Application of bacterial protein in preparation of medicine for inhibiting colorectal cancer

Abstract

The invention discloses an application of a bacterial protein in preparation of a medicine for inhibiting colorectal cancer. The bacterial protein is a CWBR-CP protein derived from Hungata hedwayi. The invention further discloses an application of the bacterial protein in preparation of a medicine for inhibiting colorectal cancer. A recombinant expression vector containing a coding gene of the CWBR-CP protein is introduced into Escherichia coli to construct recombinant Escherichia coli and express the recombinant Escherichia coli, thalli of the expressed recombinant Escherichia coli are separated and extracted, and the bacterial protein with anticancer activity is obtained. The prepared CWBR-CP protein can significantly reduce the size and weight of the tumor of a mouse with colorectal cancer induced by azomethane / dextran sodium sulfate and increase the proportion of CD80 < + > macrophages to CD80 < + > CD86 < + > macrophages, it is prompted that CWBR-CP can promote polarization of M1 macrophages to inhibit the progress of CRC, a new means capable of effectively inhibiting the occurrence and development of colorectal cancer is expected to be obtained, and the CWBR-CP protein has a broad application prospect. And the method has huge development prospects and application values.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of a bacterial protein in the preparation of a drug for inhibiting colorectal cancer. Background Art

[0002] Colorectal cancer (CRC) is the third most common malignancy and the second leading cause of cancer death (Siegel RL, Wagle NS, Cercek A, et al. Colorectal cancer statistics, 2023[J]. CA: a cancer journal for clinicians, 2023, 73(3):233-254.). The increasing global incidence, the younger onset of the disease, the recurrent nature of the disease, and the economic burden of treatment costs have made CRC a public health issue that poses a global health burden.

[0003] In recent years, a large number of studies have supported the important influence of the intestinal flora on the occurrence and development of CRC. This influence may be due to the intestinal microbiome itself or the metabolites formed by toxins and / or fermentation byproducts produced by bacteria, which affect intestinal homeostasis, leading to pro- or anti-inflammatory immune responses and subsequent CRC development. (Gao R, Wu C, Zhu Y, et al. Integrated analysis of colorectal cancer reveals cross-cohort gut microbial signatures and associated serum metabolites [J]. Gastroenterology, 2022, 163(4): 1024-1037.).

[0004] Hungatella hathewayi is a Gram-positive, rod-shaped, spore-forming, strictly anaerobic bacterium isolated from an anaerobic digester sample of industrial wastewater (Kaur S, Yawar M, Kumar PA, et al. Hungatella effluvii gen.nov., sp.nov., an obligately anaerobic bacterium isolated from an effluent treatment plant, and reclassification of Clostridium hathewayi as Hungatella hathewayi gen.nov., comb.nov[J]. International journal of systematic and evolutionary microbiology, 2014, 64(Pt_3):710-718.). Metagenomic analysis showed that H.hathewayi was enriched in fecal samples of patients with colorectal cancer or precancerous adenoma (Liang JQ, LiT, Nakatsu G, et al. A novel faecal Lachnoclostridium marker for the non-invasive diagnosis of colorectal adenoma and cancer[J]. Gut, 2020, 69(7): 1248-1257.).

[0005] In summary, the intestinal microbiome is inextricably linked to the development and progression of CRC, making it an important avenue for research and treatment. Hungatella hathewayi, a recently reclassified intestinal microbe, has garnered widespread attention. As a member of the intestinal microbiome, this bacterium has been linked to a variety of diseases, but its specific mechanisms in colorectal cancer remain unclear, necessitating further investigation. Summary of the Invention

[0006] The purpose of the present invention is to address the problem that existing technologies cannot effectively inhibit the occurrence and development of colorectal cancer, and to provide an application of bacterial protein in the preparation of drugs for inhibiting colorectal cancer. It is expected to obtain a new means that can effectively inhibit the occurrence and development of colorectal cancer, which has great development prospects and application value.

[0007] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0008] A use of a bacterial protein in the preparation of a drug for inhibiting colorectal cancer, wherein the bacterial protein is a cell wall binding repeat-containing protein (CWBR-CP) protein derived from Hungatella hathewayi, and its amino acid sequence is shown in SEQ ID NO.1.

[0009] Among them, the nucleotide sequence of the gene encoding the CWBR-CP protein is shown in SEQ ID NO.2.

[0010] The bacterial protein is prepared according to the following method: constructing a recombinant bacterium containing a CWBR-CP protein encoding gene, expressing the CWBR-CP protein and then extracting it.

[0011] The plasmid used in the process of constructing the recombinant bacteria containing the CWBR-CP protein encoding gene is pET-26b(+), and the host bacteria used is Escherichia coli, preferably Escherichia coli BL21.

[0012] Wherein, the expression is induced expression, and the inducer used is IPTG.

[0013] Preferably, the method of inducing expression is: inoculating the seed solution of the recombinant bacteria into the culture medium at a ratio of 1-2% v / v, and culturing at 30-37°C and 200-220 rpm until the bacterial OD 600 The pH value is 0.6-0.8, and then IPTG is added to the culture medium, and the culture is continued at 25-30° C. and 200-220 rpm for 12-16 hours to induce the recombinant bacteria to express the CWBR-CP protein and obtain a recombinant bacterial liquid.

[0014] Preferably, IPTG is added to the culture medium of the recombinant bacteria during culture, so that its initial concentration in the culture medium is 0.1-1 mM.

[0015] Wherein, the culture medium is LB liquid culture medium, and preferably, the culture medium contains 30-50 μg / mL of kanamycin (Kana).

[0016] The extraction method comprises the following steps: using lysozyme to break the cell wall, ultrasonic crushing, solid-liquid separation, collecting the liquid, and protein purification column chromatography to obtain the CWBR-CP protein.

[0017] The amount of lysozyme added is 20 to 50 kU / g of bacteria, and the enzyme activity unit (U) is defined as: at 25°C, in 1 mL of a Micrococcus luteus suspension with a pH of 7.0, the initial absorbance at a wavelength of 450 nm is 0.750, the path length is 10 mm, and the amount of enzyme that causes the absorbance to decrease at a rate of 0.001 per minute.

[0018] Before the column chromatography, the collected liquid is subjected to membrane filtration, and the filtrate is subjected to the protein purification column chromatography.

[0019] The resin used in the protein purification column chromatography is a His-tagged protein agarose purification resin, and the eluent used is an imidazole aqueous solution.

[0020] Preferably, the extraction method comprises the following steps:

[0021] Step 1: After the induction expression is completed, the obtained recombinant bacterial solution is centrifuged to collect the bacteria, wash the bacteria 2 to 3 times with an imidazole aqueous solution, and resuspend the bacteria with the imidazole aqueous solution to obtain a resuspended bacterial solution; wherein the centrifugation conditions are: 5000 to 8000g low-temperature centrifugation for 5 to 10 minutes; the concentration of the imidazole aqueous solution is 5 to 10mM; the volume ratio of the imidazole aqueous solution used to resuspend the bacteria to the recombinant bacterial solution before centrifugation is 1:10 to 15.

[0022] Step 2: Add lysozyme to the resuspended bacterial solution obtained in step 1, wherein the amount of lysozyme added is 20-50 kU / g of bacterial cells, incubate in a 30-37°C water bath for 10-15 minutes, perform ultrasound at 180-360W, ultrasound for 10-15 seconds, pause for 10-15 seconds, and a total ultrasound time of 10-15 minutes. After the ultrasound, centrifuge the bacterial solution at 10,000-12,000 rpm for 20-30 minutes, collect the supernatant, filter through a 0.40-0.45 μm filter membrane, and collect the filtrate.

[0023] Step 3: Mix the filtrate obtained in step 2 with the resin at 0-4° C. and 200-220 rpm for 2-3 hours to fully combine the substance in the filtrate with the resin to obtain a resin-protein mixture, add the mixture to an empty column, and then elute with imidazole aqueous solutions of different concentrations, collect the effluent, and obtain the CWBR-CP protein; wherein the volume ratio of the filtrate to the resin is 3-4:1; the amount of the imidazole aqueous solutions of different concentrations used during elution is 3-5 times the volume of the resin; the pH value of the imidazole aqueous solutions of different concentrations is 8.00-8.50; the resin is preferably Ni-16NTA His·Bind resin; and the resin is cleaned with a 5-10 mM imidazole aqueous solution before use.

[0024] The bacterial protein exerts its tumor suppressor effect by promoting macrophage polarization toward M1 macrophages and inhibiting macrophage polarization toward M2 macrophages. M1 macrophages secrete pro-inflammatory cytokines and chemokines, present antigens, and thus participate in active immune responses. As part of immune surveillance, they can directly kill or inhibit tumor cell growth. M2 macrophages primarily secrete anti-inflammatory cytokines, which reduce inflammation, promote tumor growth, and have immunosuppressive functions.

[0025] Beneficial effects:

[0026] The CWBR-CP protein of the present invention can significantly reduce the tumor size and weight of mice with colorectal cancer induced by azomethane / dextran sulfate sodium, and significantly increase the CD80 expression in the spleen of mice with colorectal cancer. + Macrophage ratio and CD80 + CD86 + The results showed that CWBR-CP can promote the polarization of macrophages into M1 macrophages in mice and inhibit the progression of CRC. It is expected to obtain a new means to effectively inhibit the occurrence and development of colorectal cancer, which has great development prospects and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more apparent.

[0028] Figure 1 Figures are related to the experimental results during the expression and purification of the protein CWBR-CP in Example 1; wherein, Figure A is an SDS-PAGE electrophoresis diagram of protein components with a molecular weight of >100 kDa and a molecular weight of 50 to 100 kDa in the culture supernatant of Hungatella hathewayi; Figure B is a schematic diagram of CWBR-CP protein information; Figure C is a schematic diagram of cloning CWBR-CP with a His tag into a pET-26b(+) vector; Figure D is an agarose gel electrophoresis diagram of pET-26b(+)-CWBR-CP plasmid DNA before and after enzyme digestion for further identification of the ligation product; Figure E is a gel electrophoresis diagram of imidazole eluates of various concentrations after Coomassie brilliant blue staining during the purification of CWBR-CP by a protein purification column; and Figure F is a gel electrophoresis diagram of the eluate verified by western blotting.

[0029] Figure 2Figure 2 is a statistical graph showing the polarization-related characteristics of BMDM or THP-1 cells in the control group and the CWBR-CP protein-treated group; Figure A is a statistical graph showing the expression levels of IL1β, TNFα, and SPP1 genes in the BMDM cells of the control group and the CWBR-CP protein-treated group; Figure B is a statistical graph showing the expression levels of IL1β, TNFα, and IL-6 genes in the THP-1 cells of the control group and the CWBR-CP protein-treated group; Figure C is a flow cytometry dual-parameter scatter plot of the BMDM cells of the control group and the CWBR-CP protein-treated group; Figure D is a statistical graph showing the expression levels of CD80 in the BMDM cells of the control group and the CWBR-CP protein-treated group. + Macrophage percentage histogram; Figure E shows the CD206 expression in BMDM cells of the control group and the CWBR-CP protein treatment group. + Figure 3 is a histogram of the percentage of macrophages; Figure F is a volcano plot of differentially expressed genes in BMDM cells of the control group and the CWBR-CP protein-treated group; Figure G is a statistical histogram of the fold changes of genes related to M1 macrophage polarization and M2 macrophage polarization in BMDM cells of the CWBR-CP protein-treated group relative to the blank-treated group; Figure H is a KEGG pathway diagram of macrophages in the CWBR-CP protein-treated group; * indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001.

[0030] Figure 3 Figure 3 is a statistical graph of physiological and biochemical indicators of CRC mice in the control group and the CWBR-CP treatment group; wherein, Figure A is a statistical graph of the weight of CRC mice in the control group and the CWBR-CP treatment group during gavage; Figure B is a statistical graph of the disease activity index of CRC mice in the control group and the CWBR-CP treatment group during gavage; Figure C is a statistical graph of the spleen weight of CAC mice in the control group and the CWBR-CP treatment group; Figure D is a typical photo of the colon of CAC mice in the control group and the CWBR-CP treatment group; Figure E is a statistical graph of the number of colon tumors in CAC mice in the control group and the CWBR-CP treatment group; Figure F is a statistical graph of the colon tumor weight of CAC mice in the control group and the CWBR-CP treatment group; Figure G is a flow cytometry histogram of the spleen of CAC mice in the control group and the CWBR-CP treatment group; Figure H is a CD80 in the spleen of CAC mice in the control group and the CWBR-CP treatment group. + Macrophages account for F4 / 80 + The proportion of macrophages in the histogram; Figure I is the flow cytometry contour map of CAC mouse tumors in the control group and the CWBR-CP treatment group; Figure J is the CD80 + CD86 + Macrophages account for F4 / 80 + Histogram of macrophage ratios. * indicates P < 0.05, ** indicates P < 0.01. DETAILED DESCRIPTION

[0031] The present invention is further described below with reference to the following examples. It should be understood that the following embodiments are only used to illustrate the present invention, rather than to limit the present invention.

[0032] The LB liquid culture medium used in the following examples contained the following components: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl, with a pH of 7.0 and was sterilized by autoclaving at 121° C. for 20 min.

[0033] The lysozyme used in the following examples was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., product number 10402ES08, with a specific enzyme activity of >20 kU / mg. The enzyme activity unit (U) is defined as: at 25°C, in 1 mL of a pH 7.0 suspension of Micrococcus luteus, the initial absorbance at a wavelength of 450 nm is 0.750, the path length is 10 mm, and the amount of enzyme that causes the absorbance to decrease at a rate of 0.001 per minute.

[0034] Example 1 Expression and purification of protein CWBR-CP

[0035] (1) Activation of the strain: Inoculate BL21 E. coli onto a sterile LB (Luria-Bertani) plate and incubate at 37°C for 16 h. Pick a single colony and incubate in liquid culture medium for 12–16 h. Subculture the BL21 E. coli and culture until the logarithmic growth phase.

[0036] (2) Preparation of competent cells: 600 μL of the above bacterial solution was inoculated into 30 mL of LB liquid medium. After incubation at 37°C for 2 h, 1 mL of the bacterial solution was transferred to a centrifuge tube. After incubation on ice for 5 min, the tube was centrifuged at 4000 rpm for 5 min and the supernatant was discarded. 200 μL of a 0.1 M CaCl₂ aqueous solution was added to resuspend the bacterial pellet. After incubation on ice for 30 min, the tube was centrifuged at 4000 rpm for 5 min and the supernatant was discarded. 40 μL of a CaCl₂ aqueous solution was added to resuspend the bacterial pellet again to obtain competent cells.

[0037] (3) Transformation and screening: The codon-optimized CWBR-CP gene with a His tag (commissioned to Nanjing GenScript Biotechnology Co., Ltd. for synthesis, the nucleotide sequence is shown in SEQ ID NO.3) was amplified by PCR and cloned into the middle of the NdeI and XhoI sites of the pET-26b(+) vector. 1 μL of the ligation product was added to the 40 μL competent cell suspension obtained in step (2), mixed evenly, and then ice-bathed for 30 minutes. Heat shock at 42°C for 90 seconds, then quickly ice-bathed for 2 minutes. Add 800 μL LB liquid culture medium, culture on a shaking table at 37°C for 45 minutes, centrifuge at 4000 rpm for 5 minutes, discard 600 μL of supernatant, mix the remaining supernatant with the bacterial pellet, spread on a sterile LB plate containing 50 μg / mL kanamycin, and culture at 37°C for 12 to 16 hours. Select resistant transformants for further screening and identification: The recombinant expression vector was digested with restriction endonucleases SacI and XhoI, and then PCR verification was performed. The nucleotide sequences of the primers used for PCR amplification in this step are: CWBR-CP-F: ATGAGGAAGCAAACAAAACT, CWBR-CP-R: TTTGTGTTTCGGATTGCTGC. AAACACAAAGCCTAACGACG

[0038] (4) Amplification and extraction of plasmid: The verified positive transformants were inoculated into sterile LB liquid medium containing 50 μg / mL kanamycin for amplification culture. The pET-26b(+)-CWBR-CP plasmid was extracted using the plasmid extraction kit D0007M produced by Shanghai Biyuntian Biotechnology Co., Ltd. according to the instructions: 3 mL of bacterial culture solution was centrifuged at 8000 g for 5 min, and the supernatant was discarded. 250 μL of solution I was added and mixed to completely lyse the bacteria. 350 μL of solution Ш was added and mixed by inverting until white flocs appeared. Centrifuged at 13000 rpm for 10 min, and the supernatant was collected and transferred to an adsorption column (plasmid purification column). Centrifuged at 13000 rpm for 60 s, and the waste liquid was discarded. 750 μL of solution IV was added to the plasmid purification column. Centrifuged at 13000 rpm for 60 s, and the waste liquid was discarded and dried. Transfer the plasmid purification column to a sterile 1.5 mL centrifuge tube, add 50 μL of Solution V dropwise, and let stand for 2 minutes. Centrifuge at 3000 rpm for 60 seconds. The resulting liquid is the high-purity plasmid.

[0039] (5) Transfection and induction of expression: The recombinant expression vector enzyme was transfected into BL21 Escherichia coli to obtain recombinant Escherichia coli; the recombinant Escherichia coli was inoculated into LB liquid medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C and 220 rpm to obtain seed solution; 2.5 mL of seed solution was inoculated into 250 mL of LB liquid medium (containing 50 μg / mL kanamycin) and cultured at 37°C and 220 rpm for 6 h until the OD 600Between 0.6 and 0.8, a cloudy state was observed in the culture medium. IPTG was added thereto to an initial concentration of 1 mM in the LB liquid medium. The culture was continued at 25°C and 200 rpm in a shaking incubator for 16 h to induce the expression of CWBR-CP protein and obtain a recombinant BL21 Escherichia coli culture medium.

[0040] (6) Purification of CWBR-CP protein: The bacterial suspension obtained after the culture was centrifuged at 8000 g for 5 min at 4°C. The cells were collected and washed twice with a 10 mM imidazole aqueous solution. The cells were resuspended with a 10 mM imidazole aqueous solution (the amount of 10 mM imidazole aqueous solution was 1 / 10 of the volume of the bacterial suspension before centrifugation). Lysozyme was added to the suspension until its initial concentration in the suspension was 1 mg / mL. The suspension was then water-bathed at 30°C for 15 min. The cells were then ultrasonically disrupted at 360 W for 10 s, followed by a 10 s pause, for a total of 10 min. The sonicated liquid was centrifuged at 1000 rpm for 20 min at 4°C. The supernatant was filtered through a 0.45 μm filter and the filtrate was collected.

[0041] Mix Ni-16NTA His·Bind resin (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., product number: 20503ES10) with 10mM imidazole aqueous solution in a ratio of 1:4, let it stand at 4°C, discard the supernatant when the resin is completely precipitated, repeat once, and the resin is cleaned. Add 3 times the volume of the above filtrate to the cleaned resin, mix and bind at 4°C and 200rpm for 2 hours. Add the bound resin-protein mixture to the empty column, use gravity to make the unbound protein liquid flow out, and mark it with imidazole (0), then take 3 to 5 times the volume of the resin in turn with different concentrations of imidazole aqueous solution (20, 50, 100, 150, 200, 250, 500mM) for elution, collect the eluate, and perform Western Blotting verification. The protein CWBR-CP has been successfully expressed and there are no impurities (see Figure 1 E and 1F).

[0042] The relevant experimental results during the expression and purification of protein CWBR-CP are shown in the figure Figure 1 shown.

[0043] Example 2 Evaluation of the effect of protein CWBR-CP on BMDM cell polarization

[0044] Tibias and femurs were obtained from 6- to 8-week-old C57BJ / 6 mice. Both ends were cut open and pre-chilled DMEM medium was aspirated with a 5 mL syringe to flush the mouse bone marrow cavity and collect the mouse bone marrow. Cell pellets were pipetted with a 1 mL pipette until uniform and passed through a 70 μm cell sieve. The cell suspension was collected and centrifuged at 300 g for 5 minutes. Three volumes of red blood cell lysis buffer were added and lysed on ice for 3-5 minutes. The cells were then centrifuged at 1000 g for 5 minutes. The cells were then resuspended in pre-chilled DMEM medium and counted according to the 2×10 6 The cells were seeded into a culture dish at a concentration of 10 cells / mL; the suspended cells were collected after 24 hours and cultured for 6 days with DMEM complete medium containing 10% inactivated fetal bovine serum and 20 ng / mL macrophage colony stimulating factor to obtain BMDM cells (bone marrow-derived macrophages). The BMDM cells were divided into two groups: a control group and a CWBR-CP protein-treated group (the concentration of CWBR-CP protein in the BMDM cell fluid was 10 μg / mL). The control group did not receive any treatment. Each group was repeated three times. After 24 hours of stimulation, RT-qPCR was used to detect the relative expression levels of proinflammatory cytokines (TNFα and IL1β, which assess the body's immune status and inflammatory response) and SPP1 (phosphoprotein 1, whose increased expression is correlated with poor prognosis of many types of cancer) (the relative expression level was calculated as 2 -ΔCt , GAPDH was used as an internal reference gene). Flow cytometry was used to quantify various macrophages using cell markers, and RNA-seq was used to detect differentially expressed genes between the control group and the CWBR-CP protein-treated group.

[0045] Take out the frozen THP-1 cells from the liquid nitrogen tank, thaw quickly in a 37℃ water bath, transfer the cell suspension to a 15mL centrifuge tube, add 3mL of THP-1 cell-specific complete medium, mix well and centrifuge at 1000rpm for 5min, discard the supernatant, add 1mL of THP-1 cell-specific complete medium and resuspend to a final volume of 5-7mL in a 25cm 2 Cultured in culture flasks until the logarithmic growth phase, inoculated into six-well plates, 2 mL per well, about 2 × 10 6 PMA (phorbol ester, which induces THP-1 cells to differentiate into macrophages) was added at a concentration of 10 mg / mL to a final concentration of 100 ng / mL. After the cells adhered to the wall, they were divided into a control group and a CWBR-CP treatment group. The control group did not receive any treatment. The CWBR-CP treatment group was stimulated with 10 μg / μL of CWBR-CP protein for 24 hours. RT-qPCR was then performed to detect the relative expression levels of proinflammatory cytokines TNFα, IL1β, and IL6 (the relative expression level was calculated as 2 -ΔCt , GAPDH is the internal reference gene).

[0046] Test results such as Figure 2As shown in Figure 2, RT-qPCR was used to detect the proinflammatory cytokines TNFα, IL1β, and IL6, as well as SPP1. The results showed that CWBR-CP could significantly upregulate the expression of tumor necrosis factor α (TNFα), interleukin 1β (IL1β), and interleukin 6 (IL6), and downregulate the expression of SPP1 (see Figure 2). Figure 2 A and 2B); flow cytometry (FCM) and cell markers were used to quantify various macrophages. Flow cytometry revealed that CWBR-CP increased CD80 + Macrophages (CD80 is a co-stimulatory molecule highly expressed by M1 macrophages and a specific marker of M1 macrophages) in F4 / 80 + The proportion of macrophages (F4 / 80 is a surface glycoprotein widely used to mark mouse macrophages and a specific cell marker for mature mouse macrophages) (see Figure 2 C and 2D), reducing CD206 + Macrophages (CD206 is a highly specific marker of M2 macrophages) in F4 / 80 + The proportion of macrophages (see Figure 2 E). RNA-seq revealed that CWBR-CP could upregulate the expression of 2376 genes and downregulate the expression of 2766 genes (see Figure 2 F), in which the expression of M1 macrophage polarization marker genes such as IL1β, IL6, NOS2, CCL2, and CD86 increased significantly, while the expression of M2 macrophage polarization marker genes such as Mrc1, SPP1, and CD163 decreased significantly (see Figure 2 G), KEGG signaling pathway enrichment analysis showed that CWBR-CP protein can significantly disturb TNF, PI3K-AKT and other signaling pathways (see Figure 2 H).

[0047] M1 macrophages secrete proinflammatory cytokines and chemokines, present antigens, and thus participate in active immune responses. They function as immune surveillance cells and can directly kill or inhibit tumor cell growth. M2 macrophages primarily secrete anti-inflammatory cytokines, which reduce inflammation, promote tumor growth, and have immunosuppressive functions. These results suggest that CWBR-CP may significantly promote the polarization of BMDM into M1 macrophages and inhibit the polarization of BMDM into M2 macrophages through signaling pathways such as TNF and PI3K-AKT, thereby enhancing the killing of tumor cells and exerting a tumor suppressor effect.

[0048] The primer sequences used for the above RT-qPCR detection of TNFα, IL1β, IL6 and SPP1 are shown in Table 1.

[0049] Table 1 Primer sequences used for RT-qPCR detection of TNFα, IL1β, IL6 and SPP1

[0050]

[0051]

[0052] m: mouse primers, used for BMDMs; h: human primers, used for THP-1.

[0053] Example 3 Evaluation of the inhibitory effect of protein CWBR-CP on CRC progression

[0054] Six-week-old C57BL / 6J mice were randomly divided into a control group and a CWBR-CP-treated group (15 mice per group). Each mouse received a single intraperitoneal injection of azomethane (AOM, 10 mg / kg), which effectively induces colon cancer in experimental animals. After one week of normal drinking water, the mice were fed with DSS-fed drinking water (dextrose sodium sulfate drinking water, 20 g / L) for 7 days and then returned to normal drinking water for 14 days. Three cycles of DSS-fed drinking water (7 days) followed by normal drinking water (14 days) were repeated to establish a CAC mouse model. During this period, the control mice and CWBR-CP-treated mice were gavaged daily with 100 μL of PBS and 100 μL of CWBR-CP (10 μg / mL), respectively. Body weight, stool characteristics, and bloody stools were observed daily. The average of the three scores was used to represent the disease activity index (see Table 1 for scoring criteria). At the end of the experiment, the mice were dissected to measure spleen weight, number of colon tumors, and colon tumor weight. Quantification of CD80 in mouse spleen by flow cytometry and cell markers + Macrophages, F4 / 80 + Macrophages, CD80 + CD86 + Macrophages (CD86 is a marker of M1 macrophages, CD80 + CD86 + Macrophages indicate that both CD80 and CD86 are detected on the cell surface) and CD11b + f / 4 / 80 + Macrophages (CD11b is a specific cell marker of mouse myeloid cells, CD11b + f / 4 / 80 + Macrophage indicates that the cell is a macrophage).

[0055] The experimental results are as follows Figure 3 As shown in the results, the experimental results showed that CWBR-CP protein could inhibit the weight loss of mice, reduce the disease activity index, spleen weight, tumor number and size; FCM detection showed that CWBR-CP protein could significantly increase the CD80 + Macrophage ratio and CD80 + CD86+ The results indicate that CWBR-CP protein can promote the polarization of M1 macrophages and inhibit the progression of CRC.

[0056] Table 2 Disease Activity Index (DAI) scores of mice

[0057]

[0058]

[0059] The present invention provides a method for using bacterial proteins in the preparation of drugs for inhibiting colorectal cancer. Numerous methods and approaches exist for implementing this technical solution. The foregoing merely represents a preferred embodiment of the present invention. It should be noted that those skilled in the art may make various improvements and modifications without departing from the principles of the present invention, and such improvements and modifications are also within the scope of protection of the present invention. Any components not specified in this embodiment may be implemented using existing technologies.

Claims

1. Use of a bacterial protein in the preparation of a drug for inhibiting colorectal cancer, wherein: The bacterial protein is the CWBR-CP protein derived from Hungatella hathewayi, and its amino acid sequence is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The nucleotide sequence of the gene encoding the CWBR-CP protein is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The bacterial protein is prepared according to the following method: constructing a recombinant bacterium containing a CWBR-CP protein encoding gene, expressing the CWBR-CP protein, and then extracting it.

4. The use according to claim 3, characterized in that The plasmid used in the construction of the recombinant bacteria containing the CWBR-CP protein encoding gene was pET-26b(+), and the host bacteria used was Escherichia coli.

5. The use according to claim 3, characterized in that The expression is induced expression, and the inducer used is IPTG.

6. The use according to claim 3, characterized in that The extraction method comprises the following steps: utilizing lysozyme to break the cell wall, ultrasonically crushing, solid-liquid separation, collecting liquid, and performing protein purification column chromatography to obtain the CWBR-CP protein.

7. The use according to claim 6, characterized in that The added amount of the lysozyme is 20-50 kU / g of bacteria.

8. The use according to claim 6, characterized in that Before the column chromatography, the collected liquid is subjected to membrane filtration, and the filtrate is subjected to the protein purification column chromatography.

9. The use according to claim 6, characterized in that The resin used in the protein purification column chromatography is a His-tagged protein agarose purification resin, and the eluent used is an imidazole aqueous solution.

10. The use according to claim 1, characterized in that The bacterial protein exerts its anti-cancer effect by promoting the polarization of macrophages to M1 macrophages and inhibiting the polarization of macrophages to M2 macrophages.

Images