstalk required to support overall neuronal homeostasis.39 To investigate whether APOE4-KI microglia display altered metabolic signatures, we performed lipidomic profiling of sorted microglia from mice carrying APOE variants in both the APP / PS1 and WT backgrounds. We detected increased levels of certain lipid species in APOE4-KI microglia compared to APOE3-KI microglia, which were more pronounced in the APP / PS1 background. Furthermore, recent studies have identified APOE4-driven lipid metabolism dysregulation in human astrocytes and microglia. 24 , which may exacerbate AD pathology. Immunohistochemistry confirmed increased Plin2 lipid droplet accumulation in microglia of APP / PS1:APOE4-KI mice, whereas conditional deletion of APOE4 in microglia reduced this lipid droplet accumulation. Collectively, these results suggest a beneficial role for MGnD microglia in limiting AD pathology, an effect that is disrupted by APOE4, and its deletion in microglia is sufficient to restore MGnD responses to phagocytic stress and neurodegeneration.
[0135] Example 5. Microglial APOE4 deficiency promotes astrocyte activation and Ab plaque encapsulation through Lgals3 signaling
[0136] Study shows that astrocyte expression of APOE4 is associated with metabolic dysregulation and contributes to tau pathology 20 However, the effect of microglial APOE4 on astrocyte phenotype and function remains unclear. Using scRNAseq analysis of brain cells isolated from APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice, we detected two astrocyte clusters (3 and 5). 40 In contrast, cluster 3 was enriched for key reactive astrocyte genes, including Gfap, Vim, Fabp7, Cd9, and serine protease inhibitor a3n (Figure 5A). Microglial APOE4 deficiency further induced the expression of Apoe, Ttr, Cd9, Vim, Gfap, and serine protease inhibitor a3n in cluster 3 (Figure 5B). The most strongly induced gene in cluster 3 was Ttr (Figure 5B), the APOE transport protein associated with the destruction of Ab fibril formation. 41 Notably, in APP / PS1:APOE4-cKO, cluster 3 astrocytes significantly downregulated Vegfa (Figure 5B), which has been shown to disrupt blood-brain barrier integrity. 42 Furthermore, APOE4 deletion in microglia increased Gfap Hi / Apoe Hi、 Gfap HiSerine protease inhibitor a3n Hi , Gfap Hi / Vim Hi and Gfap Hi / Cd9 Hi IPA analysis of astrocytes from APP / PS1:APOE4-cKO mice revealed upregulation of metabolic pathways involved in cholesterol biosynthesis, responses to oxidative stress, HIF1a, and IGF-1 signaling ( Figure 5D IHC analysis showed that Gfap immunoreactivity around Ab plaques was reduced in APP / PS1:APOE4-KI mice compared with APP / PS1:APOE3-KI mice, while Gfap immunoreactivity was restored in APP / PS1:APOE4-cKO mice ( Figures 5E to 5F Although APOE immunoreactivity was detected in plaques and astrocytes, immunostaining for human APOE protein and Gfap validated Iba1 expression in APP / PS1:APOE3-cKO and APP / PS1:APOE4-cKO mice. + APOE deficiency in microglia Figure 5E ). In addition, Gfap in APP / PS1:APOE4-cKO mice + APOE immunoreactivity was also restored in astrocytes ( Figure 5E 、 Figure 5G ), confirming the results of scRNAseq analysis (Figure 5B). In addition, Gfap was expressed in APP / PS1:APOE3-cKO and APP / PS1:APOE4-KI mice compared with APP / PS1:APOE3-KI mice. + The expression of serine protease inhibitor A3N protein in astrocytes is decreased ( Figure 5H 、 Figure 5I ), while APOE4 deletion in microglia increased Gfap encapsulating Ab plaques + Serine protease inhibitor a3a in astrocytes ( Figure 5H ).
[0137] To investigate direct microglia-astrocyte crosstalk influenced by APOE3 and APOE4 alleles expressed in microglia, we transplanted MGnD-phagocytic microglia from APOE3-KI, APOE4-KI, and APOE4-cKO donor mice injected with apoptotic neurons into WT nude mice ( Figure 5J). Astrocytes were isolated from the injection site 16 hours later and analyzed by bulk RNAseq. We found that the expression of astrocyte activation markers, including the serine protease inhibitors a3n and Gfap, was reduced in mice injected with APOE4-MGnD compared to APOE3-MGnD (Figure 5K). Importantly, APOE4 deletion in microglia restored their crosstalk with astrocytes and induced classic astrocyte activation molecules, including the serine protease inhibitors a3n, Cd9, and Gfap (Figure 5L). IPA analysis found that IGF-1 was the most active upstream regulator, while TGFb1 was the most severely suppressed upstream regulator in astrocytes in response to APOE4-cKO MGnD (Figure 5M). Taken together, these findings support a key role for Lgals3-expressing MGnD-microglia in promoting astrocyte activation and their recruitment to plaques.
[0138] Example 6. Impaired MGnD Signature Induction and Astrocyte Activation in APOE e4 AD Carriers
[0139] Female carriers of the APOE4 allele have a greater risk of developing AD and show more rapid disease progression compared to male carriers of the APOE e4 allele. 8 . To investigate sex differences associated with APOE4 in AD patients, we performed RNAseq analysis of the whole human brain. In male AD brains with the APOE e3 / 4 allele, expression levels of MGnD genes such as CLEC7A, AXL, LYZ, CD300LG, and HLA-DQB2 were significantly reduced, while the induction of ITGB8, an upstream regulator of TGFb signaling, was more pronounced compared to APOE e3 / 3 brains (Figure 6A). We also found that GRN expression was significantly increased in APOE e3 / 4 males, which has been previously reported to be associated with reduced microglial activation in humans. 45 . Furthermore, consistent with the reduced astrocyte activation in APP / PS1:APOE4-KI mice, we found reduced expression of S100A, GFAP, and VIM in female APOE e3 / 4 AD brains (Figure 6B, Figure 6C). Importantly, among the top genes upregulated in female APOE e3 / 4 AD brains were several AD risk factors, including ABCA7, IFNAR1, APP, BIN1, CD33, and HAVCR2 (Figure 6B, Figure 6D), which encode the checkpoint molecule T cell immunoglobulin mucin-3, one of the most promising new therapeutic approaches in cancer. 46 , recently described as an AD risk gene in GWAS 4 In addition, SMAD3, a downstream adaptor of TGFb signaling,47 Upregulated in the brains of APOE e3 / 4 AD females (Figure 6B, Figure 6D). KEGG pathway analysis of female microglial RNAseq data showed enrichment of pathways related to neurodegeneration, reactive oxygen species, phagosome formation, and proteolysis in APOE e3 / 3 AD carriers (Figure 6E). 48 Analysis by [ 15 ] showed that female APOE e3 / 4 carriers had increased expression of TGFb signaling genes and downstream AD risk factors, including INPP5D. Concomitantly, MGnD genes such as APOE, SPP1, and HLA-DQB1 were decreased in female APOE e3 / 4 carriers ( ). Importantly, we found similar observations in an independent cohort described by Zhou et al. 49 , showing increased expression of SPI1, TGFB1, and GRN in microglia from AD brains expressing APOE e3 / 4 ( Figure 6F Furthermore, RNAscope analysis confirmed that IBA1 expression in APOE e3 / 4 AD carriers was significantly higher than that in APOE e3 / 3 AD carriers. + Increased expression of the homeostatic checkpoint INPP5D in microglia. These findings in humans are consistent with our previous results showing that Spi1 expression is enriched in APOE4-KI mice (Figure 1A) and that MGnD characteristics are restored after Spi1 (PU.1) gene deletion in mice challenged with apoptotic neurons. Studies have shown that PU.1 can bind to SMAD3 and promote the maintenance of microglial homeostatic characteristics. 50 Importantly, we detected increased SMAD3 expression in the brains of female APOE e3 / 4 (Figure 6B), suggesting that PU.1 promotes TGFb regulation in APOE e3 / 4 AD carriers and supporting previous observations that higher SPI1 expression may lead to earlier AD onset. 29 Immunohistochemical analysis confirmed the expression of IBA1 in female patients with APOE e3 / 4 AD. + SMAD3 activation and pSMAD3 immunoreactivity in microglia ( Figure 6G 、 Figure 6H We also demonstrated that GFAP immunoreactivity associated with Ab plaques was reduced in female APOE e3 / 4 brains compared to APOE e3 / 3 brains ( Figure 6I 、 Figure 6J ). Public snRNAseq data of astrocytes from AD brains expressing APOE e3 / 3 and e3 / 4 alleles 49 The analysis confirmed that GFAP expression in APOE e3 / 3 donors was significantly higher than that in APOE e3 / 4 donors.Hi and serpin A3 + The percentage of astrocytes increased ( Figure 6K ). In addition, astrocyte activation genes (including CST3, HSP90AB1, and ALDOC) were decreased, while TGFb1 signaling-related genes (including TGFBR3, TGFB2, and ITGB8) were significantly increased in APOE e3 / 4 subjects ( Figure 6L To confirm the increased expression of ITGB8 in astrocytes, we performed RNAscope analysis and detected an increase in GFAP in APOE e3 / 4 compared to APOE e3 / 3 AD males. + Induction of ITGB8 in astrocytes (Figure 8A to Figure 8Ci). In addition, RNAscope showed that Itgb8 expression was reduced in astrocytes from APP / PS1:APOE4-cKO mice compared with APP / PS1:APOE4-KI mice (Figure 8D to Figure 8E). Taken together, these findings suggest that TGFb signaling is enhanced in APOE4 carriers, which may prevent AD development by inhibiting the response of MGnD-microglia and astrocytes to neurodegeneration.
[0140] Example 7. Loss of ITGB8-TGFb Signaling Enhances MGnD Response and Aβ Phagocytosis
[0141] To gain molecular insights into the role of APOE4-mediated TGFb signaling in the AD brain, we genetically and pharmacologically inhibited ITGB8 in WT and APP / PS1 mice, which is a potential target for TGFb1. 51 Compared with published brain RNAseq datasets 52 Consistent, Itgb8 - TdTomato reporter mice exhibit robust Itgb8 expression in cortical astrocytes, mature oligodendrocytes, and oligodendrocyte precursor cells, but not in microglia, neurons, or endothelial cells. Cre :Itgb8 fl / fl Genetic deletion of Itgb8 in the cortex of mice (Itgb8-cKO) reveals a complete absence of steady-state Tmem119 +Microglia, while Clec7a is highly expressed in cortical microglia (Figure 7A). This mouse model allows us to study the effects of Itgb8 deletion in the cortex and hippocampus, while the rest of the brain is unaffected. This is particularly important for distinguishing microglial responses between affected and unaffected areas within the same brain. Our data confirm that MGnD is induced only in the affected areas, namely the cortex and hippocampus. We also observed that Clec7a was expressed in the cortex of Itgb8-cKO mice, which is similar to the expression of MGnD in the hippocampus. + Gfap immunoreactivity was enhanced in MGnD-microglia (Figures 7B to 7D). RNAseq of cortical microglia showed that MGnD-associated genes (Apoe, Cd300ld, Cd74, and Axl) were induced, while homeostatic genes (Tmem119, Siglech, Mertk, and Havcr2) were repressed (Figure 7E). Notably, cortical microglia from Itgb8-cKO mice did not express the peripheral mononuclear cell lineage gene Ms4a3. 53 , supporting that microglia were not replaced by peripheral monocytes, as previously published Nestin-CRE:Itgb8 fl / fl Mouse model 44 Functional characterization showed that phagosome formation, antigen presentation, chemokine signaling, and IFNg signaling were induced in cortical microglia of Itgb8-cKO mice. 6 Additional characterization of microglia using acute responses to neurodegeneration revealed that genes involved in antigen presentation and IFNg signaling were upregulated in Itgb8-cKO mice compared to control mice. Furthermore, in response to acute intracranial injection of Ab, Itgb8 deletion promoted microglial Ab phagocytosis ( Figure 9A ). By acting as a regulator of microglial homeostatic features downstream of TGFb 21, 28, 50 , we found decreased Smad3 phosphorylation and increased Apoe immunoreactivity in Itgb8-KO mice ( Figure 7G to Figure 7I). Using Cx3cr1-CRE:Smad2 / 3 fl / fl In mice, we demonstrated that Smad2 / 3 deficiency in microglia resulted in the suppression of the microglial homeostatic molecule Tmem119 and the enhanced expression of MGnD molecules associated with astrocyte activation, including Cd68 and Apoe. Cre :Itgb8 fl / fl The gene expression profile of cortical microglia in mice is similar to that of Tgfbr2-cKO microglia ( Figure 6J ) and previously published Nrros-KO 54and microglial transcriptomes of Smad2 / 3-cKO mice ( Figure 10A ) were highly similar (R=0.89; P< 2.2e-16). Importantly, AD risk factors (including Bin1, Inpp5d, and Havcr2) were decreased in all datasets (Figure 7J, Figure 10B Reproducible gene expression profiling of microglia revealed that regional deletion of Itgb8 inhibits TGFb signaling, leading to the induction of the MGnD phenotype.
[0142] Example 8. Loss of the microglial homeostatic checkpoint Inpp5d contributes to plaque clearance by inducing the MGnD response.
[0143] Induction of the MGnD gene in microglia depleted of Itgb8, Tgfbr2, Nrros, or Smad2 / 3 is associated with suppression of AD risk factors, including Bin1, Havcr2, and Inpp5d 3, 4 (Figure 7J). In addition, APOE4 microglia showed increased expression of Inpp5d (Figure 1A) and enriched for protein acetylation at the Inpp5d locus. To explore the effect of microglia-specific Inpp5d on AD pathology and MGnD response, we cleaved Cx3cr1 CreERT2 / WT :Inpp5d fl / fl Mice were crossed with APP / PS1 mice. Thioflavin-S and HJ3.4b staining demonstrated that microglial Inpp5d deficiency in APP / PS1 mice induced MGnD responses that were associated with reduced Ab plaque burden. Furthermore, microglia lacking Inpp5d exhibited increased Clec7a immunoreactivity associated with Ab plaques. Importantly, microglial Inpp5d deficiency was sufficient to reduce Lamp1 expression in APP / PS1 mice. + Furthermore, after deletion of Inpp5d in microglia, enhanced MGnD responses associated with Ab plaques were accompanied by Gfap + Similarly, recent studies have shown that microglial Inpp5d deletion protects against plaque-induced neuronal dystrophy in transgenic AD mice. 55, 56 These results support a role for Inpp5d as a microglial homeostatic checkpoint and that its loss beneficially alleviates AD pathology by inducing MGnD responses.
[0144] Example 9. Blocking ITGB8-TGFb Signaling Enhances MGnD Response and Reduces AD Pathology in APP / PS1 Mice
[0145] To test whether enhanced microglial activation and phagocytosis could reduce AD pathology in adult APP / PS1 mice, we used an anti-ITGB8 neutralizing mAb (ADWA-11). 57 Three days after injection in 4-month-old APP / PS1 mice, microglia increased antigen presentation and IFNg signaling ( Figure 7K 、 Figure 7L Immunohistochemical analysis confirmed MHC-II expression around the injection site. + Increased immune reactivity ( Figure 9B ). In addition, 14 days after injection, we found that the plaque size in the anti-ITGB8 mAb-injected group was significantly reduced compared with the control group (Figure 7M, Figure 7N). In APOE4-KI:APP / PS1 mice, treatment with anti-ITGB8 mAb restored the induction of Clec7a and GFAP, which was associated with the reduction of plaque pathology ( Figure 7O 、 Figure 7P Overall, these results strongly support a key role for ITGB8-TGFb signaling in regulating the MGnD response in AD pathology. Therefore, pathological targeting of ITGB8-TGFb signaling in AD could promote MGnD responses and astrocyte activation and provide a novel approach for therapeutically modulating innate immunity in AD and dementia.
[0146] Example 10. Targeting ITGB8-TGFb signaling alleviates cognitive decline in 5xFAD mice
[0147] Microglia and astrocytes play crucial roles in brain physiology, but they can also contribute to central nervous system (CNS) pathology in the context of neurological diseases. APOE4 is the strongest genetic risk factor for late-onset AD. We determined that APOE and TGFβ reciprocally regulate neurodegenerative microglia (MGnD) in preclinical models of AD. 6, 22, 31 , also known as disease-associated microglia (DAM) 7 Astrocytes also respond to neurodegeneration and express disease-associated astrocytes (DAA) that are associated with amyloid-β protein (Aβ) plaques. 40 Furthermore, studies have shown that reactive astrocytes play a beneficial role in limiting AD pathology, and that astrocyte depletion in AD mice leads to increased plaque burden, synaptic dysfunction, and memory loss. 64We found that integrin subunit β8 (ITGB8), induced on astrocytes in the APOE4 brain environment, activates microglial TGFb signaling, locking them in a steady state and thus impairing their response to neurodegeneration. As described in Examples 1-9, we identified the microglial APOE4-ITGB8-TGFb pathway as a negative regulator of microglial responses to AD pathology and that restoring the MGnD phenotype by blocking ITGB8-TGFb signaling provides a promising therapeutic intervention for AD.
[0148] To test whether enhanced microglial activation and phagocytosis could reduce AD pathology in adult APP / PS1 mice, we used an anti-ITGB8 neutralizing mAb (ADWA-11). 57 Three days after injection in 4-month-old APP / PS1 mice, microglia increased antigen presentation and IFNg signaling, which we recently demonstrated to play a key role in inducing a pro-MGnD subset, limiting neurodegenerative pathology, and preserving cognitive function in a mouse model of AD. 105 Furthermore, 14 days after injection of anti-ITGB8 mAb, we found a significant reduction in Ab plaque size (see above).
[0149] We treated 5xFAD mice, a mouse model widely used to study synaptic dysfunction, neurodegeneration, and cognitive impairment. 104 We further investigated whether ADWA-11 could improve cognitive decline present in AD pathology by using ADWA-11 mAb or isotype control (3 mg / ml) in mice (n=15 / group), a model of AD-related amyloid pathology, and wild-type mice (n=15 / group). Treatment was administered intraperitoneally (ip) starting in four-month-old mice, once weekly, with ADWA-11 mAb or isotype control (3 mg / ml). When mice reached eight months of age, we assessed spatial learning and memory using a water maze test, as well as spatial short-term memory and alternation behavior using a T-maze test (Figure 11A). We found that systemic administration of ADWA-11 restored short-term memory, as demonstrated by the T-maze test, similar to that of WT mice (Figure 11B).
[0150] Furthermore, long-term treatment with ADWA-11 mAb improved spatial learning (Figure 11C) and memory (Figure 11D). Importantly, long-term treatment with ADWA-11 mAb for 16 weeks did not produce any visual changes in clinical behavior and was therefore safe. Therefore, pharmacological inhibition of ITGB8 signaling through peripheral therapy is a novel approach for the treatment of AD and dementia.
[0151] References
[0152] Other implementation plans
[0153] It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing description is intended to illustrate rather than limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the appended claims.
Claims
1. A method of treating a subject suffering from a neurodegenerative disorder associated with microglial damage, the method comprising administering a therapeutically effective amount of an integrin subunit β8 (ITGB8) inhibitor. 2 . The method of claim 1 , wherein the ITGB8 inhibitor is an antibody that binds to ITGB8. 3 . The method of claim 2 , wherein the antibody that binds to ITGB8 is ADWA11, ADWA16, C6D4, 37E11, HuC6D4F12, CL7290, or a humanized version thereof.
4. The method of claim 3, wherein the humanized form is ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, ADWA11-2.4, ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16 hugraft, Abl, Ab2, or Ab3. 5 . The method of claim 1 , wherein the ITGB8 inhibitor is an inhibitory oligonucleotide targeting human ITGB8 that reduces ITGB8 expression. The method of claim 5 , wherein the oligonucleotide is 15 to 21 nucleotides in length.
7. The method of claim 5, wherein at least one nucleotide of the oligonucleotide is a nucleotide analog.
8. The method of claim 5, wherein the oligonucleotide is a gapmer or a mixed-mer.
9. The method of claims 1-8, wherein the neurodegenerative disorder is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS).
10. An ITGB8 inhibitor for use in a method of treating a subject suffering from a neurodegenerative disorder associated with microglial cell damage. The inhibitor for use according to claim 10 , wherein the ITGB8 inhibitor is an antibody that binds to ITGB8.
12. The inhibitor for use according to claim 11, wherein the antibody that binds to ITGB8 is ADWA11, ADWA16, C6D4, 37E11, HuC6D4F12, CL7290 or a humanized form thereof.
13. An inhibitor for use according to claim 12, wherein the humanised form is ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, ADWA11-2.4, ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16 hugraft, Abl, Ab2 or Ab3.
14. The inhibitor for use according to claim 15, wherein the ITGB8 inhibitor is an inhibitory oligonucleotide targeting ITGB8 that reduces ITGB8 expression.
15. The inhibitor for use according to claim 14, wherein the oligonucleotide is 15 to 21 nucleotides in length.
16. The inhibitor for use according to claim 14, wherein at least one nucleotide of the oligonucleotide is a nucleotide analogue.
17. The inhibitor for use according to claim 14, wherein the oligonucleotide is a gapmer or a mixedmer.
18. The inhibitor for use according to claims 10-17, wherein the neurodegenerative disorder is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS).
Citation Information
Patent Citations
Activated protein C formulations
US20040028670A1
Methods and compositions for treating and preventing disease associated with alpha-v beta-8 integrin
US20160046717A1
Antibodies that bind integrin avb8 and uses thereof
US20210277125A1
Boll fob ob tjsiiffg gbaiit
US293306A
Synthetic polynucleotides
US3687808A