Production and preparation method of recombinant mussel mucin rich in dopa

Abstract

The invention belongs to the technical field of recombinant protein preparation, and particularly relates to a production and preparation method of recombinant mussel mucin rich in dopa. By optimizing the gene sequence of the mussel mucoprotein and combining with a pichia pastoris expression system, efficient secretory expression of recombinant protein is realized, and the problem of low natural extraction yield is solved. The immobilized tyrosine hydroxylase is used for in-vitro dopa modification, and the enzyme can be recycled through a magnet, so that the cost is reduced, and the economy and sustainability of the modification reaction are improved. Reaction parameters are optimized, so that a suitable environment is provided for enzymatic reaction, and the dopa modification efficiency is improved. Nitrogen is used for protection in the purification process, ascorbic acid and EDTA are added into a buffer solution, oxidation inactivation of dopa is avoided, and the structural integrity and the adhesion function of the target protein are ensured. And through a combined purification strategy of anion exchange chromatography and gel filtration chromatography, impurities are effectively removed, and the high-purity dopa recombinant mussel mucin is obtained.

Description

Technical Field

[0001] The invention belongs to the technical field of recombinant protein preparation, and particularly relates to a production method for DOPA-rich recombinant mussel mucin. Background Art

[0002] Mussel adhesive proteins (MAPs) are functional proteins rich in DOPA (3,4-dihydroxyphenylalanine, DOPA) residues. Their unique DOPA modification endows them with exceptionally strong adhesion in humid environments, promising broad applications in biomedicine (e.g., tissue adhesives and wound dressings) and materials science (e.g., biocoatings and underwater adhesives). Natural mussel adhesive proteins are expensive to extract, have low yields, and are limited in availability, making them difficult to commercialize. Consequently, recombinant expression of mussel adhesives in host cells through genetic engineering has become a research hotspot.

[0003] Pichia pastoris is a commonly used recombinant protein expression system with advantages such as high secretion expression efficiency, low culture cost, and suitability for large-scale fermentation. However, the host cell itself lacks enzymes (such as tyrosine hydroxylase) that hydroxylate tyrosine to produce DOPA, resulting in the recombinantly expressed mussel mucin being usually not fully DOPA-modified and having weak adhesion properties.

[0004] Traditional in vitro DOPA modification methods can be plagued by issues such as difficulty recovering enzyme preparations, unstable reaction conditions (e.g., DOPA is easily oxidized), and low modification efficiency, limiting the large-scale production and application of recombinant mussel mucins. Furthermore, the catechol groups in the DOPA structure are susceptible to oxidation, leading to decreased protein activity. Therefore, antioxidant measures (such as the addition of ascorbic acid and maintaining an anaerobic environment) are necessary during the modification and purification process to ensure the stability and functional activity of the DOPA-modified protein.

[0005] Based on this, we proposed a production and preparation method for DOPA-rich recombinant mussel mucin, hoping to solve the shortcomings of the existing technology and provide a theoretical basis and preliminary reference for the processing of recombinant mussel mucin. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for producing and preparing DOPA-rich recombinant mussel mucin in response to existing problems.

[0007] The present invention is achieved through the following technical solutions:

[0008] A method for producing DOPA-rich recombinant mussel mucin comprises the following steps:

[0009] S1. Design an optimized recombinant mussel mucin gene sequence based on the functional domain and dopaminergic modification site of mussel mucin. The optimized gene sequence is shown in SEQ ID NO.1. The designed nucleotide sequence is sent to Sangon Biotech (Shanghai) Co., Ltd. for full gene synthesis, and the synthesized sequence is cloned into a Pichia pastoris expression vector.

[0010] S2. Transform the constructed expression vector into Pichia pastoris by electrochemical transformation, and screen for positive transformants;

[0011] S3. Select positive transformants and inoculate them into YPD medium containing bleomycin. Cultivate with shaking at 26-30°C and 180-220 rpm until the logarithmic growth phase to serve as seed solution. Inoculate the seed solution into fermentation medium at a ratio of 1:100 for fermentation. When the cells grow to an OD600 of 20-30, add methanol to induce expression.

[0012] S4. collecting the fermentation broth, centrifuging and collecting the supernatant containing the recombinant mussel mucin, performing a preliminary treatment on the supernatant by adding 0.1% Triton X-100, stirring evenly, and then performing in vitro dopaminergic modification;

[0013] S5, filtering the DOPA-modified solution through a 0.22 μm filter membrane and then performing preliminary purification and further purification treatment in sequence to obtain purified DOPA-rich recombinant mussel mucin;

[0014] S6. Detecting the content of DOPA in the recombinant mussel mucin using high performance liquid chromatography (HPLC);

[0015] The purity of recombinant mussel mucin was analyzed by SDS-PAGE electrophoresis;

[0016] The adhesion properties of recombinant mussel mucin were determined using an adhesion test device.

[0017] Furthermore, the components and contents of the fermentation medium in step S3 are: yeast extract 8-12 g / L, peptone 18-22 g / L, glycerol 18-22 g / L, K2HPO4 9-9.2 g / L, KH2PO4 11.6-12 g / L, MgSO4·7H2O 4.5-5.5 g / L, CaSO4·2H2O 0.91-0.95 g / L, KCl 3.2-3.6 g / L, and trace element solution 5.3-5.4 mL / L.

[0018] Furthermore, the components and contents of the trace element solution are: CuSO4·5H2O5-7g / L, KI 0.06-0.1g / L, Na2MoO4·2H2O 0.15-0.25g / L, H3BO3 0.05-0.07g / L, CoCl2 0.5-0.6g / L, FeSO4·7H2O 25-35g / L, ZnSO4·7H2O 18-22g / L, EDTA 45-55g / L, and concentrated sulfuric acid 4-6mL / L.

[0019] Furthermore, during the fermentation in step S3, the fermentation conditions are controlled as follows: temperature 28° C., pH 5.0-6.0, dissolved oxygen 30-50%, and nitrogen is introduced during the fermentation process to maintain an anaerobic environment.

[0020] Furthermore, during the induction expression in step S3, the final concentration of methanol is 1%, and the induction time is 65-79 hours.

[0021] Furthermore, the centrifugation conditions in step S4 are: 4° C., 4000-6000 rpm, 10-20 min.

[0022] Furthermore, the in vitro dopaminergic modification described in step S4 is as follows: immobilized tyrosine hydroxylase (coupled with magnetic microspheres) is added to the reaction system to a concentration of 10 U / mL, and Tris-HCl buffer (pH 7.0) containing 20 mM ascorbic acid (reduced form) and 1 mM EDTA is added at the same time. The total volume of the reaction system is 100 mL. Nitrogen is introduced during the reaction to maintain an anaerobic environment. The reaction is shaken at 26-30°C and 180-220 rpm for 20-28 hours. After the reaction is completed, the immobilized enzyme is recovered by magnet adsorption.

[0023] Furthermore, the preliminary purification described in step S5 is as follows: an anion exchange chromatography column Q-Sepharose Fast Flow is selected, and the chromatography column is equilibrated with a buffer containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, and 20 mM Tris-HCl (pH 8.0). The filtered sample is loaded and eluted with a linear gradient eluent containing 0-1 mol / L NaCl at a flow rate of 0.5-1.5 mL / min, and the target protein peak is collected. The entire preliminary purification operation is carried out under nitrogen protection.

[0024] Furthermore, the further purification described in step S5 is as follows: a Superdex 200 column is selected, and the column is equilibrated with a buffer containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, 20 mM Tris-HCl (pH 7.5), and 150 mM NaCl. The preliminary purified sample is loaded at a flow rate of 0.4-0.6 mL / min, and a single protein peak is collected, which is the purified DOPA-rich recombinant mussel mucin. The entire operation process is carried out under nitrogen protection.

[0025] Furthermore, when the high performance liquid chromatography (HPLC) method described in step S6 is used to detect the content of DOPA in the recombinant mussel mucin, a C18 reverse phase chromatography column is selected as the chromatographic column, the mobile phase is acetonitrile-water (containing 0.1% trifluoroacetic acid), gradient elution, and the detection wavelength is 280 nm.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] 1. The invention solves the problems of low expression level, insufficient dopamination and poor stability of recombinant mussel mucin. It has the advantages of high yield, low cost, strong product activity and easy process scale-up, laying the foundation for its practical application in adhesives, biomaterials and other fields.

[0028] 2. The present invention optimizes the gene sequence of mussel mucin (SEQ ID NO.1) and combines it with the Pichia pastoris expression system to achieve efficient secretory expression of the recombinant protein, thus solving the problem of low natural extraction yield. Immobilized tyrosine hydroxylase (coupled with magnetic microspheres) is used for in vitro DOPA modification. The enzyme can be recovered and reused by magnets, reducing costs and improving the economy and sustainability of the modification reaction. The reaction parameters are optimized to provide a suitable environment for the enzymatic reaction, thereby improving the DOPA modification efficiency. Nitrogen protection is used during the purification process, and ascorbic acid and EDTA are added to the buffer to avoid DOPA oxidative inactivation and ensure the structural integrity and adhesion function of the target protein. A combined purification strategy of anion exchange chromatography (Q-Sepharose) and gel filtration chromatography (Superdex200) effectively removes impurities and obtains highly pure DOPA-modified recombinant mussel mucin.

[0029] 3. The present invention significantly increases the DOPA content in the recombinant protein through in vitro DOPA modification. HPLC detection and verification show that the adhesion test results of the protein in a humid environment are close to or better than those of natural mussel mucin, meeting the application needs in the fields of biomedicine and materials.

[0030] 4. The immobilized enzyme technology, standardized fermentation culture conditions (such as anaerobic environment control, methanol induction strategy) and purification process of the present invention provide stable technical parameters for industrial scale-up production and reduce variable interference in the production process. DETAILED DESCRIPTION

[0031] In order to further explain the present invention, it is described below with reference to the following specific embodiments.

[0032] The main experimental instruments of the present invention are shown in Table 1 below.

[0033] Table 1

[0034]

[0035]

[0036] Example 1

[0037] A method for producing DOPA-rich recombinant mussel mucin comprises the following steps:

[0038] S1. Gene sequence design and vector construction:

[0039] Based on the functional domains and dopaminergic modification sites of mussel mucin, an optimized recombinant mussel mucin gene sequence was designed. The optimized gene sequence is shown in SEQ ID NO. 1. The designed nucleotide sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for full gene synthesis, and the synthesized sequence was cloned into a Pichia pastoris expression vector.

[0040] GenBank of the sequence before optimization: GU321203.1;

[0041] The optimized gene sequence is: ATGAATAATCTCAGTATTGCAGTTTTGCTGGCTTTAGTCCCTGTTGGATTATTTGCCGTGCAGAGTGATGCAGGTTATGGCGGCTCTGGCGGCTCTGGCGGCTCTTATTATCCAGGATATAATGCACTATGGCCATACAACAATGGTTACTATGGCGGCTC TGGCGGCTCTGGCGGCTCTTATAATGGATACAATGGATATCACGGACGTTATGGCGGCTCTGGCGGCTCTGGCGGCTCTGGAATAAGGGATGGAATAGCGGTCCATGGGGAGGATCATATTATGGCGGCTCTGGCGGCTCTGGCGGCTCTAACAAAGGCTATCTGTATTAG

[0042] S2. Expression vector transformation and positive transformant screening:

[0043] The constructed expression vector was transformed into Pichia pastoris by electrochemical transformation, and positive transformants were screened;

[0044] Specifically:

[0045] (1) Preparation of Pichia pastoris competent cells:

[0046] 1) Pick a single colony of Pichia pastoris and inoculate it into 5 mL of YPD medium. Incubate the culture overnight at 26°C and 180 rpm with shaking.

[0047] 2) Transfer 1 mL of overnight culture to 50 mL of YPD medium and continue culturing until OD600 reaches 1.3;

[0048] 3) Transfer the culture to a sterile centrifuge tube, centrifuge at 3000 rpm at 4°C for 5 minutes, and discard the supernatant.

[0049] 4) Resuspend the cells in pre-cooled sterile water, centrifuge at 3000 rpm at 4°C for 5 min, discard the supernatant, and repeat this step twice.

[0050] 5) Resuspend the cells in pre-chilled 1 M sorbitol, centrifuge at 3000 rpm for 5 min at 4°C, and discard the supernatant.

[0051] 6) Finally, resuspend the cells with an appropriate amount of pre-cooled 1M sorbitol to a cell concentration of approximately 10 10 Pichia pastoris competent cells.

[0052] (2) Electrochemical conversion:

[0053] 1) Mix 80 μL of Pichia competent cells with 5 μg of linearized expression vector and transfer to a pre-chilled 0.2 cm electroporation cuvette;

[0054] 2) Place the electroporation cup in the electroporation instrument and set the following parameters: voltage 1500 V, capacitance 25 μF, resistance 200 Ω, and perform electroporation.

[0055] 3) Immediately after electroporation, add 1 mL of pre-chilled 1 M sorbitol and mix gently;

[0056] 4) Transfer the mixture to a sterile centrifuge tube and incubate at 26°C, 180 rpm, and shake for 1 h.

[0057] (3) Screening of positive transformants:

[0058] 1) Spread the culture evenly on MD plates containing the corresponding antibiotics and incubate at 28°C for 2 days until a single colony grows;

[0059] 2) Pick a single colony and inoculate it into YPD medium containing the corresponding antibiotics, and culture it with shaking at 26°C and 180 rpm overnight;

[0060] 3) Extract yeast genomic DNA and verify positive transformants by PCR;

[0061] S3. Fermentation culture and induced expression:

[0062] Positive transformants were selected and inoculated into YPD medium containing bleomycin. The cells were shaken and cultured at 26°C and 180 rpm until the logarithmic growth phase, which served as seed solution. The seed solution was inoculated into the fermentation medium at a ratio of 1:100. The fermentation conditions were controlled as follows: temperature 28°C, pH 5.0, dissolved oxygen 30%. Nitrogen was introduced during the fermentation process to maintain an anaerobic environment. When the cells grew to an OD600 of 20, methanol was added to induce expression. The final methanol concentration was 1%, and the induction time was 65 h.

[0063] The components and contents of the fermentation medium were as follows: yeast extract 8 g / L, peptone 18 g / L, glycerol 18 g / L, K2HPO4 9 g / L, KH2PO4 11.6 g / L, MgSO4·7H2O 4.5 g / L, CaSO4·2H2O 0.91 g / L, KCl 3.2 g / L, and trace element solution 5.3 mL / L;

[0064] The components and contents of the trace element solution are as follows: CuSO4·5H2O 5g / L, KI 0.06g / L, Na2MoO4·2H2O0.15g / L, H3BO30.05g / L, CoCl20.5g / L, FeSO4·7H2O25g / L, ZnSO4·7H2O 18g / L, EDTA45g / L, concentrated sulfuric acid 4mL / L;

[0065] S4. Fermentation broth collection and in vitro dopaminergic modification:

[0066] The fermentation broth was collected and centrifuged at 4°C and 4000 rpm for 10 minutes. The supernatant containing the recombinant mussel mucin was collected and preliminarily treated by adding 0.1% Triton X-100 and stirring. The supernatant was then subjected to in vitro dopaminylation modification according to the following method: immobilized tyrosine hydroxylase (coupled to magnetic microspheres) was added to the reaction system to a concentration of 10 U / mL. Tris-HCl buffer (pH 7.0) containing 20 mM ascorbic acid (reduced form) and 1 mM EDTA was also added. The total volume of the reaction system was 100 mL. Nitrogen was introduced during the reaction to maintain an anaerobic environment. The reaction was shaken at 26°C and 180 rpm for 20 hours. After the reaction was completed, the immobilized enzyme was recovered by magnetic adsorption.

[0067] S5. Protein purification:

[0068] (1) The DOPA-modified solution was filtered through a 0.22 μm filter membrane to remove impurities. An anion exchange chromatography column Q-Sepharose FastFlow was selected and equilibrated with a buffer containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, and 20 mM Tris-HCl (pH 8.0). The filtered sample was loaded and eluted with a linear gradient eluent containing 0.5 mol / L NaCl at a flow rate of 0.5 mL / min. The target protein peak was collected. The entire preliminary purification process was carried out under nitrogen protection.

[0069] (2) The protein initially purified above was further purified by using a Superdex 200 column, equilibrating the column with a buffer solution containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, 20 mM Tris-HCl (pH 7.5), and 150 mM NaCl. The initially purified sample was loaded at a flow rate of 0.4 mL / min, and a single protein peak was collected, which was the purified DOPA-rich recombinant mussel mucin. The entire operation was carried out under nitrogen protection.

[0070] S6. Detection and analysis:

[0071] The content of DOPA in recombinant mussel mucin was determined by high performance liquid chromatography (HPLC). A C18 reverse phase column was used as the chromatographic column, acetonitrile-water (containing 0.1% trifluoroacetic acid) as the mobile phase, gradient elution was used, and the detection wavelength was 280 nm.

[0072] The purity of recombinant mussel mucin was analyzed by SDS-PAGE electrophoresis;

[0073] The adhesion properties of recombinant mussel mucin were determined using an adhesion test device.

[0074] Example 2

[0075] A method for producing DOPA-rich recombinant mussel mucin comprises the following steps:

[0076] S1. Gene sequence design and vector construction:

[0077] Based on the functional domains and dopaminergic modification sites of mussel mucin, an optimized recombinant mussel mucin gene sequence was designed. The optimized gene sequence is shown in SEQ ID NO. 1. The designed nucleotide sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for full gene synthesis, and the synthesized sequence was cloned into a Pichia pastoris expression vector.

[0078] GenBank of the sequence before optimization: GU321203.1;

[0079] The optimized gene sequence is: ATGAATAATCTCAGTATTGCAGTTTTGCTGGCTTTAGTCCCTGTTGGATTATTTGCCGTGCAGAGTGATGCAGGTTATGGCGGCTCTGGCGGCTCTGGCGGCTCTTATTATCCAGGATATAATGCACTATGGCCATACAACAATGGTTACTATGGCGGCTC TGGCGGCTCTGGCGGCTCTTATAATGGATACAATGGATATCACGGACGTTATGGCGGCTCTGGCGGCTCTGGCGGCTCTGGAATAAGGGATGGAATAGCGGTCCATGGGGAGGATCATATTATGGCGGCTCTGGCGGCTCTGGCGGCTCTAACAAAGGCTATCTGTATTAG

[0080] S2. Expression vector transformation and positive transformant screening:

[0081] The constructed expression vector was transformed into Pichia pastoris by electrochemical transformation, and positive transformants were screened;

[0082] Specifically:

[0083] (1) Preparation of Pichia pastoris competent cells:

[0084] 1) Pick a single colony of Pichia pastoris and inoculate it into 5 mL of YPD medium. Incubate the culture overnight at 28°C and 200 rpm with shaking.

[0085] 2) Transfer 1 mL of overnight culture to 50 mL of YPD medium and continue culturing until OD600 reaches 1.4;

[0086] 3) Transfer the culture to a sterile centrifuge tube, centrifuge at 3000 rpm at 4°C for 5 minutes, and discard the supernatant.

[0087] 4) Resuspend the cells in pre-cooled sterile water, centrifuge at 3000 rpm at 4°C for 5 min, discard the supernatant, and repeat this step twice.

[0088] 5) Resuspend the cells in pre-chilled 1 M sorbitol, centrifuge at 3000 rpm for 5 min at 4°C, and discard the supernatant.

[0089] 6) Finally, resuspend the cells with an appropriate amount of pre-cooled 1M sorbitol to a cell concentration of approximately 10 10 Pichia pastoris competent cells.

[0090] (2) Electrochemical conversion:

[0091] 1) Mix 80 μL of Pichia competent cells with 7.5 μg of linearized expression vector and transfer to a pre-chilled 0.2 cm electroporation cuvette;

[0092] 2) Place the electroporation cup in the electroporation instrument and set the following parameters: voltage 1500 V, capacitance 25 μF, resistance 200 Ω, and perform electroporation.

[0093] 3) Immediately after electroporation, add 1 mL of pre-chilled 1 M sorbitol and mix gently;

[0094] 4) Transfer the mixture to a sterile centrifuge tube and incubate at 28°C, 200 rpm, and shake for 1.5 h;

[0095] (3) Screening of positive transformants:

[0096] 1) Spread the culture evenly on MD plates containing the corresponding antibiotics and incubate at 28°C for 2.5 days until a single colony grows;

[0097] 2) Pick a single colony and inoculate it into YPD medium containing the corresponding antibiotics, and culture it at 28°C and 200 rpm with shaking overnight;

[0098] 3) Extract yeast genomic DNA and verify positive transformants by PCR;

[0099] S3. Fermentation culture and induced expression:

[0100] Positive transformants were selected and inoculated into YPD medium containing bleomycin, and cultured with shaking at 28°C and 200 rpm until the logarithmic growth phase to serve as seed solution. The seed solution was inoculated into the fermentation medium at a ratio of 1:100, and the fermentation conditions were controlled as follows: temperature 28°C, pH 5.5, dissolved oxygen 40%, and nitrogen was introduced during the fermentation process to maintain an anaerobic environment. When the bacteria grew to an OD600 of 20, methanol was added to induce expression, with a final methanol concentration of 1%, and an induction time of 72 h.

[0101] The components and contents of the fermentation medium were as follows: yeast extract 10 g / L, peptone 20 g / L, glycerol 20 g / L, K2HPO4 9.1 g / L, KH2PO4 11.8 g / L, MgSO4·7H2O 5 g / L, CaSO4·2H2O 0.93 g / L, KCl 3.4 g / L, and trace element solution 5.35 mL / L;

[0102] The components and contents of the trace element solution are as follows: CuSO4·5H2O 6g / L, KI 0.08g / L, Na2MoO4·2H2O0.2g / L, H3BO30.06g / L, CoCl20.55g / L, FeSO4·7H2O30g / L, ZnSO4·7H2O 20g / L, EDTA50g / L, concentrated sulfuric acid 5mL / L;

[0103] S4. Fermentation broth collection and in vitro dopaminergic modification:

[0104] The fermentation broth was collected and centrifuged at 4°C and 5000 rpm for 15 minutes. The supernatant containing the recombinant mussel mucin was collected and preliminarily treated by adding 0.1% Triton X-100 and stirring. The supernatant was then subjected to in vitro dopaminylation modification according to the following method: immobilized tyrosine hydroxylase (coupled with magnetic microspheres) was added to the reaction system to a concentration of 10 U / mL. Tris-HCl buffer (pH 7.0) containing 20 mM ascorbic acid (reduced form) and 1 mM EDTA was also added. The total volume of the reaction system was 100 mL. Nitrogen was introduced during the reaction to maintain an anaerobic environment. The reaction was shaken at 28°C and 200 rpm for 24 hours. After the reaction was completed, the immobilized enzyme was recovered by magnetic adsorption.

[0105] S5. Protein purification:

[0106] (1) The DOPA-modified solution was filtered through a 0.22 μm filter membrane to remove impurities. An anion exchange chromatography column Q-Sepharose FastFlow was selected and equilibrated with a buffer containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, and 20 mM Tris-HCl (pH 8.0). The filtered sample was loaded and eluted with a linear gradient eluent containing 0.5 mol / L NaCl at a flow rate of 1 mL / min. The target protein peak was collected. The entire preliminary purification process was carried out under nitrogen protection.

[0107] (2) The protein initially purified above was further purified by using a Superdex 200 column, equilibrating the column with a buffer solution containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, 20 mM Tris-HCl (pH 7.5), and 150 mM NaCl. The initially purified sample was loaded at a flow rate of 0.5 mL / min, and a single protein peak was collected, which was the purified DOPA-rich recombinant mussel mucin. The entire operation was carried out under nitrogen protection.

[0108] S6. Detection and analysis:

[0109] The content of DOPA in recombinant mussel mucin was determined by high performance liquid chromatography (HPLC). A C18 reverse phase column was used as the chromatographic column, acetonitrile-water (containing 0.1% trifluoroacetic acid) as the mobile phase, gradient elution was used, and the detection wavelength was 280 nm.

[0110] The purity of recombinant mussel mucin was analyzed by SDS-PAGE electrophoresis;

[0111] The adhesion properties of recombinant mussel mucin were determined using an adhesion test device.

[0112] Example 3

[0113] A method for producing DOPA-rich recombinant mussel mucin comprises the following steps:

[0114] S1. Gene sequence design and vector construction:

[0115] Based on the functional domains and dopaminergic modification sites of mussel mucin, an optimized recombinant mussel mucin gene sequence was designed. The optimized gene sequence is shown in SEQ ID NO. 1. The designed nucleotide sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for full gene synthesis, and the synthesized sequence was cloned into a Pichia pastoris expression vector.

[0116] GenBank of the sequence before optimization: GU321203.1;

[0117] The optimized gene sequence is: ATGAATAATCTCAGTATTGCAGTTTTGCTGGCTTTAGTCCCTGTTGGATTATTTGCCGTGCAGAGTGATGCAGGTTATGGCGGCTCTGGCGGCTCTGGCGGCTCTTATTATCCAGGATATAATGCACTATGGCCATACAACAATGGTTACTATGGCGGCTC TGGCGGCTCTGGCGGCTCTTATAATGGATACAATGGATATCACGGACGTTATGGCGGCTCTGGCGGCTCTGGCGGCTCTGGAATAAGGGATGGAATAGCGGTCCATGGGGAGGATCATATTATGGCGGCTCTGGCGGCTCTGGCGGCTCTAACAAAGGCTATCTGTATTAG

[0118] S2. Expression vector transformation and positive transformant screening:

[0119] The constructed expression vector was transformed into Pichia pastoris by electrochemical transformation, and positive transformants were screened;

[0120] Specifically:

[0121] (1) Preparation of Pichia pastoris competent cells:

[0122] 1) Pick a single colony of Pichia pastoris and inoculate it into 5 mL of YPD medium. Incubate the culture overnight at 30°C and 220 rpm with shaking.

[0123] 2) Transfer 1 mL of overnight culture to 50 mL of YPD medium and continue culturing until OD600 reaches 1.5;

[0124] 3) Transfer the culture to a sterile centrifuge tube, centrifuge at 3000 rpm at 4°C for 5 minutes, and discard the supernatant.

[0125] 4) Resuspend the cells in pre-cooled sterile water, centrifuge at 3000 rpm at 4°C for 5 min, discard the supernatant, and repeat this step twice.

[0126] 5) Resuspend the cells in pre-chilled 1 M sorbitol, centrifuge at 3000 rpm for 5 min at 4°C, and discard the supernatant.

[0127] 6) Finally, resuspend the cells with an appropriate amount of pre-cooled 1M sorbitol to a cell concentration of approximately 10 10 Pichia pastoris competent cells.

[0128] (2) Electrochemical conversion:

[0129] 1) Mix 80 μL of Pichia competent cells with 10 μg of linearized expression vector and transfer to a pre-chilled 0.2 cm electroporation cuvette;

[0130] 2) Place the electroporation cup in the electroporation instrument and set the following parameters: voltage 1500 V, capacitance 25 μF, resistance 200 Ω, and perform electroporation.

[0131] 3) Immediately after electroporation, add 1 mL of pre-chilled 1 M sorbitol and mix gently;

[0132] 4) Transfer the mixture to a sterile centrifuge tube and incubate at 30°C and 220 rpm with shaking for 2 h;

[0133] (3) Screening of positive transformants:

[0134] 1) Spread the culture evenly on MD plates containing the corresponding antibiotics and incubate at 28°C for 2-3 days until single colonies grow;

[0135] 2) Pick a single colony and inoculate it into YPD medium containing the corresponding antibiotics, and culture it at 30°C and 220 rpm with shaking overnight;

[0136] 3) Extract yeast genomic DNA and verify positive transformants by PCR;

[0137] S3. Fermentation culture and induced expression:

[0138] Positive transformants were selected and inoculated into YPD medium containing bleomycin, and cultured with shaking at 30°C and 220 rpm until the logarithmic growth phase to serve as seed solution. The seed solution was inoculated into the fermentation medium at a ratio of 1:100, and the fermentation conditions were controlled as follows: temperature 28°C, pH 6.0, dissolved oxygen 50%, and nitrogen was introduced during the fermentation process to maintain an anaerobic environment. When the bacteria grew to an OD600 of 30, methanol was added to induce expression, with a final methanol concentration of 1%, and an induction time of 79 h.

[0139] The components and contents of the fermentation medium were as follows: yeast extract 12 g / L, peptone 22 g / L, glycerol 22 g / L, K2HPO4 9.2 g / L, KH2PO4 12 g / L, MgSO4·7H2O 5.5 g / L, CaSO4·2H2O 0.95 g / L, KCl 3.6 g / L, and trace element solution 5.4 mL / L;

[0140] The components and contents of the trace element solution are as follows: CuSO4·5H2O 7g / L, KI 0.1g / L, Na2MoO4·2H2O0.25g / L, H3BO30.07g / L, CoCl20.6g / L, FeSO4·7H2O35g / L, ZnSO4·7H2O 22g / L, EDTA55g / L, concentrated sulfuric acid 6mL / L;

[0141] S4. Fermentation broth collection and in vitro dopaminergic modification:

[0142] The fermentation broth was collected and centrifuged at 4°C and 6000 rpm for 20 minutes. The supernatant containing the recombinant mussel mucin was collected and preliminarily treated by adding 0.1% Triton X-100 and stirring. The supernatant was then subjected to in vitro dopaminergic modification according to the following method: immobilized tyrosine hydroxylase (coupled to magnetic microspheres) was added to the reaction system to a concentration of 10 U / mL. Tris-HCl buffer (pH 7.0) containing 20 mM ascorbic acid (reduced form) and 1 mM EDTA was also added. The total volume of the reaction system was 100 mL. Nitrogen was introduced during the reaction to maintain an anaerobic environment. The reaction was shaken at 30°C and 220 rpm for 28 hours. After the reaction was completed, the immobilized enzyme was recovered by magnetic adsorption.

[0143] S5. Protein purification:

[0144] (1) The DOPA-modified solution was filtered through a 0.22 μm filter membrane to remove impurities. An anion exchange chromatography column Q-Sepharose FastFlow was selected and equilibrated with a buffer containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, and 20 mM Tris-HCl (pH 8.0). The filtered sample was loaded and eluted with a linear gradient eluent containing 1 mol / L NaCl at a flow rate of 1.5 mL / min. The target protein peak was collected. The entire preliminary purification process was carried out under nitrogen protection.

[0145] (2) The protein initially purified above was further purified by using a Superdex 200 column, equilibrating the column with a buffer solution containing 20 mM ascorbic acid (reduced form), 1 mM EDTA, 20 mM Tris-HCl (pH 7.5), and 150 mM NaCl. The initially purified sample was loaded at a flow rate of 0.6 mL / min, and a single protein peak was collected, which was the purified DOPA-rich recombinant mussel mucin. The entire operation was carried out under nitrogen protection.

[0146] S6. Detection and analysis:

[0147] The content of DOPA in recombinant mussel mucin was determined by high performance liquid chromatography (HPLC). A C18 reverse phase column was used as the chromatographic column, acetonitrile-water (containing 0.1% trifluoroacetic acid) as the mobile phase, gradient elution was used, and the detection wavelength was 280 nm.

[0148] The purity of recombinant mussel mucin was analyzed by SDS-PAGE electrophoresis;

[0149] The adhesion properties of recombinant mussel mucin were determined using an adhesion test device.

[0150] Comparative Example 1

[0151] On the basis of Example 2, no in vitro dopaminergic modification was performed, and the remaining steps were the same as the technical solution of Example 2.

[0152] Comparative Example 2

[0153] On the basis of Example 2, in the S5 protein purification step, ascorbic acid and EDTA were not added to the buffer, and the remaining steps were the same as the technical solution of Example 2.

[0154] Comparative Example 3

[0155] On the basis of Example 3, in the S5 protein purification step, only preliminary purification was performed without further purification, and the remaining steps were the same as the technical solution of Example 2.

[0156] The test results are shown in Table 2 below.

[0157] Table 2

[0158]

[0159] As shown in Table 1 above, the present invention verified the successful DOPA modification, high purity and good adhesion performance of the recombinant mussel mucin through HPLC, SDS-PAGE and adhesion test, and can be applied in the fields of adhesives, biomaterials, etc.

[0160] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. A method for producing a recombinant mussel mucin rich in DOPA, characterized in that: The steps include: S1. Design an optimized recombinant mussel mucin gene sequence based on the functional domain and dopaminergic modification site of mussel mucin. The optimized gene sequence is shown in SEQ ID NO.

1. The designed nucleotide sequence is sent to Sangon Biotech Co., Ltd. for full gene synthesis, and the synthesized sequence is cloned into a Pichia pastoris expression vector. S2. Transform the constructed expression vector into Pichia pastoris by electrochemical transformation, and screen for positive transformants; S3. Select positive transformants and inoculate them into YPD medium containing bleomycin. Cultivate with shaking at 26-30°C and 180-220 rpm until the logarithmic growth phase to serve as seed solution. Inoculate the seed solution into fermentation medium at a ratio of 1:100 for fermentation. When the cells grow to an OD600 of 20-30, add methanol to induce expression. S4. collecting the fermentation broth, centrifuging and collecting the supernatant containing the recombinant mussel mucin, performing a preliminary treatment on the supernatant by adding 0.1% Triton X-100, stirring evenly, and then performing in vitro dopaminergic modification; S5, filtering the DOPA-modified solution through a 0.22 μm filter membrane and then performing preliminary purification and further purification treatment in sequence to obtain purified DOPA-rich recombinant mussel mucin; S6. Detecting the content of DOPA in recombinant mussel mucin using high performance liquid chromatography; The purity of recombinant mussel mucin was analyzed by SDS-PAGE electrophoresis; The adhesion properties of recombinant mussel mucin were determined using an adhesion test device.

2. The method for producing a DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: The components and contents of the fermentation medium in step S3 are: yeast extract 8-12 g / L, peptone 18-22 g / L, glycerol 18-22 g / L, K2HPO4 9-9.2 g / L, KH2PO4 11.6-12 g / L, MgSO4·7H2O 4.5-5.5 g / L, CaSO4·2H2O 0.91-0.95 g / L, KCl 3.2-3.6 g / L, and trace element solution 5.3-5.4 mL / L.

3. The method for producing a DOPA-rich recombinant mussel mucin according to claim 2, wherein: The components and contents of the trace element solution are as follows: CuSO4·5H2O 5-7g / L, KI 0.06-0.1g / L, Na2MoO4·2H2O 0.15-0.25g / L, H3BO3 0.05-0.07g / L, CoCl2 0.5-0.6g / L, FeSO4·7H2O 25-35g / L, ZnSO4·7H2O 18-22g / L, EDTA 45-55g / L, and concentrated sulfuric acid 4-6mL / L.

4. The method for producing a DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: During the fermentation in step S3, the fermentation conditions are controlled as follows: temperature 28° C., pH 5.0-6.0, dissolved oxygen 30-50%, and nitrogen is introduced during the fermentation process to maintain an anaerobic environment.

5. The method for producing a DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: During the induction of expression described in step S3, the final concentration of methanol is 1%, and the induction time is 65-79 hours.

6. The method for producing a DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: The centrifugation conditions in step S4 are: 4° C., 4000-6000 rpm, 10-20 min.

7. The method for producing a DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: The in vitro dopaminergic modification described in step S4 is as follows: immobilized tyrosine hydroxylase is added to the reaction system to a concentration of 10 U / mL, and Tris-HCl buffer containing 20 mM ascorbic acid and 1 mM EDTA is added at the same time. The total volume of the reaction system is 100 mL. Nitrogen is introduced during the reaction to maintain an anaerobic environment. The reaction is shaken at 26-30°C and 180-220 rpm for 20-28 hours. After the reaction is completed, the immobilized enzyme is recovered by magnet adsorption.

8. The method for producing a DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: The preliminary purification described in step S5 is as follows: an anion exchange chromatography column Q-Sepharose Fast Flow is selected, the chromatography column is equilibrated with a buffer containing 20mM ascorbic acid, 1mM EDTA, and 20mM Tris-HCl, the filtered sample is loaded, and a linear gradient eluent containing 0-1mol / L NaCl is used for elution at a flow rate of 0.5-1.5mL / min, and the target protein peak is collected. The entire preliminary purification operation process is carried out under nitrogen protection.

9. The method for producing a DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: The further purification described in step S5 is as follows: a Superdex200 column is selected, and the column is equilibrated with a buffer containing 20 mM ascorbic acid, 1 mM EDTA, 20 mM Tris-HCl, and 150 mM NaCl. The preliminary purified sample is loaded at a flow rate of 0.4-0.6 mL / min, and a single protein peak is collected, which is the purified DOPA-rich recombinant mussel mucin. The entire operation process is carried out under nitrogen protection.

10. The method for producing the DOPA-rich recombinant mussel mucin according to claim 1, characterized in that: When the high performance liquid chromatography method described in step S6 is used to detect the content of DOPA in the recombinant mussel mucin, a C18 reverse phase chromatography column is selected as the chromatographic column, the mobile phase is acetonitrile-water, the gradient elution is performed, and the detection wavelength is 280 nm.

Images