Preparation method and application of hepatitis B vaccine adjuvant containing GV657-ALKBH5 mixture

Abstract

The invention is suitable for the technical field of biological cells, and provides a preparation method and application of a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture. According to the invention, the GV657 plasmid carrying ALKBH5 is transfected into the dendritic cells, so that the antigen presentation phenotype of the dendritic cells can be effectively improved, and the activation of CD4 + T cells is promoted; the plasmid and the hepatitis B vaccine are sequentially added into the dendritic cell, so that the immune response of the dendritic cell to the hepatitis B vaccine can be effectively improved, and the dendritic cell is added into a CD4 + T cell, so that the activation of the CD4 + T cell can be effectively induced; in the environment of giving HBV stimulation in advance, the GV657-ALKBH5 can obviously improve the immune response of dendritic cells and CD4 + T cells to the hepatitis B vaccine.

Description

Technical Field

[0001] The present invention relates to the field of biological cell technology, and in particular to a preparation method and application of a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture. Background Art

[0002] Hepatitis B vaccine and high-titer immunoglobulin (HBIG) are currently recognized as effective measures for preventing mother-to-child transmission of HBV. my country included hepatitis B vaccine in its immunization program in 2002, and while this has yielded remarkable results, nearly 30% of children under five years old still lack the protective antibody, hepatitis B surface antibody (anti-HBs), placing them at high risk for HBV infection. According to a report by the Polaris Observatory Collaborators, the number of HBV infections in my country reached 79.74 million in 2022. This is undoubtedly closely related to the lack of hepatitis B vaccine response (protective antibody anti-HBs <10 mIU / ml) and the rapid decline of anti-HBs in infants of HBV-infected mothers.

[0003] Among infants born to HBV-infected mothers in my country, the non-response rate to hepatitis B vaccine at seven months of age is as high as 1.5%-7.4%. A multicenter prospective cohort study in my country showed that anti-HBs levels in infants born to HBV-infected mothers declined rapidly, with the geometric mean concentration of anti-HBs dropping sharply from 663.28 mIU / ml at seven months to 216.14 mIU / ml at one year of age. At two years of age, it fell below the upper limit of a weak response (100 mIU / ml) to 27.76 mIU / ml, remaining at three and five years of age. Among infants born at seven months of age with a weak response, the HBsAg and / or HBV DNA positivity rate was as high as 5.26% at two to five years of age. 90% of children infected with HBV in their first year of life and 25%-30% of children infected under five years of age will become chronic carriers of hepatitis B, respectively. Improving the immune response to hepatitis B vaccination and reducing HBV susceptibility in this special population is crucial for ultimately achieving the WHO's 2030 goal of global hepatitis B elimination.

[0004] The response to hepatitis B vaccine requires the participation of multiple immune cells. Among them, activation of CD4+ T cells by DCs (dendritic cells) is a key driver of the generation and maintenance of anti-HBs resistance. The DC antigen presentation phenotype and its ability to activate CD4+ T cells may be linked to abnormal expression of molecules involved in transcriptional regulatory networks, metabolic microenvironment, and RNA modification. Increasing evidence suggests that m6A regulators, molecules involved in RNA m6A modification, may represent novel immune system regulators. m6A regulators include methyltransferases, demethyltransferases, and reader proteins. ALKBH5, a member of the ALKB family, is considered a key m6A demethyltransferase. Although there are no reports of HBV affecting DC ALKBH5, research teams have explored the relationship between HBV and ALKBH5 and found that ALKBH5 plays a key role in regulating HBV gene expression in hepatocytes under hypoxic conditions and promotes immune evasion during HBV infection. Although the relationship between ALKBH5 and vaccine response has not been reported, ALKBH5 has been found to regulate the immune infiltration of DCs and macrophages in antigen-presenting cells, participate in the immune infiltration of T cells and play an important role in the immune microenvironment.

[0005] In summary, the present invention intends to prepare a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture and analyze its immune effect under in vitro HBV pre-exposure, which is expected to provide new ideas for improving the hepatitis B vaccine response of infants of HBV-infected mothers. Summary of the Invention

[0006] The purpose of the present invention is to solve the above problems and to propose a preparation method and application of a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions: A method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture, characterized by comprising the following steps: 1) Preparation of the first mixed solution: On day 1, HBV concentrate was added to the HBV + HBV vaccine group, the HBV + mock + HBV vaccine group, the HBV + GV657-NC + HBV vaccine group, and the HBV + GV657-ALKBH5 + HBV vaccine group, prestimulating for 54 hours. 2) Preparation of the second mixed solution: On day 3, transfection reagent, transfection reagent + GV657-NC mixture, and transfection reagent + GV657-ALKBH5 mixture were added to the HBV + mock + HBV vaccine group, the HBV + GV657-NC + HBV vaccine group, and the HBV + GV657-ALKBH5 + HBV vaccine group, respectively, for 6 hours. 3) Preparation of the third mixed solution: On day 3+6, collect the three groups of cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, replace with fresh complete medium containing the inducer, and incubate for 18 hours; 4) Preparation of the fourth mixture: On day 4, add the hepatitis B vaccine to the three groups of cells and incubate for 24 hours; 5) Preparation of the fifth mixture: On day 4, isolate PBMCs, sort CD4+ T cells, and culture for 12 hours; 6) Preparation of the sixth mixed solution: On day 5, collect 3.5 ml of cell suspension from each replicate flask in each of the three groups and test relevant indicators. The remaining 0.5 ml of cell suspension is co-cultured with CD4+ T cells. On day 8, the proliferation and activation of CD4+ T cells in the co-culture system are tested.

[0008] Preferably, the HBV type added in step 1) is type D, and the DNA loading capacity of the HBV concentrate is 4.25×10 6 IU / ml, the volume was 210ul, and the density of dendritic cells was 0.6×10 6 Each group had 3 replicate bottles, with 4 ml of cells in each replicate bottle.

[0009] Preferably, the transfection reagent added in step 2) is prepared from lip3000, Opti-MEM Medium and P3000™ Reagent in a volume ratio of 41.67:1.25:1, the concentrations of GV657-NC and GV657-ALKBH5 are 100 ng / μl, the added transfection reagent + GV657-NC mixture is prepared from lip3000, GV657-NC, Opti-MEM Medium and P3000™ Reagent in a volume ratio of 41.67:20.67:1.25:1, and the added transfection reagent + GV657-ALKBH5 mixture is prepared from lip3000, GV657-ALKBH5, Opti-MEM Medium and P3000TM Reagent in a volume ratio of 41.67:20.67:1.25:1.

[0010] Preferably, the complete medium containing the inducer added in step 3) comprises rhGM-CSF and rhIL-4, with the added amounts being 315 ng and 67.5 ng respectively, and the complete medium is composed of triple antibodies, fetal bovine serum and 1640 medium in a volume ratio of 1:10:89.

[0011] Preferably, the dose of hepatitis B vaccine added in step 4) is 4 μg, corresponding to a volume of 66.67 μl.

[0012] Preferably, the density of CD4+ T cells in step 5) is 1×106 / ml, with a purity of 98.76%.

[0013] Preferably, the concentration of dendritic cells used in step 6) is 0.02×10 6 / ml, the concentration of CD4+ T cells was 0.2×10 6 The cell number ratio of the two is 1:10.

[0014] Preferably, a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture is prepared by the above steps.

[0015] Preferably, a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture is used.

[0016] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are: 1. In the present invention, compared with adding hepatitis B vaccine after HBV pre-stimulation, the additional addition of the mixture on the third day can effectively improve the expression of transcription factor NF-κB in dendritic cells.

[0017] 2. In the present application, in the present invention, compared with adding hepatitis B vaccine after HBV pre-stimulation, the additional addition of the mixture on the third day can effectively improve the antigen presentation phenotype of dendritic cells.

[0018] 3. In the present invention, compared with adding hepatitis B vaccine after HBV pre-stimulation, the mixture is additionally added to dendritic cells on the third day and co-cultured with CD4+ T cells, which can effectively improve the activation state of CD4+ T cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The effect of overexpressing ALKBH5 on dendritic cells by GV657-ALKBH5 is shown in the present invention; Figure 2 The figure shows the differences in the expression of NF-κB and dendritic cell antigen presenting molecules between the GV657-NC group and the GV657-ALKBH5 group in the present invention.

[0020] Figure 3 The figure shows the difference in expression of activation molecules of CD4+ T cells between the GV657-NC group and the GV657-ALKBH5 group in the present invention. DETAILED DESCRIPTION

[0021] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0022] See also Figure 1-3 , the present invention provides a technical solution: A method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture, characterized by comprising the following steps: 1) Preparation of the first mixed solution: On day 1, HBV concentrate was added to the HBV + HBV vaccine group, the HBV + mock + HBV vaccine group, the HBV + GV657-NC + HBV vaccine group, and the HBV + GV657-ALKBH5 + HBV vaccine group, prestimulating for 54 hours. 2) Preparation of the second mixed solution: On day 3, transfection reagent, transfection reagent + GV657-NC mixture, and transfection reagent + GV657-ALKBH5 mixture were added to the HBV + mock + HBV vaccine group, the HBV + GV657-NC + HBV vaccine group, and the HBV + GV657-ALKBH5 + HBV vaccine group, respectively, for 6 hours. 3) Preparation of the third mixed solution: On day 3+6, collect the three groups of cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, replace with fresh complete medium containing the inducer, and incubate for 18 hours; 4) Preparation of the fourth mixture: On day 4, add the hepatitis B vaccine to the three groups of cells and incubate for 24 hours; 5) Preparation of the fifth mixture: On day 4, isolate PBMCs, sort CD4+ T cells, and culture for 12 hours; 6) Preparation of the sixth mixed solution: On day 5, collect 3.5 ml of cell suspension from each replicate flask in each of the three groups and test relevant indicators. The remaining 0.5 ml of cell suspension is co-cultured with CD4+ T cells. On day 8, the proliferation and activation of CD4+ T cells in the co-culture system are tested.

[0023] Specifically, the HBV type added in step 1) is type D, and the DNA loading capacity of the HBV concentrate is 4.25×10 6 IU / ml, the volume was 210ul, and the density of dendritic cells was 0.6×10 6 Each group had 3 replicate bottles, with 4 ml of cells in each replicate bottle.

[0024] Specifically, the transfection reagent added in step 2) is prepared by lip3000, Opti-MEM Medium and P3000™ Reagent in a volume ratio of 41.67:1.25:1, the concentrations of GV657-NC and GV657-ALKBH5 are 100 ng / μl, the added transfection reagent + GV657-NC mixture is prepared by lip3000, GV657-NC, Opti-MEM Medium and P3000™ Reagent in a volume ratio of 41.67:20.67:1.25:1, and the added transfection reagent + GV657-ALKBH5 mixture is prepared by lip3000, GV657-ALKBH5, Opti-MEM Medium and P3000™ Reagent in a volume ratio of 41.67:20.67:1.25:1.

[0025] Specifically, the complete medium containing inducers added in step 3) comprises rhGM-CSF and rhIL-4, with the added amounts being 315 ng and 67.5 ng, respectively. The complete medium comprises triple antibodies, fetal bovine serum, and 1640 medium in a volume ratio of 1:10:89.

[0026] Specifically, the dose of hepatitis B vaccine added in step 4) is 4 μg, corresponding to a volume of 66.67 μl.

[0027] Specifically, the density of CD4+ T cells in step 5) is 1×10 6 / ml, with a purity of 98.76%.

[0028] Specifically, the concentration of dendritic cells used in step 6) is 0.02×10 6 / ml, the concentration of CD4+ T cells was 0.2×10 6 The cell number ratio of the two is 1:10.

[0029] The present invention is a method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture, and relates to its effect of improving immune response. Preparation step 1) The added HBV type is required to be type D, and the DNA loading capacity of the HBV concentrate is 4.25×10 6 IU / ml, the volume was 210ul, and the density of dendritic cells was 0.6×10 6, the volume is 3 ml, 3 replicate bottles are set up for each group, and 4 ml of cells are placed in each replicate bottle. Preparation step 2) requires that the added transfection reagent be prepared from lip3000, Opti-MEM Medium, and P3000TM Reagent in a volume ratio of 41.67:1.25:1, and the concentrations of GV657-NC and GV657-ALKBH5 are 100 ng / μl. The added transfection reagent + GV657-NC mixture is prepared from lip3000, GV657-NC, Opti-MEM Medium, and P3000TM Reagent in a volume ratio of 41.67:20.67:1.25:1, and the added transfection reagent + GV657-ALKBH5 mixture is prepared from lip3000, GV657-ALKBH5, Opti-MEM Medium, and P3000TM Reagent, with a volume ratio of 41.67:20.67:1.25:1. Preparation step 3) requires the addition of complete medium containing inducers, wherein the added inducing reagents are rhGM-CSF and rhIL-4, with the addition amounts being 315ng and 67.5ng respectively. The complete medium is composed of triple antibodies, fetal bovine serum and 1640 medium, with a volume ratio of 1:10:89. Preparation step 4) requires the addition of 4ug of hepatitis B vaccine, corresponding to a volume of 66.67ul. WB detection showed that the NF-κB protein level in the HBV+GV657-ALKBH5+hepatitis B vaccine group was significantly increased. Flow cytometry detection showed that the HLA-DR and CD86 protein levels in the HBV+GV657-ALKBH5+hepatitis B vaccine group were significantly increased. RT-qPCR detection showed that the IL12A The mRNA level was significantly increased. Preparation step 5) requires a density of CD4+ T cells of 1×10 6 cells / ml, with a purity of 98.76%. The concentration of dendritic cells used in step 6) is required to be 0.02×10 6 / ml, the concentration of CD4+ T cells was 0.2×10 6 The cell number of the two groups was 1:10. Flow cytometry analysis showed that the CD40L and ICOS levels in the HBV+GV657-ALKBH5+hepatitis B vaccine group were significantly increased.

[0030] The specific experimental plan is: 1. Experimental Grouping: There were 3 groups, 3 replicates per group. The intervention, detection, and co-culture times for each group were as follows: Table 1 Intervention and cell collection time in each group

[0031] 2. Detection method: 1. ALKBH5 protein level detection: Western blotting (WB) (1) Protein extraction: Protein was extracted from cells according to the instructions of RIPA lysis buffer (Severn Innovation).

[0032] (2) Protein concentration detection: Detect protein concentration according to the instructions of the BCA protein concentration detection kit (Biyuntian).

[0033] (3) Gel preparation: Prepare gel according to the instructions of Easy PAGER Color Rapid Gel Preparation Kit (10%) (Seven Innovations).

[0034] (4) Sample loading and electrophoresis: 80V 10min→120V min.

[0035] (5) Transfer: current 200mAV for 1.5h.

[0036] (6) Wash the membrane: shake on a shaker at 90 r / min for 5 minutes, repeat 3 times.

[0037] (7) Blocking: Prepare blocking solution with 20 ml TBST + 1 g milk powder → Place the PVDF membrane in it and shake on a shaker at 90 rpm for 90 minutes.

[0038] (8) Antibody incubation: Anti-ALKBH5 antibody [EPR18958] (abcam) primary antibody diluted 1:5000, Anti-GAPDH Recombinant Rabbit (Hua'an Bio) primary antibody diluted 1:20000, HRP*Goat Anti Rabbit IgG (H+L) (immunoway) secondary antibody diluted 1:5000. Add primary antibody, incubate overnight at 4°C → wash membrane → add secondary antibody → incubate on a shaker at 80 rpm for 60 min.

[0039] (9) Development: Development was performed according to the instructions of the Super ECL Prime ultrasensitive ECL chemiluminescence kit (Seven Innovations).

[0040] 2. Detection of relative expression of ALKBH5 and NF-κB mRNA: reverse transcription quantitative polymerase chain reaction (RT-qPCR).

[0041] (1) RT-qPCR principle: base complementary pairing.

[0042] (2) Instruments and reagents used for RT-qPCR: Gene thermal cycler (Hangzhou Bioray), Mx3005P fluorescence quantitative PCR instrument (Bio-Rad); RNA extraction kit (M5total RNA Extraction Reagent), Takara reverse transcription kit [Takara, RR036A, PrimeScript™ RT Master Mix (Perfect Real Time), 200 Rxns], Takara qPCR kit [Takara, RR820A, TB Green® Premix Ex Taq™ II (Tli RNaseH Plus), 200 Rxns].

[0043] (3) RT-qPCR steps: ① Extract RNA: Collect cells from each group and extract total RNA from the cells according to the instructions of the RNA extraction kit; ② Reverse transcription: Using total RNA as a template, set up the reaction system according to the instructions of the reverse transcription kit. Set the reaction conditions of the gene thermal cycler to 37°C for 15 minutes (reverse transcription reaction) → 85°C for 5 seconds (reverse transcriptase inactivation reaction) → 4°C to reverse transcribe RNA into cDNA; ③ Primer sequence: name sequence h-NF-κB subunit NFKB1 (p50)-F TGGGAAGGCCTGAACAAATG h-NF-κB subunit NFKB1 (p50)-R GGTATGGGCCATCTGCTGTT h-ALKBH5-1-F TGAGCACAGTCACGCTTCCC h-ALKBH5-1-R TCCGTGTCCTTCTTTAGCGACTC h-β-actin-F TGGCACCCAGCACAATGAA h-β-actin-R CTAAGTCATAGTCCGCCTAGAAGCA ④ Reaction system: Set up the system according to the instructions of the fluorescent quantitative PCR kit.

[0044] ⑤ Reaction conditions: Set the reaction conditions of the Mx3005P fluorescence quantitative PCR instrument to: Step 1: 95℃ 30s; Step2: 95℃ 5s, 60℃ 30s, 39cycles; Step 3: Melt Curve; ⑥Data acquisition and analysis: The C(t) values of each sample were normalized with the internal reference gene β-actin, and the relative expression level of ALKBH5 mRNA was calculated based on 2-△△C(t) using EXCEL software. Statistical analysis was performed using R software.

[0045] 3. Detection of protein levels of dendritic cell antigen-presenting molecules HLA-DR and CD86: flow cytometry (FCM).

[0046] (1) FCM principle: specific binding of antigen and antibody.

[0047] (2) Instruments and reagents used for FCM: CytoFlex flow cytometer (Beckman); HLA-DR antibody (HLA-DR Monoclonal Antibody-PerCP-Cyanine5.5, Bdbiosciences); CD86 antibody (Mouse Anti-Human CD86-FITC, Bdbiosciences).

[0048] (3) FCM steps: ① Collect cells: Collect cells from each group into 1.5 ml tubes, label the group and the molecule to be detected, centrifuge at 1200 rpm for 5 minutes, discard the supernatant, and leave 100 μl of cell suspension; ② Antibody incubation: Add 2µl CD86 antibody to the "CD86" tube and 2µl HLA-DR antibody to the "HLA-DR" tube, and incubate at 4°C in the dark for 15 minutes; ③ Wash cells: add 1 ml of 4°C pre-cooled PBS to each tube, centrifuge at 1200 rpm for 5 minutes, and discard the supernatant; ④ Resuspend and load onto the flow cytometer: Add 200µl of 4℃ pre-cooled PBS to each tube, transfer to each tube, and load onto the flow cytometer.

[0049] ⑤Data acquisition: CytExpert software was used to set gates and export flow cytometry molecular expression percentage data (Excel format).

[0050] ⑥Data analysis: R software was used for statistical analysis.

[0051] 3. Product identification data: (1) As Figure 1 Shown: Effect of overexpressing ALKBH5 by GV657-ALKBH5 on dendritic cells; (2) If Figure 2 Shown: Differences in the expression of NF-κB and dendritic cell antigen-presenting molecules between the GV657-NC group and the GV657-ALKBH5 group.

[0052] (3) If Figure 3 Shown: Differences in the expression of activation molecules in CD4+ T cells between the GV657-NC group and the GV657-ALKBH5 group.

[0053] 4. Number of effects: (I) Effect of overexpressing ALKBH5 with GV657-ALKBH5: There was no significant difference in ALKBH5 mRNA expression between the Mock group and the GV657-NC group, and ALKBH5 protein expression in the GV657-NC group was not higher than that in the Mock group, indicating that the empty vector GV657-NC does not have the property of increasing ALKBH5. The ALKBH5 mRNA and protein levels in the GV657-ALKBH5 group were significantly higher than those in the GV657-NC group (P < 0.05), indicating that GV657-ALKBH5 has the property of overexpressing ALKBH5 on dendritic cells, and the overexpression of ALKBH5 is more effective. Figure 1 .

[0054] (II) Effect of GV657-ALKBH5 on the expression of transcription factor NF-κB and antigen-presenting molecules on dendritic cells: The mRNA and protein levels of transcription factor NF-κB, and the protein levels of antigen-presenting molecules HLA-DR and CD86 on dendritic cells in the GV657-ALKBH5 group were higher than those in the GV657-NC group (P < 0.05), indicating that GV657-ALKBH5 can increase the expression of NF-κB and antigen-presenting molecules on dendritic cells. Figure 2 .

[0055] (III) Expression of CD4+ T cell activation molecules in the GV657-NC group and the GV657-ALKBH5 group After dendritic cells were co-cultured with CD4+ T cells, the levels of CD40L and ICOS proteins, the CD4+ T cell activation molecules, in the GV657-NC group were significantly higher than those in the GV657-ALKBH5 group (P < 0.05), indicating that GV657-ALKBH5 can promote the activation of CD4+ T cells by dendritic cells. Figure 3 .

[0056] The above description of the embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture, characterized in that: The following steps are involved: 1) Preparation of the first mixed solution: On day 1, HBV concentrate was added to the HBV + HBV vaccine group, the HBV + mock + HBV vaccine group, the HBV + GV657-NC + HBV vaccine group, and the HBV + GV657-ALKBH5 + HBV vaccine group, prestimulating for 54 hours. 2) Preparation of the second mixed solution: On day 3, transfection reagent, transfection reagent + GV657-NC mixture, and transfection reagent + GV657-ALKBH5 mixture were added to the HBV + mock + HBV vaccine group, the HBV + GV657-NC + HBV vaccine group, and the HBV + GV657-ALKBH5 + HBV vaccine group, respectively, for 6 hours. 3) Preparation of the third mixed solution: On day 3+6, collect the three groups of cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, replace with fresh complete medium containing the inducer, and incubate for 18 hours; 4) Preparation of the fourth mixture: On day 4, add the hepatitis B vaccine to the three groups of cells and incubate for 24 hours; 5) Preparation of the fifth mixture: On day 4, isolate PBMCs, sort CD4+ T cells, and culture for 12 hours; 6) Preparation of the sixth mixed solution: On day 5, collect 3.5 ml of cell suspension from each replicate flask in each of the three groups and test relevant indicators. The remaining 0.5 ml of cell suspension is co-cultured with CD4+ T cells. On day 8, the proliferation and activation of CD4+ T cells in the co-culture system are tested.

2. The method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture according to claim 1, characterized in that: The HBV type added in step 1) was D type, and the DNA loading capacity of the HBV concentrate was 4.25×10 6 IU / ml, the volume was 210ul, and the density of dendritic cells was 0.6×10 6 Each group had 3 replicate bottles, with 4 ml of cells in each replicate bottle.

3. The method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture according to claim 1, characterized in that: The transfection reagent added in step 2) was prepared from lip3000, Opti-MEM Medium, and P3000™ Reagent in a volume ratio of 41.67:1.25:

1. The concentrations of GV657-NC and GV657-ALKBH5 were 100 ng / μl. The added transfection reagent + GV657-NC mixture was prepared from lip3000, GV657-NC, Opti-MEM Medium, and P3000™ Reagent in a volume ratio of 41.67:20.67:1.25:

1. The added transfection reagent + GV657-ALKBH5 mixture was prepared from lip3000, GV657-ALKBH5, Opti-MEM Medium, and P3000™ Reagent in a volume ratio of 41.67:20.67:1.25:

1.

4. The method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture according to claim 1, characterized in that: In step 3), the complete medium containing inducers is added, wherein the added inducing reagents are rhGM-CSF and rhIL-4, and the added amounts are 315 ng and 67.5 ng, respectively. The complete medium consists of three antibodies, fetal bovine serum and 1640 medium, and the volume ratio is 1:10:

89.

5. The method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture according to claim 1, characterized in that: The dose of hepatitis B vaccine added in step 4) is 4 μg, corresponding to a volume of 66.67 μl.

6. The method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture according to claim 1, characterized in that: The density of CD4+ T cells in step 5) is 1×10 6 / ml, with a purity of 98.76%.

7. The method for preparing a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture according to claim 1, characterized in that: The concentration of dendritic cells used in step 6) was 0.02×10 6 / ml, the concentration of CD4+ T cells was 0.2×10 6 The cell number ratio of the two is 1:

10.

8. A hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture, characterized in that: It is prepared by the preparation method according to any one of claims 1 to 7.

9. Use of a hepatitis B vaccine adjuvant containing a GV657-ALKBH5 mixture according to claim 8.

Images