The ferroptosis inducer is used for preparing a therapeutic t (4; application of (14) positive multiple myeloma medicine

Through the combination of CD38 monoclonal antibody Daratumumab and RSL3, targeting GPX4, the drug resistance and apoptosis dependence problems of existing treatments of t(4; 14) translocation-positive multiple myeloma were solved, and efficient apoptosis and ferrode death were achieved, providing a new treatment plan.

CN120478618APending Publication Date: 2025-08-15TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510671969.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

Existing treatment methods are difficult to effectively treat t(4; 14) translocation-positive multiple myeloma. Existing drugs such as CD38 monoclonal antibody may lead to drug resistance and lack of efficient selective inhibitors. The existing treatment methods mainly rely on apoptosis pathways and cannot completely solve high-risk outcomes.

Method used

CD38 monoclonal antibody Daratumumab combined with the ferrody death inducer RSL3 targets GPX4, induces apoptosis and ferrody death in t(4; 14) positive multiple myeloma cells. By combining RSL3 and CD38 monoclonal antibody, the killing effect on t(4; 14) positive MM cells is enhanced.

Benefits of technology

It significantly improved the apoptosis and ferrodynamic levels of t(4; 14) positive multiple myeloma cells, provided a new treatment strategy, enhanced the treatment effect on high-risk myeloma patients, and had potential commercial value and clinical application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120478618A_ABST
    Figure CN120478618A_ABST
Patent Text Reader

Abstract

The invention belongs to but is not limited to the technical field of biological medicines, and discloses application of a ferroptosis inducer in preparation of a medicine for treating t (4; 14) application in a positive multiple myeloma medicine; the combination of the CD38 monoclonal antibody and the RSL3 is at t (4; 14) a synergistic effect in positive multiple myeloma cells; the action target of the combination of the CD38 monoclonal antibody and the RSL3 medicine is GPX4. The CD38 monoclonal antibody is combined with RSL3 to induce t (4; and 14) positive multiple myeloma cell apoptosis. The CD38 monoclonal antibody is combined with RSL3 to induce t (4; and 14) positive multiple myeloma cell ferroptosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to but is not limited to the field of biomedicine technology, and in particular relates to the use of a ferroptosis inducer in the preparation of a drug for treating t(4;14)-positive multiple myeloma. Background Art

[0002] Multiple myeloma (MM) is a malignant tumor that originates from plasma cells in the bone marrow and is the second most common malignant tumor of the blood system. MM primarily affects the elderly, is common in people over 60 years old, and is slightly more common in men than in women. MM develops due to the unlimited proliferation of abnormal plasma cells (myeloma cells) in the bone marrow, leading to impaired normal hematopoietic and immune functions and triggering a series of clinical manifestations, including osteolytic lesions, hypercalcemia, anemia, and kidney damage. The pathogenesis of MM is complex, involving multiple factors such as genetic abnormalities, microenvironmental changes, and immune disorders.

[0003] In recent years, significant progress has been made in the treatment of MM. The application of new drugs and combination therapies has greatly improved the survival and quality of life of patients. Treatment strategies are individualized according to the patient's age, comorbidities, genetic risk stratification, and disease stage (new diagnosis, relapsed / refractory). However, MM is still incurable, and some patients who have received standard treatment still face adverse outcomes of drug resistance and relapse, especially those with high-risk genetic abnormalities such as t(4;14) translocation-positive MM. Therefore, challenges and difficulties in MM treatment still exist. For patients with t(4;14) translocation-positive MM who are difficult to treat with approved clinical drugs, there is still a need to develop new treatments that are highly effective and have different mechanisms of action. Combining new therapies with different mechanisms of action with existing immunotherapy drugs may be of great significance in overcoming the poor prognosis of patients with t(4;14) translocation-positive MM.

[0004] Ferroptosis is an oxidative death process caused by the disruption of the intracellular reduction system or redox balance due to environmental stimulation or drug intervention, resulting in the accumulation of large amounts of lipid peroxidation that depends on iron ions. Research has identified it as a new type of regulated cell death. Researchers collectively refer to all drugs that can induce ferroptosis in cells as ferroptosis inducers, including screened new small molecule compounds, natural products, and clinically used drugs such as artemisinin, sorafenib, and cisplatin. Ferroptosis inducers can be further divided into multiple types based on the drug's target. Type II ferroptosis inducers, such as RSL3, induce cells to undergo ferroptosis by directly inhibiting the activity of glutathione peroxidase 4 (GPX4), a downstream target of the cellular reduction system. Studies have shown that RSL3 can resensitize a variety of tumor cells to chemotherapeutic drugs, and its combination with radiotherapy, photothermal therapy, and other treatments can significantly improve the efficacy of anti-tumor therapy.

[0005] CD38 monoclonal antibodies exert their therapeutic effects synergistically through multiple mechanisms, including direct killing of myeloma cells, immune regulation, and influence on cell signaling pathways. Whether used as a single agent or in combination with other drugs, CD38 monoclonal antibodies can significantly improve the remission rate of patients with multiple myeloma. However, long-term use of CD38 monoclonal antibodies may lead to the development of drug resistance in tumor cells, reducing the therapeutic effect. This resistance mechanism may be related to multiple factors, including downregulation of CD38 expression on the tumor cell surface, antigen escape, changes in the tumor microenvironment, and activation of intracellular signaling pathways.

[0006] In view of the above analysis, the technical problems that need to be solved urgently in the existing technology are:

[0007] To investigate the sensitivity of t(4;14) translocation-positive MM cells to the ferroptosis inducer RSL3, as well as the therapeutic effect and target of RSL3 combined with CD38 monoclonal antibody on t(4;14)-positive MM cells. Summary of the Invention

[0008] In response to the problems existing in the prior art, the present invention provides the use of CD38 monoclonal antibody Daratumumab combined with ferroptosis inducer RSL3 in the preparation of a drug for treating t(4;14)-positive multiple myeloma (MM).

[0009] The present invention is achieved by using CD38 monoclonal antibody in combination with RSL3 in the preparation of a drug for treating t(4;14)-positive multiple myeloma.

[0010] Furthermore, CD38 monoclonal antibody combined with RSL3 had a synergistic effect in t(4;14)-positive multiple myeloma cells.

[0011] Furthermore, the target of the combination of CD38 monoclonal antibody and RSL3 drug is GPX4.

[0012] Furthermore, CD38 monoclonal antibody combined with RSL3 induced apoptosis of t(4;14)-positive multiple myeloma cells.

[0013] Furthermore, CD38 monoclonal antibody combined with RSL3 induced ferroptosis in t(4;14)-positive multiple myeloma cells.

[0014] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0015] MM has a complex genetic background, and disease progression or treatment is often accompanied by the evolution of subclonal populations. This is a major factor contributing to the high heterogeneity and incurability of MM and is also a key factor affecting the prognosis of MM patients. Among them, chromosome t(4;14) has a diagnostic rate of 10% to 15% in newly diagnosed MM patients, a higher incidence than other genetic abnormalities such as t(14;16) (2% to 4%) and t(6;14) (1%), and is an important marker for predicting a high-risk prognosis in MM patients. However, there is currently a lack of effective selective inhibitors for t(4;14). In addition, existing clinical treatments, such as proteasome inhibitors, can improve the survival of t(4;14)-positive patients in the short term, but they still cannot change the high-risk outcome they ultimately face. Since existing treatments mainly induce apoptosis in t(4;14)-positive MM cells, seeking a non-apoptotic pathway as a new approach to treat t(4;14)-positive patients may be of great significance. The present invention found that compared with t(4;14)-negative MM cells, t(4;14)-positive MM cells are more sensitive to the ferroptosis inducer RSL3. The combination of RSL3 and the CD38 monoclonal antibody Daratumumab in the treatment of t(4;14)-positive multiple myeloma cells has a synergistic effect, and its target is GPX4. Further experimental data showed that the combination of CD38 monoclonal antibody and RSL3 induced a further increase in the level of apoptosis in t(4;14)-positive multiple myeloma cells; at the same time, the combination of CD38 monoclonal antibody and RSL3 induced a further increase in the level of ferroptosis in t(4;14)-positive multiple myeloma cells.

[0016] The expected benefits and commercial value of the technical solution of this invention after transformation are as follows: If the ferroptosis inducer RSL3 is expected to enter clinical trials and be approved for clinical use, the combined treatment regimen developed by this invention is expected to quickly enter clinical use, and ferroptosis inducers are expected to have certain commercial value as new anti-tumor drugs. The combined treatment regimen developed by this invention for the targeted treatment of t(4;14)-positive multiple myeloma provides a new strategy for the treatment of high-risk myeloma patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a graph showing the results of RSL3 inhibiting the proliferation of t(4;14)-positive and -negative MM cells provided by an embodiment of the present invention.

[0018] Figure 2 This is a graph showing the inhibitory effect of the ferroptosis inducer RSL3 provided in an embodiment of the present invention in combination with the CD38 monoclonal antibody Daratumumab on t(4;14)-positive H-929 cells.

[0019] Figure 3 This is a graph showing the results of RSL3 combined with Daratumumab inducing apoptosis in H-929 cells provided in an embodiment of the present invention.

[0020] Figure 4 This is a graph showing the changes in the level of ferroptosis in H-929 cells induced by RSL3 combined with Daratumumab provided in an embodiment of the present invention.

[0021] Figure 5 This is a graph showing the changes in MDA levels in H-929 cells induced by RSL3 combined with Daratumumab provided in an embodiment of the present invention.

[0022] Figure 6 This is a graph showing the changes in PTGS2 mRNA levels in H-929 cells induced by RSL3 combined with Daratumumab, as provided in an embodiment of the present invention.

[0023] Figure 7 This is a graph showing changes in GPX4 protein levels in H-929 cells induced by RSL3 combined with Daratumumab, as provided in an embodiment of the present invention.

[0024] Figure 8 The present invention provides an embodiment of the effect of GPX4 on the killing of H-929 cells by RSL3 combined with Daratumumab. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0026] The embodiments of the present invention provide the use of CD38 monoclonal antibody combined with RSL3 in the preparation of a drug for treating t(4;14)-positive multiple myeloma.

[0027] Example 1

[0028] Activity detection and IC of RSL3 in MM cells 50 calculate

[0029] Three human t(4;14)-positive MM cell lines H-929, OPM-2, and KMS-11, and three human t(4;14)-negative MM cell lines U-266, MM1.S, and RPMI8226 were cultured at 1.5×10 5Cells were seeded into 96-well plates at a density of 100 μl / well at 100 cells / ml, and then different concentrations of RSL3 drugs (0, 0.05, 0.1, 0.5, 1, 5, and 10 μM) were added in sequence. The control group was treated with the corresponding solvent control. After 24 hours of treatment, 10 μl of CCK8 reagent was added to each well and incubated at 37°C for 4 hours. The final absorbance was measured at a wavelength of 450 nm using a microplate reader. The IC values of ferroptosis inducer RSL3 for t(4;14)-positive and negative MM cells were calculated using Prism 10.0. 50 Value. Figure 1 As shown in the figure, after adding RSL3 to MM cells, the proliferation rate of t(4;14)-positive MM cells decreased significantly, while the proliferation rate of t(4;14)-negative MM cells decreased relatively slowly, indicating that RSL3 strongly killed the proliferation activity of t(4;14)-positive MM cells.

[0030] Example 2

[0031] Activity detection of RSL3 combined with Dara in the treatment of H-929 cells and calculation of drug combination effect

[0032] The t(4;14)-positive H-929 cells in the logarithmic growth phase were collected and washed with 1× PBS solution (1500 rpm, centrifugation for 5 minutes) and the cells were collected and centrifuged at a rate of 1.5× 10 5 / ml cell density, the cells were evenly seeded in a 96-well plate (90μl / well), and RSL30.1, 0.2, 0.3, 0.4μmol / L, Daratumumab0.05, 0.1, 0.2, 0.3μg / mL were used to treat H-929 cells in a 1:1 combination according to the above concentrations, and 10μl of plasma extracted from human peripheral blood was added to each well simultaneously. The above two drugs were completely cross-combined and applied to H-929 cells at the above concentrations. After 48h of drug action, 10ul of CCK8 reagent was added to each well, incubated at 37℃ for 4 hours, and the final absorbance was measured at a wavelength of 450nm using an enzyme reader. Finally, the synergistic index of the two drugs was calculated using the synergistic index calculation software CompuSyn. Figure 2 As shown in Table 1, the combination of RSL3 and Daratumumab significantly enhanced the killing effect of both drugs on t(4;14)-positive MM cells, indicating that the combination of the two drugs has a good synergistic effect.

[0033] Table 1 Synergistic effect of CD38 monoclonal antibody combined with RSL3 in t(4;14)-positive H929 cells

[0034]

[0035] Example 3

[0036] Detection of apoptosis levels in MM cells

[0037] H929 cells in the logarithmic growth phase were collected and cultured at a rate of 2.5×10 5 / ml of cell density was seeded in a 6-well plate (1.8ml / well), cultured in an incubator overnight, and solvent control (appropriate amount of DMSO), 0.2μmol / LRSL3, 0.1μg / mL Daratumumab, and 0.2μmol / L RSL3+0.1μg / mL Daratumumab were added to the four groups of cells respectively; 200μl of plasma extracted from human peripheral blood was added to each well simultaneously. After 48h of drug treatment, the cells were collected and resuspended using 1x PBS solution twice (1500rpm, centrifugation for 5 minutes). 200μl was aspirated into the flow cytometry tube, 1μl of Caspase-3 substrate was added, and the substrate was immediately mixed to a final concentration of 5μM. Incubate at room temperature in the dark for 30 minutes, add 300μl of 1x PBS solution, and analyze by flow cytometry. Detect the green fluorescence channel (maximum excitation / emission wavelength: 500 / 530nm). As Figure 3 As shown in the data, after adding Daratumumab to t(4;14)-positive H-929 cells, the number of apoptotic H-929 cells increased by about 20%. After combined use with RSL3 drug, the number of apoptotic H-929 cells further increased by about 55%, indicating that RSL3 combined with Daratumumab induced apoptosis of t(4;14)-positive MM cells.

[0038] Example 4

[0039] Detection of lipid reactive oxygen species levels in MM cells

[0040] H929 cells in the logarithmic growth phase were collected and cultured at a rate of 2.5×10 5Cells were seeded at a density of 1.8 ml / well in a 6-well plate and cultured overnight in an incubator. Four groups of cells were treated with solvent (appropriate amount of DMSO), 0.2 μmol / L RSL3, 0.1 μg / mL Daratumumab, and 0.2 μmol / L RSL3 plus 0.1 μg / mL Daratumumab. Simultaneously, 200 μl of human peripheral blood plasma was added to each well. After 48 hours of drug treatment, cells were harvested and washed twice with 1x PBS (centrifuged at 1500 rpm for 5 minutes) to resuspend in 200 μl. An appropriate volume of DCFH-DA probe was added to a final concentration of 10 μmol / L. The cells were incubated in a dark incubator at 37°C for 20 minutes, inverting every 5 minutes to ensure thorough interaction of the probe with the cells. The cells were washed three times with 1x PBS (centrifuged at 1500 rpm for 5 minutes) to remove any unaffected DCFH-DA dye. Then add 500 μl 1x PBS solution and analyze by flow cytometry, select FL1 or BL1 channel, excite at 488 nm, and measure the emission signal at 530 nm. Please refer to FITC parameter settings. Figure 4 As shown in the results, after adding RSL3 to t(4;14)-positive H-929 cells, the number of H-929 cells that developed lipid-reactive oxygen species increased by approximately 35%. After combined use with Daratumumab, the number of H-929 cells that developed lipid-reactive oxygen species further increased by approximately 66%, indicating that RSL3 combined with Daratumumab induced a significant increase in the level of lipid-reactive oxygen species in t(4;14)-positive MM cells, thereby promoting their ferroptosis.

[0041] Example 5

[0042] Detection of malondialdehyde (MDA) levels, a lipid peroxidation product, in MM cells

[0043] H929 cells in the logarithmic growth phase were collected and cultured at a rate of 4 × 10 5Cells were seeded at a density of 1.8 ml / well in a 6-well plate at 4°C / ml and cultured overnight in an incubator. Solvent control (appropriate amount of DMSO), 0.2 μmol / L RSL3, 0.2 μg / mL Daratumumab, and 0.2 μmol / L RSL3 + 0.1 μg / mL Daratumumab were added to each of the four groups of cells, respectively. Simultaneously, 200 μl of human peripheral blood plasma was added to each well. After 48 hours of drug treatment, cells were harvested, 100 μl of cell lysis buffer was added, and the cells were incubated at 4°C for 30 minutes. The supernatants of the four cell lysates were obtained by centrifugation at 12,000 g. 200 μl of MDA detection solution was added to each cell group and thoroughly vortexed. The cells were heated in a dry bath at 100°C for 15 minutes. After cooling to room temperature, the samples were centrifuged at 1,000 g for 10 minutes. 200 μl of supernatant was added to a 96-well plate, and the absorbance was measured at 532 nm using a microplate reader. The MDA level of the sample was calculated based on the pre-determined MDA standard curve. Figure 5 As shown, after adding RSL3 and Daratumumab to H-929 cells for 48 hours, the intracellular MDA level increased significantly, indicating that RSL3 combined with Daratumumab can significantly induce lipid peroxidation damage in t(4;14)-positive MM cells and promote ferroptosis.

[0044] Example 6

[0045] Detection of PTGS2 mRNA levels in MM cells

[0046] H929 cells in the logarithmic growth phase were collected and cultured at a rate of 4 × 10 5 Cells were seeded at a density of 100 μg / ml in a 6-well plate (1.8 ml / well) and cultured overnight in an incubator. Solvent control (appropriate amount of DMSO), 0.2 μmol / L RSL3, 0.2 μg / mL Daratumumab, and 0.2 μmol / L RSL3 + 0.1 μg / mL Daratumumab were added to the four groups of cells, respectively. Simultaneously, 200 μl of human peripheral blood plasma was added to each well. After 48 hours of drug treatment, the cells were collected, 1000 μl of TRIZOL extract was added, 200 μl of chloroform was added, and the cells were vigorously inverted for 30 seconds and then allowed to stand on ice for 10 minutes. The cells were centrifuged at 12,000 rpm at 4°C for 15 minutes. 500 μl of the colorless, transparent liquid rich in RNA was aspirated, allowed to stand again, and then centrifuged to obtain a milky white RNA precipitate. The RNA concentration was determined after adding an appropriate amount of DEPC water. The SYBR Green PCR method was used to detect the target gene PTGS2 mRNA level. The forward primer sequence of PTGS2 was CGGTGAAACTCTGGCTAGACAG, and the rear primer sequence was GCAAACCGTAGATGCTCAGGGA. Figure 6As shown, 48 hours after adding RSL3 and Daratumumab to H-929 cells, the intracellular PTGS2 mRNA level increased significantly, indicating that RSL3 combined with Daratumumab can significantly induce ferroptosis of t(4;14)-positive MM cells.

[0047] Example 7

[0048] Western blot (WB) detection of target GPX4

[0049] H929 cells in the logarithmic growth phase were collected and cultured at a rate of 4 × 10 5 / ml cell density was seeded in a 6-well plate (1.8ml / well) and cultured in an incubator overnight. Solvent control (appropriate amount of DMSO), 0.2μmol / L RSL3, 0.2μg / mL Daratumumab, and 0.2μmol / L RSL3 + 0.1μg / mL Daratumumab were added to the four groups of cells respectively; 200μl of plasma extracted from human peripheral blood was added to each well simultaneously. After 48 hours of drug treatment, cells were collected for protein extraction. Cell lysate and cocktail (a type of protease inhibitor) were prepared at a ratio of 100:1 to prepare protein lysate. An appropriate amount of lysate was added to the cell pellet and vigorously shaken on a vortex shaker for 30 seconds, every 5 minutes. After complete lysis, centrifugation was performed at 4°C and 13000rpm for 20 minutes, and the protein supernatant was then aspirated. Use protein standard 0.5mg / ml BSA to prepare standard curve, simultaneously draw 1μl of sample to be tested into 96-well plate, draw 19μl double distilled water to make up the volume of each well to 20μl. Draw 200μl BCA working solution into the well to be tested, and incubate at 37°C for 30 minutes. Use microplate reader to read OD value at 570nm wavelength, and calculate protein concentration according to standard curve and OD value of sample to be tested. Use WB method to detect changes in expression level of target protein GPX4, GPX4 antibody (catalog number ab125066) (expansion ratio is 1:2000) purchased from Abcam. Figure 7 As shown, 48 hours after the addition of RSL3 and Daratumumab to H-929 cells, the intracellular GPX4 protein level was significantly reduced, indicating that the target of the combined drug is GPX4.

[0050] Example 8

[0051] Lentiviral transfection of target GPX4 and verification of cell activity

[0052] The GPX4 knockdown H-929 cell line was constructed using the lentiviral method. After the cells were collected, the cells were cultured at a rate of 1.5×10 5The cells were seeded into 96-well plates at a density of 10 cells / ml (90 μl / well). Then solvent control, (appropriate amount of DMSO), 0.2 μmol / L RSL3, 0.1 μg / mL Daratumumab, 0.2 μmol / L RSL3+0.1 μg / mL Daratumumab were added in sequence; 10 μl of plasma extracted from human peripheral blood was added to each well simultaneously. The CCK-8 method was used to detect the changes in cell activity of the above four groups in GPX4 knockdown and non-knockdown MM cells. Figure 8 As shown, 48 hours after the addition of RSL3 and Daratumumab to H-929 cells, the cell activity was significantly reduced, while the cell activity of the GPX4 knockdown group cells was relatively increased, which again suggested that the target of the combined action of the two drugs was GPX4.

[0053] The above description is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with this technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered by the scope of protection of the present invention.

Claims

1. Application of CD38 monoclonal antibody combined with RSL3 in the preparation of drugs for the treatment of t(4;14)-positive multiple myeloma.

2. The use according to claim 1, characterized in that CD38 monoclonal antibody combined with RSL3 has a synergistic effect in t(4;14)-positive multiple myeloma cells.

3. The use according to claim 1, characterized in that The target of the combination of CD38 monoclonal antibody and RSL3 drug is GPX4.

4. The use according to claim 1, characterized in that CD38 monoclonal antibody combined with RSL3 induces apoptosis of t(4;14)-positive multiple myeloma cells.

5. The use according to claim 1, characterized in that CD38 monoclonal antibody combined with RSL3 induces ferroptosis in t(4;14)-positive multiple myeloma cells.