6-O-carboxymethyl-N-acetylglucosamine as well as preparation method and application thereof
By preparing 6-O-carboxymethyl-N-acetylglucosamine, the problems of large side effects of existing anti-cancer drugs and limited anti-cancer activity are solved, and efficient and safe tumor suppression effect is achieved, which is suitable for the preparation of anti-colorectal and pancreatic cancer drugs.
Patent Information
- Application Number
- CN202510399127.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2025-08-15
AI Technical Summary
Existing anti-cancer drugs such as aspirin require higher doses in preventing recurrence of colorectal cancer, resulting in obvious side effects. The anti-cancer activity of glucosamine is limited by high IC50 concentration, which limits its clinical application.
6-O-carboxymethyl-N-acetylglucosamine was developed to form a novel compound by carboxymethylation at the C-6 position of N-acetylglucosamine, which selectively inhibits the proliferation, migration and invasion of colorectal and pancreatic cancer cells, and induces cancer cell apoptosis by upregulating PCK2.
This compound significantly inhibits tumor cell proliferation and invasion, reduces tumor migration, slows tumor growth, improves histopathological results, and is safer than aspirin and has a lower IC50, which is suitable for the preparation of anti-tumor drugs.
Smart Images

Figure CN120484036A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of chemical medicines, and in particular relates to 6-O-carboxymethyl-N-acetylglucosamine and a preparation method and application thereof. Background Art
[0002] Cancer is one of the most pressing challenges in global health. However, traditional treatments have limitations, necessitating innovative therapeutic strategies. Aspirin (acetylsalicylic acid), long known for its anti-inflammatory and cardioprotective properties, has also garnered significant attention for its emerging role in cancer prevention and treatment. Clinical data have demonstrated that daily low-dose aspirin (75–300 mg) significantly reduces the risk of cancer metastasis, decreases cancer-related mortality, and improves overall survival across multiple cancer types. These benefits are particularly pronounced in digestive system cancers, including esophageal, colorectal, pancreatic, and gastric cancers, and are even present in cases involving specific oncogene mutations, such as PIK3CA. In light of these and other key findings, the U.S. Preventive Services Task Force (USPSTF) recommended in 2016 the use of low-dose aspirin as a colorectal cancer prevention strategy for individuals aged 50 to 69 years with a 10-year cardiovascular disease risk ≥10%. In 2017, the National Comprehensive Cancer Network (NCCN) updated its colorectal cancer treatment guidelines, explicitly recommending the use of low-dose aspirin as a "secondary prevention" strategy after resection of early-stage colorectal cancer. However, while aspirin has demonstrated efficacy in preventing colorectal cancer recurrence, it requires a relatively high dose to achieve a certain effect in inhibiting colorectal tumor growth. High doses can also cause side effects such as gastrointestinal bleeding, intracranial hemorrhage, and renal impairment.
[0003] N-acetylglucosamine (NAG, CAS No. 7512-17-6) is an acetylated derivative of glucosamine. Both NAG and glucosamine have a wide range of biological activities, including anti-inflammatory effects, cardiovascular and neuroprotection, promotion of skin health and antioxidant properties. New evidence shows that they also have potential anti-cancer activity. Existing research results have reported the correlation between the combined use of glucosamine and chondroitin and the reduction of lung and colorectal cancer risks, and demonstrated through in vitro and in vivo studies that the combined use of glucosamine and chondroitin significantly inhibited the proliferation of liver cancer (SMMC-7721) cells and had anti-tumor effects in sarcoma 180 tumor-bearing mice. However, its IC for SMMC-7721 cells 50 The high concentration of about 500 µg / mL required to achieve therapeutic effects limits its clinical application.
[0004] Therefore, it is necessary to continue to develop more new compounds to provide new drugs with fewer side effects and higher anti-cancer activity for cancer treatment. Summary of the Invention
[0005] To address the above technical issues, the present invention provides 6-O-carboxymethyl-N-acetylglucosamine, its preparation method, and uses. This compound significantly inhibits the proliferation, migration, and invasion of colorectal and pancreatic cancer cells and induces apoptosis in tumor cells. Its efficacy is significantly superior to aspirin in all respects, and its antitumor activity is significantly superior to that of NAG. It also exhibits no significant toxicity to major organs, suggesting its potential for the preparation of antitumor drugs.
[0006] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions: The first aspect of the present invention provides 6-O-carboxymethyl-N-acetylglucosamine, the structural formula of which is shown in Formula I:
[0007] Formula I In vitro experiments have shown that the compound can effectively inhibit the proliferation of colorectal cancer cells and pancreatic cancer cells, and can upregulate phosphoenolpyruvate carboxykinase 2 (PCK2), a key regulator of gluconeogenesis, and induce cancer cell apoptosis through a PCK2-mediated pathway; the compound can effectively inhibit the formation of colorectal cancer and pancreatic cancer cell colonies and significantly reduce the migration and invasion of tumor cells, thereby helping to control tumor growth and progression, improve the effectiveness of traditional treatments such as surgery, radiotherapy, and chemotherapy, and reduce the risk of tumor recurrence and metastasis, thereby improving patient prognosis. The compound is significantly better than NAG in inhibiting tumor cell proliferation, and the above-mentioned effects are also significantly better than aspirin, and the IC 50 Lower.
[0008] In vivo experiments have shown that in xenograft models, the compound can significantly slow down the growth rate of tumors, thereby slowing the progression of the disease; it can also cause tumor regression, improve histopathological results, and contribute to tumor prevention and prognosis recovery; at the same time, it shows no obvious toxicity in major organs.
[0009] Therefore, 6-O-carboxymethyl-N-acetylglucosamine has the potential to be a new generation of anti-tumor drugs and has higher efficacy and safety than aspirin.
[0010] Currently, no relevant reports on 6-O-carboxymethyl-N-acetylglucosamine have been found. The compound provided by the present invention provides a new option for cancer treatment.
[0011] A second aspect of the present invention provides a method for preparing the above-mentioned 6-O-carboxymethyl-N-acetylglucosamine, comprising the following steps: S1. Dissolve N-acetylglucosamine in 40% to 60% v / v ethanol aqueous solution, adjust the pH to 8.5 to 12, and react in an ice bath for 2 to 12 hours. S2. Add chloroacetic acid and potassium carbonate, react at 40-50° C. for 4-12 hours, and then adjust the pH to 6-8 with hydrochloric acid. The resulting reaction solution contains the 6-O-carboxymethyl-N-acetylglucosamine.
[0012] To synthesize 6-O-carboxymethyl-N-acetylglucosamine (Formula I), the present invention employs an O-carboxymethylation strategy. In this preparation method, after adjusting the pH to 8.5-12, the C-6 hydroxyl group of NAG is first activated with KOH to generate an alkoxy intermediate. Subsequently, due to steric hindrance at the C-1, C-3, and C-4 positions, regioselectivity allows chloroacetic acid to selectively undergo an SN2 nucleophilic substitution reaction with this intermediate, thereby forming a carboxymethyl group in a single step to obtain 6-O-carboxymethyl-N-acetylglucosamine. This preparation method is suitable for both laboratory-scale trials and is easily scalable to large-scale production.
[0013] Preferably, the concentration of the ethanol aqueous solution in S1 is 50% v / v.
[0014] Preferably, the pH in S1 is adjusted to 8.5.
[0015] Preferably, the pH regulator used to adjust the pH in S1 is an aqueous solution of potassium hydroxide.
[0016] Further preferably, the concentration of the potassium hydroxide aqueous solution is 0.1 M.
[0017] Preferably, the reaction time in the ice bath in S1 is 2 hours.
[0018] Preferably, the molar ratio of the N-acetylglucosamine to the chloroacetic acid is 1:(3-5).
[0019] Further preferably, the molar ratio of the N-acetylglucosamine to the chloroacetic acid is 1:3.
[0020] Preferably, the amount of the chloroacetic acid to the potassium carbonate is 3: (1-2).
[0021] Further preferably, the amount of the chloroacetic acid and the potassium carbonate is 3:2.
[0022] Preferably, the reaction temperature in S2 is 40° C. and the reaction time is 4 hours.
[0023] Preferably, the concentration of the hydrochloric acid in S2 is 0.5 M.
[0024] By controlling the reagent concentration, solvent, reaction temperature and reaction time, the degree of carboxyl substitution at the C-6 position can be maximized in the synthesis of 6-O-carboxymethyl-N-acetylglucosamine, thereby improving the yield of the final product.
[0025] Preferably, the preparation method further comprises separating and purifying the reaction solution by preparative chromatography, wherein the chromatographic column of the preparative chromatography is an amino column, the mobile phase is acetonitrile: water = 90:10, isocratic elution, a flow rate of 3.0 mL / min, a column temperature of 25°C, and a detector wavelength of 210 nm; the eluate is collected at the peak elution time, and the eluate contains purified 6-O-carboxymethyl-N-acetylglucosamine. The above reaction solution contains unreacted N-acetylglucosamine and the by-product potassium chloroacetate. After separation and purification under these chromatographic conditions, the purity of the 6-O-carboxymethyl-N-acetylglucosamine in the eluate is significantly improved.
[0026] Further preferably, the amino column is YMC-Pack ODS-A, with a specification of 250 mm×10 mm and 5.0 μm.
[0027] More preferably, the eluate is collected within 9 to 10 minutes.
[0028] Further preferably, the separation and purification method further comprises concentrating and drying the eluate to obtain solid 6-O-carboxymethyl-N-acetylglucosamine.
[0029] The third aspect of the present invention provides the use of the above-mentioned 6-O-carboxymethyl-N-acetylglucosamine in the preparation of anti-tumor drugs.
[0030] 6-O-carboxymethyl-N-acetylglucosamine can effectively inhibit tumor cell proliferation, induce cancer cell apoptosis, inhibit the formation of tumor cell colonies, significantly reduce tumor cell migration and invasion, slow down tumor growth rate, and can cause tumor regression and improve histopathological results. Therefore, it can be used to prepare anti-tumor drugs.
[0031] Preferably, the anti-tumor drug is an anti-colorectal cancer drug.
[0032] Preferably, the anti-tumor drug is an anti-pancreatic cancer drug.
[0033] Preferably, the dosage form of the drug is an oral dosage form.
[0034] The beneficial effects of the present invention are: The present invention provides a novel N-acetylglucosamine derivative, 6-O-carboxymethyl-N-acetylglucosamine. In vitro experiments have demonstrated that this compound can significantly inhibit the proliferation, migration, and invasion of colorectal and pancreatic cancer cells and induce apoptosis by upregulating PCK2, a key regulator of gluconeogenesis. Its efficacy is superior to that of aspirin in all respects, and its anticancer activity is significantly higher than that of NAG. In vivo experiments based on xenograft models have demonstrated that, compared with aspirin, this compound can more significantly reduce tumor growth and improve histopathological findings, without exhibiting significant toxicity in major organs, demonstrating enhanced efficacy and safety. Therefore, this compound is expected to become a new option for cancer treatment. The present invention also provides a method for preparing 6-O-carboxymethyl-N-acetylglucosamine. This method uses a one-step carboxymethylation chemical modification technique to carboxymethylate the C-6 hydroxyl group of NAG, resulting in the efficient synthesis of 6-O-carboxymethyl-N-acetylglucosamine. The process is simple and controllable, making it suitable for both laboratory-scale trials and large-scale production. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 This is a schematic diagram of the reaction process in Example 1 of the present invention; Figure 2 The results of high performance liquid chromatography (HPLC) analysis of the reactants, reaction mixture, and final product in Example 1 of the present invention are shown; in the figure, a is potassium chloroacetate, b is NAG, c is the CM-NAG reaction mixture, and d is solid CM-NAG; Figure 3 FTIR spectra of NAG and CM-NAG in Example 1 of the present invention; Figure 4 This is the secondary mass spectrum of CM-NAG in negative ion mode in Example 1 of the present invention; Figure 5 The results of cell viability analysis of SW480 cells (Figure A) and MIA PACA-2 cells (Figure B) treated with NAG, aspirin, and CM-NAG in Example 4 of the present invention for 48 hours; *** indicates P < 0.001 compared with NAG; Figure 6 The IC values of aspirin (Figure A) or CM-NAG (Figure B) in Example 4 of the present invention after 48 hours of treatment on SW480 cells are shown in Table 1. 50 ; Figure 7 The IC values of aspirin (Figure A) or CM-NAG (Figure B) in Example 4 of the present invention after 48 hours of treatment on MIA PACA-2 cells are shown in Table 1. 50 ; Figure 8The morphological analysis results of SW480 cells treated with aspirin or CM-NAG in Example 4 of the present invention are shown; Figure 9 The morphological analysis results of MIA PACA-2 cells treated with aspirin or CM-NAG in Example 4 of the present invention are shown; Figure 10 Representative images and statistical analysis results of the SW480 cell clone formation experiment treated with aspirin or CM-NAG in Example 4 of the present invention; *** indicates P < 0.001 compared with the blank control; Figure 11 Representative images and statistical analysis results of the scratch test on SW480 cells treated with aspirin or CM-NAG in Example 4 of the present invention; ** indicates P < 0.05 compared with the blank control; Figure 12 Representative images and statistical analysis results of the transwell assay of SW480 cells treated with aspirin or CM-NAG in Example 4 of the present invention; ** indicates P < 0.05 compared with the blank control, *** indicates P < 0.001 compared with the blank control; Figure 13 The results of apoptosis analysis of SW480 cells after treatment with aspirin or CM-NAG for 48 hours in Example 4 of the present invention are shown; Figure 14 Western blot images and quantitative analysis results of BCL-2 in SW480 cells after treatment with aspirin or CM-NAG for 48 hours in Example 4 of the present invention; *** indicates P < 0.001; Figure 15 This is a volcano plot of gluconeogenesis-related genes in RNA-Seq in Example 4 of the present invention; Figure 16 Western blot images and quantitative analysis results of PCK2 in SW480 cells after treatment with aspirin or CM-NAG for 48 hours in Example 4 of the present invention; *** indicates P < 0.001 compared with the blank control; Figure 17 qPCR analysis and cell viability analysis of PCK2 in SW480 control cells (PCK2-Ctrl, not overexpressing PCK2) and PCK2-overexpressing SW480 cells (PCK2-OE) in Example 4 of the present invention; *** indicates P < 0.001; Figure 18 The tumor volumes of each group in Example 5 of the present invention; *** indicates P < 0.001; Figure 19 The tumor size and mass of each group in Example 5 of the present invention; *** indicates P < 0.001; Figure 20 Representative HE images and Ki-67 stained IHC images of tumor tissues in each group in Example 5 of the present invention; Figure 21 Representative HE images of the heart, liver, spleen, lung, and kidney tissues in Example 5 of the present invention; Figure 22 These are representative IHC images of PCK2 staining in each group of tumors in Example 5 of the present invention. DETAILED DESCRIPTION
[0036] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.
[0037] Aspirin is widely recognized for its anti-inflammatory and cardioprotective effects and has also shown potential as a cancer treatment drug, demonstrating significant therapeutic effects in digestive system cancers (especially colorectal cancer and pancreatic cancer). However, its clinical application is hampered by serious adverse reactions. Glucosamine has potential anticancer activity, but IC for cancer cells is limited. 50 This limits its clinical application.
[0038] The present invention provides a novel N-acetylglucosamine derivative, 6-O-carboxymethyl-N-acetylglucosamine, whose structural formula is shown in Formula I:
[0039] Formula I Experiments have found that this compound can effectively inhibit the proliferation of colorectal cancer and pancreatic cancer cells, induce cancer cell apoptosis, inhibit the formation of tumor cell colonies, significantly reduce the migration and invasion of tumor cells, slow down the growth rate of tumors, and even cause tumor regression. 50 It has a lower risk of allergic reaction and no obvious toxicity to major organs. Compared with aspirin, it has higher efficacy and safety, and is expected to become a new generation of anti-tumor drug.
[0040] The present invention also provides a method for preparing 6-O-carboxymethyl-N-acetylglucosamine, comprising the following steps: S1. Dissolve N-acetylglucosamine in 40% to 60% v / v ethanol aqueous solution, adjust the pH to 8.5 to 12, and react in an ice bath for 2 to 12 hours. S2. Add chloroacetic acid and potassium carbonate, react at 40-50° C. for 4-12 hours, and then adjust the pH to 6-8 with hydrochloric acid. The resulting reaction solution contains the 6-O-carboxymethyl-N-acetylglucosamine.
[0041] In this preparation method, the reaction solution obtained in S2 can be further separated and purified by preparative chromatography to obtain a product of higher purity. The chromatographic conditions for preparative chromatography are: an amino column, a mobile phase of acetonitrile:water = 90:10, isocratic elution, a flow rate of 3.0 mL / min, a column temperature of 25°C, and a detector wavelength of 210 nm. The eluate is collected at the peak elution time, and the resulting eluate contains the purified 6-O-carboxymethyl-N-acetylglucosamine.
[0042] The solutions of the present invention are described below through specific embodiments.
[0043] The reagents in the following examples are as follows: N-acetylglucosamine was homemade in the laboratory (purity ≥99%) and characterized. The colorectal cancer cell line SW480 and the pancreatic cancer cell line MIA-PaCa2 were purchased from the American Type Culture Collection (ATCC, USA). All solvents used for synthesis were purchased from Sinopharm Chemical Reagent Company (China). All solvents used for high-performance liquid chromatography (HPLC) were purchased from Tedia (USA). Antibodies against BCL-2, PCK2, and GAPDH were purchased from Proteintech (China), and polyamide was purchased from Sigma. Antibodies against Ki-67 were purchased from Roche (USA). Hematoxylin-eosin staining kit (H&E) was purchased from Solebol (China). CCK8 kit, Annexin V-Alexa Fluor 647 / PI kit, and TRIeasy TM Total RNA extraction reagents were purchased from Yeasen (China). Matrigel was purchased from Corning Incorporated (USA). L-15 medium, DMEM medium, fetal bovine serum, and penicillin-streptomycin were purchased from Gibco for cell culture. Paraformaldehyde and crystal violet were purchased from BioSharp for colony formation experiments. Protease inhibitors, phosphatase inhibitors, RIPA buffer, and BCA assay kits were purchased from Beyotime for immunoblotting, PVDF membranes were purchased from Millipore, and the ultrasensitive chemiluminescent substrate detection kit was purchased from Elabscience. HiScript III reverse transcriptase, Taq Pro Universal SYBR qPCR Master Mix, and the VAHTS Universal V8 RNA-Seq Library Prep Kit for MGI were purchased from Vazyme for RT-qPCR and library construction.
[0044] Unless otherwise specified, all other reagents, drugs, or instruments used in the following examples are commercially available products. The methods used in the following examples are conventional methods in the art unless otherwise specified.
[0045] Example 1 This example provides 6-O-carboxymethyl-N-acetylglucosamine (named CM-NAG) and a preparation method thereof.
[0046] 1. Preparation of CM-NAG 1.1 Synthesis of CM-NAG Purified NAG (2.0 g, 9.04 mmol, 1 equiv.) was finely ground and dissolved in 20 mL of 50% v / v aqueous ethanol. The pH was adjusted to 8.5 with 0.1 M KOH (w / w). The reaction mixture was stirred in an ice bath for 2 hours. Chloroacetic acid (2.56 g, 27.12 mmol, 3 equiv.) and potassium carbonate (K2CO3) (2.49 g, 18.08 mmol, 2 equiv.) were slowly added to the NAG mixture. The reaction mixture was stirred at 40°C for 4 hours. The pH was then adjusted to 7 with 0.5 M HCl to obtain a reaction solution containing CM-NAG.
[0047] The reaction process is as follows Figure 1 shown.
[0048] 1.2 Separation and purification The reaction solution obtained in 1.1 was separated and purified using preparative HPLC under the following conditions: a YMC-Pack ODS-A column (250 mm × 10 mm, 5.0 µm); a mobile phase of acetonitrile:water (90:10), isocratic elution at a flow rate of 3.0 mL / min, an injection volume of 80 µL, a column temperature of 25°C, and a detector wavelength of 210 nm. The eluate was collected between 9 and 10 minutes. The resulting eluate was concentrated by rotary evaporation at 40°C and freeze-dried in vacuo to obtain solid CM-NAG. The yield of CM-NAG was 67.2%, and its purity was 95%.
[0049] 2. Structural characterization 2.1 HPLC analysis The solid CM-NAG obtained in 1.2 was dissolved in deionized water (concentration approximately 50 mg / mL) with shaking, filtered through a 0.22 µm filter, and analyzed by HPLC. HPLC analysis was performed using a Wooking K2025 HPLC system (Wooking Instrument, China) equipped with a quaternary pump, an online degasser, a UV detector, and a thermostatically controlled column compartment. A Zafex Acutfex YS-NH2 analytical column (2500 × 4.6 mm ID, 5 µm) was used. Acetonitrile and water were used as mobile phases A and B, respectively. Isocratic elution conditions were: 80% phase A, a flow rate of 1.0 mL / min, an injection volume of 20 µL, and detection at 210 nm.
[0050] The potassium chloroacetate, NAG and the reaction solution containing CM-NAG obtained in 1.1 were subjected to HPLC analysis under the same chromatographic conditions. The HPLC analysis results are as follows: Figure 2 As shown, the reaction solution containing CM-NAG contains a lot of impurities. According to the peak time of the impurities, the impurities are mainly composed of unreacted NAG and the by-product potassium chloroacetate. After preparative chromatography separation in 1.2, the obtained solid CM-NAG is relatively pure.
[0051] 2.2 Fourier transform infrared spectroscopy (FTIR) analysis The sample was mixed with potassium bromide (KBr) at a ratio of 1:10 (w / w) and pressed into 1 mm thick KBr pellets. FTIR spectra were obtained using a Vertex 70 FTIR spectrometer (Germany) with a measurement range of 4000 to 400 cm -1 , with a resolution of 4 cm -1 , with an interval of 1 cm -1 Each spectrum was subtracted from the background.
[0052] like Figure 3 As shown in the figure, the infrared spectrum of NAG shows the basic characteristic absorption peak of NAG: 1019 cm -1 (C-O stretching vibration), 1548 cm -1 、1628 cm -1 (CON-H bending vibration), 2891 cm -1 (C-H stretching vibration) and 3459 cm -1 (O-H stretching vibration). In contrast, CM-NAG has a peak at 1742 cm -1 and 1206 cm -1 There are additional absorption peaks at - ) of C=O bond and C-O-C ether bond. In addition, 942 cm -1The decrease in the absorption intensity at OH-6 confirms the selective carboxymethylation at the OH-6 position.
[0053] 2.3 Mass spectrometry (MS) analysis Mass spectrometry analysis was performed using a Sciex X500B QTOF in information-dependent acquisition (IDA) mode. Parameters were as follows: (i) Positive ion mode: declustering voltage = 50 V, collision energy = 10 V, ion spray voltage = 5500 V; (ii) Negative ion mode: declustering voltage = -80 V, collision energy = -10 V, ion spray voltage = -4500 V; (iii) Both ion source gases were maintained at 50 psi, and the source temperature was set to 500°C; (iv) Mass spectrometry scan range: 100–1000 m / z. Total scan time: 0.713 s; (v) Both positive and negative ion modes were used simultaneously.
[0054] Mass spectrometry analysis results Figure 4 The molecular formula of CM-NAG was determined to be C 10 H 17 NO8, quasi-molecular ion [MH] - Detected at m / z 278.0873 (calculated value: [C 10 H 17 NO8-H] - The characteristic peaks of CM-NAG synthesized by the above method appear at m / z 75.0087 and 59.0143, respectively, which are attributed to O-carboxymethyl (OCH2COO - ) and carboxymethyl (CH2COO - ) fragment ions; in addition, the fragment peaks at m / z 100.0411, 112.0417, and 119.0347 confirmed that the C-6 position of NAG had undergone O-carboxymethylation, which was consistent with the FTIR results.
[0055] The above analysis results confirmed that the present invention successfully synthesized CM-NAG.
[0056] Example 2 This example provides 6-O-carboxymethyl-N-acetylglucosamine (named CM-NAG) and a preparation method thereof.
[0057] 1. Synthesis of CM-NAG Purified NAG (2.0 g, 9.04 mmol, 1 equiv.) was finely ground and dissolved in 20 mL of 40% v / v aqueous ethanol. The pH was adjusted to 10 with 0.1 M KOH (w / w). The reaction mixture was stirred in an ice bath for 7 hours. Chloroacetic acid (3.42 g, 36.16 mmol, 4 equiv.) and potassium carbonate (1.67 g, 12.05 mmol, 1.33 equiv.) were slowly added to the NAG mixture. The reaction mixture was stirred at 45°C for 8 hours. The pH was then adjusted to 6 with 0.5 M HCl to obtain a reaction solution containing CM-NAG.
[0058] 2. Separation and purification The reaction solution obtained in 1.1 was separated and purified using preparative HPLC under the following conditions: a YMC-Pack ODS-A column (250 mm × 10 mm, 5.0 µm); a mobile phase of acetonitrile:water (90:10), isocratic elution at a flow rate of 3.0 mL / min, an injection volume of 80 µL, a column temperature of 25°C, and a detector wavelength of 210 nm. The eluate was collected between 9 and 10 minutes. The resulting eluate was concentrated by rotary evaporation at 40°C and freeze-dried in vacuo to obtain solid CM-NAG.
[0059] Example 3 This example provides 6-O-carboxymethyl-N-acetylglucosamine (named CM-NAG) and a preparation method thereof.
[0060] 1. Synthesis of CM-NAG Purified NAG (2.0 g, 9.04 mmol, 1 equiv.) was finely ground and dissolved in 20 mL of 60% v / v aqueous ethanol. The pH was adjusted to 12 with 0.1 M KOH (w / w). The reaction mixture was stirred in an ice bath for 12 hours. Chloroacetic acid (4.27 g, 45.20 mmol, 5 equiv.) and potassium carbonate (4.16 g, 30.13 mmol, 3.33 equiv.) were slowly added to the NAG mixture. The reaction mixture was stirred at 50°C for 12 hours. The pH was then adjusted to 8 with 0.5 M HCl to obtain a reaction solution containing CM-NAG.
[0061] 2. Separation and purification The reaction solution obtained in 1.1 was separated and purified using preparative HPLC under the following conditions: a YMC-Pack ODS-A column (250 mm × 10 mm, 5.0 µm); a mobile phase of acetonitrile:water (90:10), isocratic elution at a flow rate of 3.0 mL / min, an injection volume of 80 µL, a column temperature of 25°C, and a detector wavelength of 210 nm. The eluate was collected between 9 and 10 minutes. The resulting eluate was concentrated by rotary evaporation at 40°C and freeze-dried in vacuo to obtain solid CM-NAG.
[0062] Example 4 This example uses tumor cells to verify the anti-tumor activity of CM-NAG. The CM-NAG used in the following experiments was prepared in Example 1.
[0063] 1. Experimental methods 1.1 Cell culture SW480 cells were cultured in Leibovitz's L-15 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. MIA PaCa-2 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. Culture conditions were 37°C with 5% CO2.
[0064] 1.2 Cell proliferation assay SW480 cells and MIA PaCa-2 cells were seeded at a density of 5,000 cells per well in 96-well plates. After 24 hours of culture, cells were treated with 0.1, 0.3, 1, 3, 10, or 30 mM NAG, aspirin, or CM-NAG for 48 hours. Cell viability was assessed using the CCK-8 assay, and absorbance was measured at 450 nm using a spectrophotometer (Molecular Devices, USA). The IC values were calculated from dose-response curves using Graph Pad Prism 9.0 software. 50 value.
[0065] 1.3 Cell morphology observation experiment SW480 cells and MIA PaCa-2 cells were cultured at 10 per well. 5 The cells were seeded at a density of 100 μg / mL in a 12-well plate and cultured for 24 h. The cells were treated with 0.25 mM CM-NAG and 0.25 mM aspirin for 48 h, and then observed in the bright field and photographed at 0 h, 24 h, and 48 h, respectively.
[0066] 1.4 Clone formation assay SW480 cells were seeded at a density of 1000 cells per well in 6-well plates and cultured for 24 hours before being treated with 0.25 mM aspirin or CM-NAG and incubated for 8 days. Subsequently, the cells were fixed with 4% paraformaldehyde for 25 minutes, stained with crystal violet for 20 minutes, and imaged using a light microscope (Nikon, Japan).
[0067] 1.5 Scratch test and cell migration assay Given the key role of epithelial-mesenchymal transition in the progression of colorectal cancer, this study evaluated the migration and invasion abilities of cells using wound healing assay and Transwell assay.
[0068] Wound wound assay: SW480 cells and MIA PaCa-2 cells were seeded in 6-well plates and cultured to 90% confluence. A straight wound was created using a sterile pipette tip. Detached cells were washed with PBS. Subsequently, cells were treated with 0.25 mM aspirin or CM-NAG and imaged using light microscopy at 12, 24, and 36 hours. The images were analyzed using ImageJ software.
[0069] Cell migration assay: 5×10 4 SW480 cells or MIA PaCa-2 cells were suspended in 200 μL of serum-free medium and seeded into Matrigel-coated Transwell inserts (6.5 mm diameter, 8.0 μm pore size). The lower chamber was filled with 500 μL of complete medium containing 20% fetal bovine serum (FBS) and either NAG, aspirin, or CM-NAG. After incubation at 37°C for 36 hours, cells on the upper surface of the membrane were removed. Cells that had invaded the lower surface of the membrane were fixed with 4% paraformaldehyde for 30 minutes, stained with crystal violet, and quantitatively analyzed in five randomly selected fields under a light microscope (Nikon, Japan).
[0070] 1.6 Cell apoptosis detection Aspirin irreversibly inhibits cyclooxygenase (COX), reduces the synthesis of prostaglandins, and thus induces apoptosis of cancer cells. To evaluate whether CM-NAG has a stronger ability to induce apoptosis of cancer cells, this experiment used the Annexin V-AlexaFluor 647 / PI kit to detect the apoptosis of SW480 cells. SW480 cells were seeded in a 96-well plate at a density of 5000 per well. After 24 hours of culture, the cells were treated with 0.5 mM CM-NAG and 1 mM aspirin for 48 hours. 5The treated SW480 cells were incubated with 5 μL Alexa Fluor 647-Annexin V and 5 μL propidium iodide (PI) at room temperature for 15 min in the dark and then analyzed by flow cytometry on an LSRⅡ instrument (Beckman Coulter Life Sciences).
[0071] 1.7 Immunoblotting RIPA buffer containing protease inhibitors and phosphatase inhibitors was used as cell lysis buffer. SW480 cells were plated at 10 5 Cells were seeded at a density of 100 μg / well in 12-well plates. After 24 hours of culture, cells were treated with 0.5 mM CM-NAG and 0.5 mM aspirin for 48 hours. The cell culture medium was then aspirated, and the cells were washed three times with pre-chilled PBS. Cell lysis buffer (with protease inhibitors added within 2 minutes before use) was added. Adherent cells were repeatedly pipetted on ice with a pipette tip and transferred to a fresh centrifuge tube. The tubes were incubated on ice for 30 minutes, with mixing every 10 minutes. After lysis, the cells were centrifuged at 12,000 rpm for 20 minutes at 4°C. The protein concentration of the supernatant (hereafter referred to as the protein lysate) was determined using a BCA assay. Twenty μg of the protein lysate was separated on an SDS-PAGE gel and transferred to a PVDF membrane. The membrane was blocked with 5% nonfat dry milk, incubated with the primary antibody overnight at 4°C, and then washed. The membrane was incubated with the secondary antibody for 1 hour at room temperature. The membrane was then washed and developed using an ultrasensitive chemiluminescent substrate detection kit. The protein concentration was quantified using the OI600 system (Guangyi). Western blotting experiments used the following antibodies (dilution factor in brackets): anti-BCL-2 (1:2000), anti-PCK2 (1:5000), and anti-GAPDH (1:5000).
[0072] 1.8 RNA extraction and RT-qPCR Place SW480 at 10 per well 5 The cells were seeded at a density of 100 μg / mL in a 12-well plate and cultured for 24 hours. After 48 hours of treatment with 0.5 mM CM-NAG and 0.25 mM aspirin, the cells were harvested and RNA was extracted for RNA sequencing. TM Total RNA was isolated using a total RNA extraction reagent, precipitated, washed with 70% ethanol, and finally dissolved in water. One microgram of total RNA was reverse transcribed using random hexanucleotide primers and HiScript III reverse transcriptase. RT-qPCR reactions were performed on a CFX96 instrument using 20 ng of cDNA per reaction and Taq Pro Universal SYBR qPCR Master Mix. All gene expression values were normalized to GAPDH. Gene-specific primers used for all PCR-based analyses were as follows: Human PCK2: Forward primer: GAATACTGCCACACTGACCC; Reverse primer: GAGAAGGAGTTACAATCACCGT; GAPDH: Forward primer: GGCTGAGAACGGGAAGCTTGTCAT; Reverse primer: CAGCCTTCTCCATGGTGGTGAAGA.
[0073] 1.9 Transcriptome Sequencing Analysis Libraries were prepared from 1 μg of RNA extracted in Section 1.8 using the VAHTS Universal V8 RNA-Seq Library Prep Kit for MGI. Sequencing was performed on the MGI-SEQ 2000 platform. Reads were aligned to the GRCh38 human genome using HISAT2, and differential gene expression analysis was performed using DESeq2.
[0074] 1.10 Packaging of PCK2 Overexpression Lentivirus PCK2 cDNA was amplified by PCR and subcloned into a laboratory-designed FUW-pEF1a-IRES-Puro vector. The coding region was verified by sequencing. PCK2-overexpressing lentivirus was packaged using HEK293FT cells (ATCC), concentrated by ultracentrifugation (50,000 g, 1.5 hours), resuspended in PBS, and stored at −80°C. For lentiviral transduction of SW480 cells, cells were mixed with virus at a multiplicity of infection (MOI) of 5 and seeded in 6-well plates containing 8 mg / mL polybrene. After incubation with virus for 4 hours, cells were washed with PBS and supplemented with fresh culture medium to generate PCK2-overexpressing SW480 cells (PCK2-OE). PCK2 mRNA expression levels were measured in wild-type SW480 cells (PCK-Ctrl) and SW480 cells overexpressing PCK2.
[0075] 1.11 Statistical Analysis The results were analyzed using SPSS 19.0.0 and Graph Pad Prism 9.0. All data are presented as the mean ± standard deviation (SD) of at least three independent experiments. Statistical significance was determined using an unpaired t-test or one-way analysis of variance. A p-value < 0.05 was considered statistically significant.
[0076] 2. Experimental results 2.1 CCK-8 assay results CCK-8 assay Figures 5 to 7 As shown: In SW480 ( Figure 5 A in the figure) and MIA-PaCa-2 cells ( Figure 5 In Figure B), both CM-NAG and aspirin showed significant inhibitory effects, and CM-NAG showed a stronger inhibitory effect than aspirin, while NAG had no ability to inhibit tumor cell proliferation at the experimental concentrations. In SW480 cells, the IC 50 The value was 0.85 mM, while the IC 50 The value is 0.23 mM ( Figure 6 ); In MIA-PaCa-2 cells, the IC of aspirin 50 The value was 5.77 mM, while the IC 50 The value is 0.26 mM ( Figure 7 ).
[0077] 2.2 Cell morphology observation results like Figure 8 、 Figure 9 As shown in the figure, after 48 hours of treatment with 0.25 mM aspirin or CM-NAG, both cell lines showed morphological changes different from those of the control cells, including reduced cell size and membrane blebbing, and the changes after CM-NAG treatment were more significant.
[0078] 2.3 Results of clone formation experiments like Figure 10 As shown, the colony formation assay showed that both aspirin and CM-NAG significantly inhibited colony formation, and the colony formation was significantly reduced compared with the control group, and CM-NAG showed a stronger effect at 0.25 mM.
[0079] 2.3 Results of scratch test and cell migration assay like Figure 11 and Figure 12 As shown, CM-NAG treatment significantly reduced cell migration ( Figure 11 ) and invasive ability ( Figure 12 ), the effect was better than that of the control group and aspirin group.
[0080] The experimental data of 2.2~2.3 showed that CM-NAG was a stronger in vitro anticancer drug candidate compared with aspirin.
[0081] 2.4 Cell apoptosis results Flow cytometric analysis showed that (e.g. Figure 13 CM-NAG induced apoptosis in SW480 cells more potently than aspirin.
[0082] 2.5 Immunoblotting results like Figure 14 As shown in the figure, CM-NAG can significantly downregulate the expression level of the anti-apoptotic protein BCL-2.
[0083] The results of clone formation assay and immunoblotting assay showed that CM-NAG could reduce the proliferation and spread of SW480 cells in vitro, helping to control tumor growth and progression. These data indicate that CM-NAG is a stronger in vitro anticancer drug candidate than aspirin.
[0084] 2.6 RNA sequencing results CM-NAG is a monosaccharide that forms a sugar ring and has a major structural difference from aspirin. It is speculated that gluconeogenesis may be related to apoptosis through metabolic stress response, redox regulation, and energy homeostasis, and may be dysregulated under CM-NAG treatment. This experiment found that only PCK2 and HKDC1 were enriched more than 2-fold compared with the control group and aspirin-treated SW480 cells by searching for genes related to gluconeogenesis annotated by KEGG. PCK2 showed significant enrichment, such as Figure 15 This result was also confirmed by Western blot analysis, as shown in Figure 16 shown.
[0085] 2.7 PCK2 expression in SW480 cells like Figure 17 As shown, the proliferation ability of the PCK2 overexpressing cell line was significantly weaker than that of the PCK2 wild-type cell line, indicating that overexpression of PCK2 in SW480 cells led to a significant decrease in the proliferation rate of tumor cells and PCK2 was a key mediator of CM-NAG-induced apoptosis.
[0086] Example 5 This example demonstrates the in vivo anti-tumor potential of CM-NAG. The CM-NAG used in the following experiments was prepared in Example 1.
[0087] 1. Experimental methods 1.1 Xenotransplantation Male BALB / c nude mice (4 weeks old, weighing 16–25 g) were purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd. (Shandong, China) and housed at 22–25°C with a 12-h light / dark cycle. All animal experiments were approved by the Experimental Animal Ethics and Use Committee of Qilu University of Technology (No. 24-HB08-M5). SW480 cells (4 × 10 6) were suspended in PBS and mixed with Matrigel (1:1) before being subcutaneously injected into the left abdomen of mice. Mice were randomly divided into three groups (n=6 per group): (i) control group (normal saline); (ii) aspirin group (ASP, 50 mg / kg body weight); (iii) CM-NAG group (50 mg / kg body weight). Each group was given the drug daily by oral gavage for 12 days. The tumor volume was calculated as follows: volume = 1 / 2 × (length × width 2 After the experiment, tumor tissues were collected, weighed, and subjected to histological analysis and immunohistochemistry (IHC) analysis.
[0088] 1.2 Histological analysis Tumor tissues, as well as heart, liver, spleen, lung, and kidney tissues, were fixed in 4% paraformaldehyde, embedded in paraffin, and cut into 4-μm-thick sections. The sections were dried at room temperature for 24 hours, dewaxed in xylene, rehydrated through graded ethanol solutions, stained with hematoxylin and eosin (H&E), and imaged using a light microscope (Nikon, Japan).
[0089] 1.3 Immunohistochemistry (IHC) staining Sections from section 1.2 were incubated with primary antibodies overnight at 4°C, washed, incubated with secondary antibodies, stained with diaminobenzidine tetrachloride (DAB), counterstained with hematoxylin, and imaged using a light microscope (Nikon, Japan). The following antibodies were used for IHC experiments (dilution ratios are shown in parentheses): anti-Ki-67 (1:1) and anti-PCK2 (1:400).
[0090] 1.4 Statistical analysis The results were analyzed using SPSS 19.0.0 and Graph Pad Prism 9.0. All data are presented as the mean ± standard deviation (SD) of at least three independent experiments. Statistical significance was determined using an unpaired t-test or one-way analysis of variance. A p-value < 0.05 was considered statistically significant.
[0091] 2. Experimental results 2.1 Histological analysis and IHC staining results like Figure 18 As shown in Figure 3, the tumor growth rate of CM-NAG-treated mice was significantly slower than that of the control and aspirin-treated groups during the administration period; Figure 19As shown, at the end of the experiment, the tumors in CM-NAG-treated mice were significantly smaller than those in the control and aspirin-treated groups, demonstrating the potential of CM-NAG as an effective anti-tumor drug in vivo. Hematoxylin-eosin staining showed that the control tumors exhibited irregular morphology, darkly stained nuclei, and dense cell arrangement, while aspirin and CM-NAG treatment led to significant tumor regression, with CM-NAG showing a stronger effect. Ki-67 staining showed that the proliferation rate of CM-NAG-treated tumors was significantly reduced compared with the control and aspirin-treated groups ( Figure 20 These data indicate that CM-NAG not only reduced tumor size but also improved tumor morphology and decreased cell proliferation, suggesting that it has a potent antitumor effect in vivo.
[0092] H&E staining results of heart, liver, spleen, lung and kidney tissues ( Figure 21 ) showed that CM-NAG had no obvious toxicity to these organs.
[0093] 2.2 Immunohistochemical analysis results like Figure 22 As shown, PCK2 was upregulated in CM-NAG-treated tumors, but not in control or aspirin-treated tumors. This indicates that CM-NAG-induced PCK2 upregulation is also confirmed in solid tumors. This experimental result further demonstrates that PCK2 is a key mediator of CM-NAG-induced apoptosis.
[0094] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. 6-O-carboxymethyl-N-acetylglucosamine, characterized in that Its structural formula is shown in Formula I: Formula I.
2. The method for preparing 6-O-carboxymethyl-N-acetylglucosamine according to claim 1, wherein The following steps are involved: S1. Dissolve N-acetylglucosamine in 40% to 60% v / v ethanol aqueous solution, adjust the pH to 8.5 to 12, and react in an ice bath for 2 to 12 hours. S2. Add chloroacetic acid and potassium carbonate, react at 40-50° C. for 4-12 hours, and then adjust the pH to 6-8 with hydrochloric acid. The resulting reaction solution contains the 6-O-carboxymethyl-N-acetylglucosamine.
3. The preparation method according to claim 2, characterized in that The concentration of the ethanol aqueous solution in S1 is 50% v / v; and / or Adjust the pH in S1 to 8.5; and / or The pH regulator used to adjust the pH in S1 is a potassium hydroxide aqueous solution; and / or The reaction time in the ice bath in S1 is 2 hours; and / or The molar ratio of the N-acetylglucosamine to the chloroacetic acid is 1:(3-5); and / or The amount of the chloroacetic acid and the potassium carbonate is 3: (1-2); and / or The reaction temperature in S2 is 40° C. and the reaction time is 4 hours; and / or The concentration of hydrochloric acid in S2 is 0.5 M.
4. The preparation method according to claim 2 or 3, characterized in that The preparation method also includes separating and purifying the reaction solution by preparative chromatography, wherein the chromatographic column of the preparative chromatography is an amino column, the mobile phase is acetonitrile:water = 90:10, isocratic elution, the flow rate is 3.0 mL / min, the column temperature is 25°C, and the detector wavelength is 210 nm; the eluate is collected at the peak elution time, and the eluate contains the purified 6-O-carboxymethyl-N-acetylglucosamine.
5. The preparation method according to claim 4, characterized in that The amino column is YMC-Pack ODS-A, with a specification of 250 mm×10 mm and a diameter of 5.0 μm; and / or Collect the eluate at 9-10 minutes; and / or The separation and purification method further comprises concentrating and drying the eluate.
6. Use of the 6-O-carboxymethyl-N-acetylglucosamine according to claim 1 in the preparation of anti-tumor drugs.
7. The use according to claim 6, characterized in that The anti-tumor drug is a drug for treating colorectal cancer.
8. The use according to claim 6, characterized in that The anti-tumor drug is a drug for treating pancreatic cancer.
9. The use according to any one of claims 6 to 8, characterized in that The dosage form of the medicine is an oral dosage form.