Application of FAM3A inhibitor in colorectal cancer treatment

Abstract

The invention discloses an application of an FAM3A inhibitor in colorectal cancer treatment. Experiments prove that the FAM3A gene is a brand-new functional gene related to colorectal cancer morbidity, an inhibitor of the FAM3A gene can inhibit colorectal cancer cell proliferation, migration and invasion, and a new research strategy and tool are provided for colorectal cancer treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to the use of FAM3A inhibitors in the treatment of colorectal cancer. Background Art

[0002] Colorectal cancer (CRC) is a common malignancy in China. A combined treatment approach of surgical resection and adjuvant chemotherapy has become the standard of care and has significantly improved overall prognosis. However, a series of epigenetic and metabolic changes endow CRC cells with enhanced migration and invasion capabilities, resulting in a 5-year survival rate of approximately 12% for metastatic CRC. Approximately 30% of CRC patients have distant metastases at the time of diagnosis, and up to 30% of patients die from metastasis and recurrence. Currently, targeted therapies for CRC mainly include anti-vascular endothelial growth factor / VEGF / VEGFR (VEGF / VEGFR)-targeted therapies, epidermal growth factor receptor (EGFR)-targeted therapies, and multi-targeted kinase inhibitors.

[0003] Through in-depth research into the pathogenesis of colorectal cancer, the study of new targets and personalized precision treatment can help prolong the survival of colorectal cancer patients, especially those with refractory disease, and improve their quality of life. In view of this, the present invention provides a new target for colorectal cancer and its inhibitors for the treatment of colorectal cancer. Summary of the Invention

[0004] In view of the deficiencies of the existing technology, the present invention provides a new target for colorectal cancer and the use of its inhibitors in the treatment of colorectal cancer.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The first aspect of the present invention provides the use of a FAM3A inhibitor, wherein the use includes any of the following:

[0007] 1) Application in the preparation of products for the treatment of colorectal cancer;

[0008] 2) Application in inhibiting the proliferation, migration and / or invasion of colorectal cancer cells in vitro.

[0009] In the present invention, FAM3A includes wild-type, mutant forms, or fragments thereof. The term encompasses full-length, unprocessed FAM3A, as well as any form of FAM3A derived from processing in cells. The term also encompasses naturally occurring variants of FAM3A (e.g., splice variants or allelic variants). For example, the term encompasses the FAM3A gene, human FAM3A, as well as FAM3A from any other vertebrate source, including mammals such as primates and rodents (e.g., mice and rats). As a preferred embodiment, in the present invention, FAM3A is a human gene with Gene ID 60343.

[0010] Furthermore, the inhibitor includes reagents used in RNA interference technology, CRISPR technology, antisense oligonucleotide technology, TALEN technology, ZFN technology, and Cre-loxP gene recombination technology, or the inhibitor is a compound that has a specific inhibitory effect on FAM3A.

[0011] Furthermore, the inhibitors include shRNA, antisense oligonucleotides (ASO), antibodies, antagonists, blockers, siRNA, and miRNA targeting FAM3A or its expression products.

[0012] Furthermore, the inhibitor is a reagent used in RNA interference technology.

[0013] In this context, RNA interference (RNAi) technology refers to the highly evolutionarily conserved phenomenon of efficient and specific degradation of homologous mRNAs induced by double-stranded RNA (dsRNA). Gene silencing is primarily categorized into two types: pre-transcriptional gene silencing (TGS) and post-transcriptional gene silencing (PTGS). TGS occurs when genes are unable to transcribe normally due to factors such as DNA modification or chromosomal heterochromatinization; PTGS triggers the sequence-specific degradation of target mRNAs in the cytoplasm. Sometimes, transgenics can cause both TGS and PTGS.

[0014] Furthermore, the reagent used in the RNA interference technology is shRNA that specifically targets FAM3A.

[0015] Specifically, the shRNA (short hairpin RNA) primarily participates in RNA interference and consists of two short inverted repeats. Cloned into an shRNA expression vector, the shRNA consists of two short inverted repeats separated by a stem-loop sequence, forming a hairpin structure controlled by a Pol III promoter. Five to six Ts are then attached to serve as a transcriptional terminator for RNA polymerase III. Those skilled in the art can design and screen shRNAs specifically targeting the FAM3A gene using known gene sequences.

[0016] Furthermore, the shRNA sequence specifically targeting FAM3A is shown in SEQ ID NO: 1.

[0017] Furthermore, the compound having a specific inhibitory effect on FAM3A is lincitinib.

[0018] In the applications provided by the present invention, the inhibitor or product can also be used in combination with other cancer treatment methods or cancer treatment drugs, such as, but not limited to, radiotherapy, immunotherapy, gene therapy, and surgery.

[0019] A second aspect of the present invention provides use of a pharmaceutical composition in preparing a product for treating colorectal cancer, wherein the pharmaceutical composition comprises an inhibitor of FAM3A.

[0020] Furthermore, the inhibitor includes reagents used in RNA interference technology, CRISPR technology, antisense oligonucleotide technology, TALEN technology, ZFN technology, and Cre-loxP gene recombination technology, or the inhibitor is a compound that has a specific inhibitory effect on FAM3A.

[0021] Furthermore, the inhibitor is a reagent used in RNA interference technology.

[0022] Furthermore, the reagent used in the RNA interference technology is shRNA that specifically targets FAM3A.

[0023] Furthermore, the shRNA sequence specifically targeting FAM3A is shown in SEQ ID NO: 1.

[0024] Furthermore, the compound having a specific inhibitory effect on FAM3A is lincitinib.

[0025] Furthermore, the pharmaceutical composition also includes any one or more of the following drugs for treating colorectal cancer: conafenib, bimetinib, dabrafenib, trametinib, vemurafenib, cobimetinib, imatinib, nilotinib, pembrolizumab, atezolizumab, nivolumab, ipilimumab, paclitaxel, cisplatin, temozolomide, dacarbazine, carboplatin, nimustine, bleomycin, and irinotecan.

[0026] Furthermore, the FAM3A inhibitor and other drugs for treating colorectal cancer can be administered simultaneously or sequentially.

[0027] In the present invention, "simultaneous administration" may mean that the FAM3A inhibitor and other colorectal cancer treatment drugs are administered simultaneously, preferably, the FAM3A inhibitor and other colorectal cancer treatment drugs are administered within a time interval of less than 15 minutes, more preferably, within a time interval of less than 5 minutes. "Sequential administration" may mean that the FAM3A inhibitor is administered before or after other colorectal cancer treatment drugs, preferably, the FAM3A inhibitor and other colorectal cancer treatment drugs are administered at an interval of at least 1 day, 2 days, 3 days, 7 days, 30 days, or longer.

[0028] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier, diluent or excipient.

[0029] In the present invention, the pharmaceutically acceptable carrier, diluent, or excipient is any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, surfactant, or emulsifier that can be used for humans or livestock. The carrier should be biologically acceptable, meaning that it is compatible with the other ingredients in the formulation and is harmless to the patient and does not induce an adverse reaction (e.g., an immune response) when administered to the host.

[0030] The pharmaceutical composition of the present invention can be prepared into various dosage forms as needed, including but not limited to tablets, solutions, granules, patches, ointments, capsules, aerosols, or suppositories for transdermal, mucosal, nasal, buccal, sublingual, or oral administration.

[0031] As used herein, the terms "drug," "drug composition," "cancer drug," "cancer treatment drug," and "tumor drug" have synonymous meanings and refer to substances or combinations of substances that can treat tumors. The inhibitors (drugs) provided herein have tumor treatment effects. "Treatment" includes preventing or delaying the onset of symptoms and complications of a disease (such as a tumor), extending the survival of cancer patients, improving quality of life, alleviating symptoms, shrinking or even eliminating tumors, curbing tumor metastasis, and preventing tumor recurrence. As used herein, "cancer treatment" and "inhibiting cell proliferation" have synonymous meanings. In specific embodiments, "cancer" and "tumor" refer to colorectal cancer.

[0032] A third aspect of the present invention provides a method for inhibiting the proliferation, migration and / or invasion of colorectal cancer cells in vitro, the method comprising contacting a FAM3A inhibitor with target cells, or introducing the FAM3A inhibitor into target cells.

[0033] In the present invention, the target cells include colorectal cancer cells, specifically cancer cells obtained from a subject (in vitro), commercially available or self-cultured cancer cell lines. In a specific embodiment, the target cells are LOVO cells or SW480 cells.

[0034] As used herein, the term "subject" refers to any animal (e.g., a mammal), including but not limited to humans, non-human primates, rodents, etc., that is to be the recipient of a particular treatment. Generally, the terms "subject" and "patient" are used interchangeably herein when referring to a human subject. Most preferably, the subject is a human.

[0035] In the present invention, the FAM3A inhibitor can be introduced into target cells (cancer cells) by any conventional technique. In a specific embodiment of the present invention, a transfection method is specifically used. The transfection reagent can be a commercial product or a self-prepared reagent; exemplary commercial products include Lipofectamine™ 2000 (Thermo Fisher Scientific), Lipofectamine™ 3000 (Thermo Fisher Scientific), Lipofectamine™ RNAiMAX (Thermo Fisher Scientific), Neon™ Transfection System (Thermo Fisher Scientific), HiPerFect (QIAGEN), X-tremeGENE (Roche), siLentFect™ (Bio-Rad), etc.

[0036] Furthermore, the FAM3A inhibitor includes reagents used in RNA interference technology, CRISPR technology, antisense oligonucleotide technology, TALEN technology, ZFN technology, and Cre-loxP gene recombination technology, or the inhibitor is a compound that has a specific inhibitory effect on FAM3A.

[0037] Furthermore, the inhibitor is a reagent used in RNA interference technology.

[0038] Furthermore, the reagent used in the RNA interference technology is shRNA that specifically targets FAM3A.

[0039] Furthermore, the shRNA sequence specifically targeting FAM3A is shown in SEQ ID NO: 1.

[0040] Furthermore, the compound having a specific inhibitory effect on FAM3A is lincitinib.

[0041] Furthermore, the introduction method includes viral transduction, electroporation transfection, liposome delivery, polymer carriers, chemical carriers, lipid complexes, polymer complexes, dendrimers, nanoparticles, natural endocytosis or phagocytosis pathways, cell penetrating peptides, microinjection, microneedle delivery, and particle bombardment.

[0042] Advantages and beneficial effects of the present invention: The present invention provides a new functional gene FAM3A related to the pathogenesis of colorectal cancer, and proves that reagents that inhibit FAM3A expression can inhibit the proliferation, migration and invasion of colorectal cancer cells. FAM3A inhibitors can be used to prepare products for the treatment of colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Bioinformatics analysis revealed that FAM3A expression in tumor tissues was significantly upregulated compared with adjacent adjacent tissues.

[0044] Figure 2 Bioinformatics analysis found that FAM3A expression in tumor tissues was significantly upregulated compared with adjacent cancer tissues in the three study cohorts.

[0045] Figure 3 Survival curves of colorectal cancer patients with different FAM3A expression levels analyzed from TCGA-COADREAD cohort data.

[0046] Figure 4 Western blot and statistical graph of FAM3A expression in colorectal cancer cells after FAM3A knockdown.

[0047] Figure 5 This is the proliferation curve of colorectal cancer cells detected by MTS experiment after knocking down FAM3A.

[0048] Figure 6 The results and statistical graph of the colorectal cancer cell scratch healing experiment after knocking down FAM3A.

[0049] Figure 7 The results and statistical graph of the Transwell migration experiment of colorectal cancer cells after knocking down FAM3A.

[0050] Figure 8 This is a statistical diagram of the subcutaneous tumor volume in nude mice in the xenograft tumor model after knocking down FAM3A.

[0051] Figure 9 This is a diagram of drug sensitivity score and molecular docking results. DETAILED DESCRIPTION

[0052] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making creative efforts shall fall within the scope of protection of the present invention.

[0053] Example

[0054] 1. Experimental Methods

[0055] 1. In the preliminary work, the research team collected 10 pairs of colorectal cancer tumor tissue and control adjacent cancer tissue specimens. These specimens were all from patients who visited the Provincial Hospital Affiliated to Shandong First Medical University and underwent radical resection of colorectal cancer. During the specimen collection process, the informed consent of the patient was obtained for each specimen. Before the patient was admitted to the hospital for surgical treatment, the attending physician of the research team introduced the purpose, significance, use of specimens, and possible risks and benefits of the study in detail to the patient and his family, fully respecting the patient's wishes and rights. After fully understanding and agreeing to participate in the study, the patient voluntarily signed a detailed informed consent form, which detailed the relevant information of the study, including but not limited to the collection, storage, analysis and use of research results of the specimens, providing a strong guarantee for the legal and compliance of the study.

[0056] Regarding the inclusion and exclusion criteria of patients, the inclusion criteria are as follows:

[0057] Patients were diagnosed with colorectal cancer by pathological examination and planned to undergo radical surgery; they were between 18 and 75 years old; and they or their legal representatives were able to understand and sign the informed consent form.

[0058] Exclusion criteria include:

[0059] Patients with a history of other malignant tumors; patients with severe dysfunction of important organs such as the heart, liver, and kidney, or patients with mental illness or cognitive impairment who are unable to communicate and cooperate effectively with the research; patients who are receiving special treatments that may affect gene expression (such as chemotherapy, radiotherapy, etc.); patients who refuse to sign the informed consent form.

[0060] 2. The shRNA sequence used to knock down FAM3A was GAAGAACAGTAAGCACAGCAA (SEQ ID NO: 1). The vector used was pLKO.1-puro-CMV-tGFP.

[0061] 3. shRNA screening and transfection protocol

[0062] 1) Plasmid construction verification: Sequence the constructed pLKO.1-puro-CMV-tGFP-FAM3A shRNA plasmid to confirm that the shRNA sequence is correctly inserted into the vector without mutations or mismatches.

[0063] 2) Cell Culture: SW480 and HCT116 cells were seeded in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin, respectively, and cultured in a cell culture incubator at 37°C and 5% CO2. The culture medium was changed regularly to maintain good cell growth.

[0064] 3) Plasmid Transfection: When cells reach 70%-80% confluence, perform transfection experiments. SW480 and HCT116 cells were transfected with the pLKO.1-puro-CMV-tGFP-FAM3A shRNA plasmid and an empty pLKO.1-puro-CMV-tGFP plasmid (as an empty control) using Lipofectamine 3000 transfection reagent in triplicate. Six hours after transfection, observe the cells and replace the culture medium with fresh medium.

[0065] 4) Screening for Stable Knockdown Cell Lines: 48 hours after transfection, add puromycin to the cell culture medium for selection. Replace the puromycin-containing culture medium every three days for approximately two to three weeks. Observe cell morphology and growth regularly during this period. When most untransfected cells die and transfected cells form colonies, observe and record cell growth and fluorescence expression using an inverted microscope.

[0066] 5) Cell Expansion and Cryopreservation: After the selected stable expressing cell clones have grown, they are trypsinized and counted. The cells are diluted according to a specific ratio and seeded into new culture dishes for expansion. When the cells are growing well and have reached a density of 80%-90% confluence, they are cryopreserved and stored in liquid nitrogen for subsequent experiments.

[0067] 4. Western blot

[0068] 1) Total protein extraction

[0069] Cell samples: centrifuge at 1000 rpm for 10 minutes, discard the culture medium, and wash with PBS; centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and wash with PBS; centrifuge at 1000 rpm for 5 minutes, and aspirate the PBS solution.

[0070] Add the appropriate extraction buffer based on the cell count and gently shake at 4°C for 15 minutes. Collect the lysate into an EP tube and centrifuge at 14,000 rpm for 15 minutes. Transfer the supernatant to a new EP tube.

[0071] 2) Preliminary quantification of protein samples: protein concentration was measured by BCA assay.

[0072] 3) SDS-PAGE electrophoresis

[0073] a. Prepare protein loading buffer: Mix the extracted protein solution and loading buffer in a ratio of 2:1 and boil for 5 minutes.

[0074] b. Before gel electrophoresis, wash each well with 1× electrophoresis buffer. Add 1× electrophoresis buffer to both the upper and lower electrophoresis tanks. Ensure the buffer level in the upper tank is above the top of the sample loading well.

[0075] c. Electrophoresis: 80V constant voltage for 50 minutes, or 120V constant voltage until bromophenol blue just comes out of the bottom of the gel.

[0076] 4) Protein transfer

[0077] a. Pre-treat the PVDF membrane with methanol for 3-5 seconds and allow it to soak in the transfer solution for half an hour.

[0078] b. Remove the gel and place it on the filter paper, forming a "sandwich" structure: gel transfer stacking layer, filter paper, gel, PVDF membrane, filter paper, gel transfer stacking layer. Be sure to completely remove any air bubbles during this operation.

[0079] c. Place the transfer clip in the positive and negative directions.

[0080] d. Under low temperature conditions, maintain constant voltage at 100V for 60 to 120 minutes.

[0081] 5) Immunoblotting

[0082] a. Remove the hybridized membrane and rinse three times with TBST for 5 minutes. Block with 5% skim milk solution for 1 hour at room temperature or overnight at 4°C. Wash the membrane three times with TBST for 5 minutes. Incubate with the appropriate primary antibody dilution at 4°C overnight or at 37°C for 2 hours. Wash the membrane three times with TBST for 5 minutes. Incubate with the appropriate secondary antibody dilution at 37°C for 1 hour. Wash the membrane three times with TBST for 5 minutes. Rinse the membrane with distilled water for 2 minutes and discard the solution. Wash three times in total.

[0083] Place the hybridization membrane on a clear plastic plate, taking care not to allow it to dry. Using a clean pipette, evenly apply the chemiluminescent substrate to the membrane surface and allow the reaction to continue for 5 minutes. Remove any excess substrate solution from the membrane surface with the filter paper provided in the kit and place it in a dark box. Develop the membrane.

[0084] 6) Reagents used:

[0085] a. Internal control antibody information: Name: Recombinant Anti-Actin Antibody [EPR16769], Dilution: 1:5,000, Manufacturer: Abcam, Catalog Number: ab179467.

[0086] b. Primary Antibody: FAM3A Rabbit mAb, Dilution: 1:2000, Manufacturer: ABclonal, Catalog No.: A24116.

[0087] c. Secondary Antibody: Name: Goat Anti-Rabbit IgG (H+L chain specific), Dilution: 1:5000, Manufacturer: Southern Biotech, Catalog Number: 4050-05.

[0088] d. Film: Name: Medical X-ray Film, Manufacturer: Kodak, Model: XBT-1, Specifications: 13.7 × 17.8 cm.

[0089] e. Luminescent liquid: Name: IMMOBILON WESTERN CHEMILUM HRP SUBSTRATE, Manufacturer: MILLIPORE, Product Number: WBKLS0500.

[0090] f. PVDF membrane: Name: Immobilon-P Transfer Membrane, Manufacturer: MILLIPORE, Product Number: IPVH00010, Model: 0.45 μm.

[0091] Appendix: Reagent formula:

[0092] ①10× electrophoresis buffer: Dissolve 144g Glycine, 30g Tirs-Base, and 10g SDS in 800ml of pure water, then dilute to 1L and store at room temperature. When using, dilute 100ml of 10× buffer with 900ml of pure water to 1×.

[0093] ②10× Transfer Buffer: Dissolve 154g Glycine and 30g Tris-Base in 800mL of pure water, then dilute to 1L and store at room temperature. When using, add 200mL of methanol to 100mL of 10× Transfer Buffer and dilute to 1L with pure water.

[0094] ③5× Loading Buffer: Dissolve 1.25 mL of 1M Tris-HCl (pH 6.8), 0.5 g of SDS, 25 mg of BPB (bromophenol blue), and 3.5 mL of glycerol in 2 mL of deionized water and adjust the volume to 5 mL. Add 50 μL of β-mercaptoethanol per 1 mL of Loading Buffer.

[0095] ④ Tris buffer formula (0.5M pH 7.6): Dissolve 60.57 g of Tris-Base in 800 mL of pure water, adjust the pH to 7.6 with concentrated hydrochloric acid, and make up to 1 L.

[0096] ⑤1×TBS (TBST): Dissolve 8.5 g of NaCl in a small amount of pure water, then add 100 mL of 0.5 M Tris buffer and adjust the volume to 1 L. This is 1×TBS. Add 0.1% Tween-20.

[0097] ⑥RIPA lysis buffer: 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS. When using, add 100 mM PMSF, 100× Cocktail, and phosphatase inhibitors at a ratio of 1:100.

[0098] ⑦ Fixer: 240 g sodium thiosulfate, 25 g anhydrous sodium sulfite, 48 mL glacial acetic acid, dissolve in pure water and adjust to 1 L.

[0099] 5. Cell proliferation

[0100] Cells from each treatment group were taken for the following experiments.

[0101] After digestion, disperse the cells by pipetting, count the cells, and adjust the cell concentration to 1×10 5 cells / ml, and divided into 96-well plates, 100 μl per well, i.e. 1×10 cells per well4 indivual.

[0102] Adherent cells need to be allowed to adhere to the wall before collecting cells at different time points for detection.

[0103] Cells were collected at various time points (0 h, 24 h, 48 h, and 72 h) and added to the cellTiter96AQ single-solution cell proliferation assay reagent (Promega, Cat. No. G3582) at a ratio of 1:10, i.e., 10 μl of assay solution was added to 100 μl of culture medium.

[0104] After 4 hours of incubation, the plate was read using a microplate reader and the OD490 data was read using the MTS assay.

[0105] 6. Cell Cycle

[0106] 48 hours after transfection, 1×10 cells were collected for each sample. 6 cell.

[0107] Cell fixation: Collect cells by centrifugation, discard the supernatant, wash cells twice with pre-cooled PBS, add pre-cooled 70% ethanol, and fix at 4°C overnight or -20°C for long-term fixation.

[0108] Cell staining: Collect cells by centrifugation, wash cells once with 1 mL of PBS, add 500 μL of PBS containing 50 μg / mL propidium bromide (PI), 100 μg / mL RNase A, and 0.2% Triton X-100, and incubate at 4°C in the dark for 30 min.

[0109] Flow cytometric analysis: Standard procedures were used for detection using a flow cytometer (BD calibur), generally counting 20,000 to 30,000 cells, and the results were analyzed using the cell cycle fitting software ModFit.

[0110] Reagents used: KGI Cell Cycle Detection Kit, catalog number KGA511.

[0111] 7. Apoptosis

[0112] Transfer the culture medium from each group of cell culture plates to a 15 ml conical tube and place on ice. Gently rinse the cells in the culture plate with 2 ml of PBS solution and remove the PBS solution. Add 0.5 ml of 0.25% trypsin (without EDTA) and incubate until the cells begin to detach from the culture plate wall under the microscope. Gently tap the culture plate continuously to completely detach the cells from the culture plate wall. Gently resuspend the cells in culture medium or pre-chilled 1× binding buffer to a density of approximately 1×10 6 cells / ml. 0.5 ml of cell suspension was taken from the cell culture plate (5×10 5Transfer 100 μl of cells to a clean microcentrifuge tube. Add 1.25 μl of Annexin V-FITC. Incubate at room temperature (18-24°C) in the dark for 15 minutes. Centrifuge at 1000 × g for 5 minutes at room temperature and remove the supernatant. Gently resuspend the cells in 0.5 ml of pre-chilled 1× binding buffer. Add 10 μl of Propidium Iodide. Store the sample on ice in the dark. Analyze immediately by flow cytometry.

[0113] Kit used: Annexin V-FITC Cell Apoptosis Detection Kit (keygen, product number KGA106).

[0114] Instrument used: Flow cytometer BD calibur.

[0115] 8. Transwell experiment

[0116] Dissolve Matrigel overnight at 4°C. Dilute Matrigel with pre-chilled serum-free medium at a 1:3 volume ratio. Add 40 μl to a pre-chilled Transwell chamber and incubate at 37°C for 2 h to allow the Matrigel to solidify. Aspirate excess liquid from the chamber and add 100 μl and 600 μl of serum-free medium to the upper and lower chambers, respectively. Equilibrate at 37°C overnight.

[0117] On the second day of microRNA transfection, 1×10 cells were counted. 5 Cells were resuspended in 100 μl serum-free DMEM medium and added to the upper chamber of the Transwell chamber, and 600 μl complete medium was added to the lower chamber.

[0118] After incubation at 37°C, 5% CO2 for 24 and 48 hours, the chamber was removed, and the cells in the upper chamber were wiped off with a cotton swab. The cells were fixed with 4% paraformaldehyde for 15 minutes, washed once with PBS, stained with crystal violet for 10 minutes, and washed once with PBS. The cells were tested to see if they had passed through the holes. If so, other experimental groups were discontinued, and photos were taken for statistical analysis.

[0119] Reagents and consumables used: Transwell cell culture plates (BD, REF353097); Matrigel glue (BD, 356234).

[0120] 9. Scratch healing experiment

[0121] 1) Cell preparation

[0122] a. Cell Culture: Colorectal cancer cells were cultured in DMEM high-glucose medium supplemented with 10% fetal bovine serum in advance and incubated in a 37°C, 5% CO2 incubator until the logarithmic growth phase.

[0123] b. Cell counting: Digest the cells with trypsin to prepare a single-cell suspension. Count the cells using a hemocytometer and adjust the cell concentration to 5 × 10 5 pcs / ml.

[0124] 2) Planking and Scratching

[0125] a. Plating: Add 2 ml of cell suspension to each well of a 6-well plate. Gently shake to evenly distribute the cells. Incubate in a 37°C, 5% CO2 incubator for 24 hours to achieve approximately 90% cell confluency.

[0126] b. Scratch: Use a 200 μl sterile pipette tip to gently scratch a straight line in each well perpendicular to the direction of cell growth, keeping the scratch width as consistent as possible. Wash the cells twice with PBS to remove scratch debris.

[0127] 3) Cell culture and observation

[0128] a. Add culture medium: Add 2 ml of serum-free DMEM high-glucose medium to each well and culture in a 37°C, 5% CO2 incubator.

[0129] b. Observation and Photography: Observe the wound healing process under an inverted microscope and take photos at 0, 24, 36, and 48 hours after the scratch. Select 3–5 representative fields of view for photography.

[0130] 10. Construction of a nude mouse subcutaneous tumor model

[0131] Four-week-old BALB / c nude mice (5 per group, purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) were fed with normal feed. 200 μl of cell suspension (approximately 5×10 5 Xenograft tumors were established in the control group (shNCSW480 cells) and in the experimental group (shFAM3A-interfered SW480 cells). Mice were sacrificed by cervical dislocation 30 days after inoculation, and tumors were removed for subsequent analysis. Tumor volume was calculated using the formula: .

[0132] 11. Drug sensitivity analysis and molecular docking:

[0133] Based on RNA-seq data from colon cancer samples from the TCGA-COAD cohort, gene expression levels were converted to TPM values. The oncoPredict R package and drug resistance data for 545 small molecule compounds from the CTRP database were used to identify FAM3A-specific anticancer drugs. Drug susceptibility prediction was performed using the "calcPhenotype" function in the "oncoPredict" R package. The core parameters were set to exclude genes with high coefficients of variation across all samples and retain 80% of genes; each gene was expressed in at least 10 samples. Candidate small molecule drugs whose drug sensitivity scores were negatively correlated with FAM3A expression levels were considered potential specific drugs and subsequently subjected to molecular docking simulations.

[0134] The three-dimensional protein structure of FAM3A was generated using AlphaFold, and the amino acid sequence used was MRLAGPLRIVVLVVSVGVTWIVVSILLGGPGSGFPRIQQLFTSPESSVTAAPRARKYKCGLPQPCPEEHLAFRVVSGAANVIGPKICLEDKMLMSSVKDNVGRGLNIALVNGVSGELIEARAFDMWAGDVNDLLKFIRPLHEGTLVFVASYDDPATKMNEETRKLFSELGSRNAKELAFRDSWVFVGAKGVQNKSPFEQHVKNSKHSNKYEGWPEALEMEGCIPRRSTAS (SEQ ID NO: 2, from Uniport database, protein ID P98173).

[0135] The 3D chemical structures of potential specific drugs were obtained from the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov / ). The AutoDockTools tool in AutoDock 4.2.6 was used to preprocess the protein and compound structures, including hydrogenation and charge balancing. A grid box was defined based on the protein structure, and its position and size were set in AutoDockTools to ensure that all target active sites were included. Parameters such as the search space size, docking algorithm, and population size were all set to default values, and the number of iterations was set to 100. The molecular docking results output by AutoDock 4.2.6 were evaluated based on binding energy, binding position, and hydrogen bonding. The binding between the ligand and the protein was examined using PyMOL 3.1.0. A binding energy below -5 kcal / mol was considered a good docking.

[0136] 2. Experimental Results

[0137] 1. Overexpression of FAM3A was found in colorectal cancer (CRC) tissues, and this overexpression was associated with tumor progression and poor prognosis of patients.

[0138] Shandong Provincial Hospital collected samples for transcriptome sequencing and analysis and found that the expression of the new tumor-related gene FAM3A in colorectal cancer was significantly upregulated in tumor tissues compared with control adjacent cancer tissues (results as shown in Figure 1 Then, the colorectal cancer data were extracted from the GEO database (GSE24551, GSE37182, and GSE38043 cohorts, respectively). Figure 2 Analysis of the left, middle, and right figures in the figure showed that the expression level of the FAM3A gene in colorectal cancer tissues was significantly higher than that in control adjacent cancer tissues (results shown in Figure 2 As shown in the TCGA-COADREAD cohort data, FAM3A gene high expression in colorectal cancer patients with poor prognosis, can be used as a prognostic marker (P = 0.0003) (results as shown in the Figure 3 shown).

[0139] In summary, the data demonstrate that FAM3A is highly expressed in colorectal cancer tumor tissue compared to adjacent adjacent tissues, suggesting that it may be involved in CRC progression and associated with adverse clinical outcomes. A systematic literature review revealed no functional studies linking FAM3A to tumors, suggesting that the FAM3A gene may represent a novel target for colorectal cancer.

[0140] 2. Analysis of shRNA transfection efficiency:

[0141] 1) 48 hours after transfection, observe tGFP expression using a fluorescence microscope and calculate transfection efficiency. Transfection efficiency = number of fluorescence-positive cells / total number of cells × 100%.

[0142] 2) Collect the screened stable knockdown cells and control cells, extract total protein with RIPA lysis buffer, and perform Western blot experiments to detect the expression level of FAM3A protein. Use Actin as an internal reference protein to analyze the knockdown effect at the protein level.

[0143] 3) LOVO and SW480 cells were transduced with shRNA targeting FAM3A or empty vector control (NC) to reduce FAM3A expression. Compared with control cells, FAM3A expression in FAM3A knockdown cells was significantly decreased (results shown in Figure 4 shown).

[0144] 3. Low expression of FAM3A inhibits the proliferation, migration and invasion of colorectal cancer (CRC) cells.

[0145] MTS assay showed that knocking down FAM3A gene expression could inhibit tumor cell proliferation (P<0.05) (results as shown in Figure 5 The scratch healing assay showed that low expression of FAM3A significantly weakened the migration ability of the two CRC cells (results shown in Figure 6 Transwell migration assay showed that the invasion and migration abilities of cells with low FAM3A expression were significantly reduced compared with the control group (results shown in Figure 7 shown).

[0146] In summary, the data indicate that low expression of FAM3A can inhibit the proliferation, migration, and invasion of CRC cells in vitro.

[0147] 4. Nude mouse subcutaneous tumor model

[0148] 30 days after inoculation of colorectal cancer cells, the tumor volume of BABL / c mice in the FAM3A knockdown group xenograft model was significantly reduced (P=0.0003). Figure 8 As shown, it can be seen that inhibiting FAM3A expression can significantly reduce the size of colorectal cancer tumors.

[0149] 5. Drug sensitivity and molecular docking

[0150] The "calcPhenotype" function in the "oncoPredict" R package was used to predict drug susceptibility in 481 colorectal cancer patients in the TCGA-COAD cohort. Normality test and correlation analysis showed that the linsitinib drug sensitivity score was strongly negatively correlated with the expression level of FAM3A (Spearman rank correlation coefficient = -0.4723, P < 0.0001, as shown in Figure 5). Figure 9 Molecular docking showed that FAM3A protein docked well with linsitinib, forming two hydrogen bonds with alanine-216 residue and glutamic acid-220 residue, with an average binding energy of -5.98 kcal / mol and the lowest binding energy of this state of -6.27 kcal / mol (as shown in Figure 2). Figure 9 Therefore, colorectal cancer patients with high FAM3A expression levels may benefit from linsitinib.

[0151] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention can be implemented over a wide range under equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides embodiments, it will be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any variations, uses, or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the disclosed scope of this application.

Claims

1. Use of a FAM3A inhibitor, characterized in that: The application includes any of the following: 1) Application in the preparation of products for the treatment of colorectal cancer; 2) Application in inhibiting the proliferation, migration and / or invasion of colorectal cancer cells in vitro.

2. The use according to claim 1, characterized in that The inhibitor includes reagents used in RNA interference technology, CRISPR technology, antisense oligonucleotide technology, TALEN technology, ZFN technology, and Cre-loxP gene recombination technology, or the inhibitor is a compound with a specific inhibitory effect on FAM3A.

3. The use according to claim 2, characterized in that The inhibitor is a reagent used in RNA interference technology.

4. The use according to claim 3, characterized in that The reagent used in the RNA interference technology is shRNA that specifically targets FAM3A; The shRNA sequence specifically targeting FAM3A is shown in SEQ ID NO:

1.

5. Use of the pharmaceutical composition in preparing a product for treating colorectal cancer, characterized in that: The pharmaceutical composition includes an inhibitor of FAM3A; The inhibitor includes reagents used in RNA interference technology, CRISPR technology, antisense oligonucleotide technology, TALEN technology, ZFN technology, and Cre-loxP gene recombination technology, or the inhibitor is a compound with a specific inhibitory effect on FAM3A.

6. The use according to claim 5, characterized in that The inhibitor is a reagent used in RNA interference technology; The reagent used in the RNA interference technology is shRNA that specifically targets FAM3A; The shRNA sequence specifically targeting FAM3A is shown in SEQ ID NO:

1.

7. The use according to claim 5, characterized in that The pharmaceutical composition further includes any one or more of the following drugs for treating colorectal cancer: connefenib, bimetinib, dabrafenib, trametinib, vemurafenib, cobimetinib, imatinib, nilotinib, pembrolizumab, atezolizumab, nivolumab, ipilimumab, paclitaxel, cisplatin, temozolomide, dacarbazine, carboplatin, nimustine, bleomycin, and irinotecan.

8. A method for inhibiting the proliferation, migration and / or invasion of colorectal cancer cells in vitro, characterized in that: The method comprises contacting a FAM3A inhibitor with a target cell, or introducing the FAM3A inhibitor into the target cell; The FAM3A inhibitor includes reagents used in RNA interference technology, CRISPR technology, antisense oligonucleotide technology, TALEN technology, ZFN technology, and Cre-loxP gene recombination technology, or the inhibitor is a compound with a specific inhibitory effect on FAM3A.

9. The method according to claim 8, characterized in that The inhibitor is a reagent used in RNA interference technology; The reagent used in the RNA interference technology is shRNA that specifically targets FAM3A; The shRNA sequence specifically targeting FAM3A is shown in SEQ ID NO:

1.

10. The method according to claim 8, characterized in that The methods of introduction include viral transduction, electroporation transfection, liposome delivery, polymer carriers, chemical carriers, lipid complexes, polymer complexes, dendrimers, nanoparticles, natural endocytosis or phagocytosis pathways, cell penetrating peptides, microinjection, microneedle delivery, and particle bombardment.

Images