Pseudosciaena crocea antimicrobial peptide LcPLA2XIIB as well as preparation method and application thereof

The preparation of the antimicrobial peptide LcPLA2XIIB of the big yellow croaker was solved through genetic engineering, and the prevention and treatment of bacterial diseases in the big yellow croaker breeding was provided, safe and efficient antibacterial drugs and feed additives were achieved, and the inhibition and killing effects on a variety of pathogenic microorganisms were achieved, while non-toxic to mammalian and aquatic animal cells.

CN120484087APending Publication Date: 2025-08-15EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510467439.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-15
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

During the breeding of yellow croaker, infections of bacterial diseases such as visceral white spot disease are difficult to effectively prevent and treat. The use of chemical drugs leads to the destruction of bacterial resistance and the balance of water ecosystems, and poses a threat to human health. It lacks safe and efficient antibacterial peptide preparations.

Method used

Using genetic engineering technology, the antimicrobial peptide LcPLA2XIIB of the large yellow croaker was prepared through the E. coli expression system, including amplifying the gene, constructing the recombinant expression vector pET32a/LcPLA2XIIB and induced expression in BL21 cells. LcPLA2XIIB was then purified by affinity chromatography to obtain LcPLA2XIIB.

Benefits of technology

LcPLA2XIIB shows significant inhibitory and killing effects on a variety of pathogenic microorganisms, is non-toxic to mammalian and aquatic animal cells, provides safe and efficient anti-pathogenic microorganism drugs and feed additives, and promotes the development of green and healthy aquaculture industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120484087A_ABST
    Figure CN120484087A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a pseudosciaena crocea antimicrobial peptide LcPLA2XIIB as well as a preparation method and application of the pseudosciaena crocea antimicrobial peptide LcPLA2XIIB. The LcPLA2XIIB prepared by the preparation method disclosed by the invention has obvious inhibiting and killing effects on pathogenic bacteria, viruses and fungi. Meanwhile, the LcPLA2XIIB has no toxic effect on common mammalian cells and aquatic animal cells, so that the LcPLA2XIIB has a wide application prospect in the aspects of development and application of novel microbial infection resistant drugs and novel disease-resistant feed additives.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a large yellow croaker secretory phospholipase A2 group XII homologous molecule LcPLA2XIIB, a preparation method and an application thereof. Background Art

[0002] Large yellow croaker is a key marine aquaculture fish, ranking first among marine fish in terms of aquaculture output, exceeding 200,000 tons annually. Large yellow croaker, also known as yellow croaker or cucumber fish, belongs to the phylum Chordata, class Osteichthyes, order Perciformes, family Sciaenidae, and genus Pseudosciaena. Large yellow croaker has a high economic value, with tender meat and a high protein content, making it a highly desirable fresh food. It is found in the northwest Pacific region. However, the rapid development of large yellow croaker aquaculture has been particularly problematic, with outbreaks and epidemics of various diseases causing significant economic losses. Common diseases include viral diseases such as iridovirus and bacterial diseases such as visceral white spot disease.

[0003] Antimicrobial peptides (AMPs) are among the most promising sustainable small-molecule peptides for combating bacterial, viral, fungal, and parasitic infections. AMPs are a novel class of antimicrobial agents that are widely distributed in the natural environment. They can disrupt the membrane integrity of pathogens and exhibit broad-spectrum antimicrobial activity in animals both in vitro and in vivo. Furthermore, due to the diverse array of pathogens in aquatic environments, fish possess a diverse array of AMPs to combat pathogen invasion. Phospholipase A2 (PLA2) is a disulfide-rich lipolytic enzyme that hydrolyzes glycerophospholipids to release fatty acids and lysophospholipids. Secreted PLA2 (sPLA2), a member of the PLA2 superfamily, is commonly found in vertebrates such as humans, fish, and reptiles, invertebrates such as worms, viruses, parasites, and protists. sPLA2 members exert a variety of biological activities through their catalytic activity or specialized molecular structures. PLA2XIIB has been identified in various animal species, including the Japanese medaka and seahorse. These proteins have significant killing or inhibitory effects on Gram-negative and Gram-positive bacteria, as well as various viruses, and can participate in host immune responses. Therefore, PLA2XIIB plays a crucial role in defending animals against foreign pathogens invading the host body.

[0004] At present, the treatment of bacterial diseases such as white spot disease in the internal organs of large yellow croaker in aquatic animals mainly uses chemical disinfectants for disinfection, combined with the feeding of medicated baits such as antibiotics. However, the widespread use of chemical drugs such as antibiotics has led to the common phenomenon of bacterial resistance. Animals infected with the disease often fail to achieve the ideal prevention and control effect. Not only can the economic losses caused by the outbreak of the disease in aquatic animals not be recovered, but new problems such as drug residues in aquatic food will also arise. Therefore, the large-scale use of chemical drugs not only causes great damage to the emergence of drug-resistant strains in fish and the balance of aquatic ecosystems, but also poses a huge threat to human health due to drug residues in aquatic food, further causing human public food safety issues. Therefore, it is urgent to develop a new type of safe, efficient and environmentally friendly antimicrobial peptide preparation for the prevention and control of aquatic animal diseases.

[0005] The E. coli high-efficiency expression system is one of the most mature and stable systems for expressing protein products. This method offers high protein yields, a simple workflow, and stable protein expression, making it a key approach for large-scale production of target proteins. However, the protective effects of large yellow croaker PLA2XIIB (Larimichthys crocea, PLA2XIIB, LcPLA2XIIB) against major viral and bacterial diseases, as well as its associated antibacterial and antiviral mechanisms, have yet to be reported. Summary of the Invention

[0006] The purpose of the present invention is to solve the problem of infection by bacterial diseases such as white spot disease of the large yellow croaker viscera during the breeding process of the large yellow croaker, and to provide a large yellow croaker antimicrobial peptide LcPLA2XIIB and a preparation method and application thereof. The present invention creates possibilities for the development and application promotion of new large yellow croaker drugs and feed additives in aquatic products, and also provides a theoretical basis for the research and development of antibacterial drugs and antiviral drugs.

[0007] In order to achieve the above object, the first aspect of the present invention provides a method for preparing the antimicrobial peptide LcPLA2XIIB from large yellow croaker, comprising the following steps:

[0008] After the LcPLA2XIIB gene was amplified, it was connected to the pET32a vector. After positive screening, it was transformed into the host cell BL21, and then the host cell was induced to express. LcPLA2XIIB was purified by affinity chromatography.

[0009] Furthermore, the preparation method of the large yellow croaker antimicrobial peptide LcPLA2XIIB comprises the following steps:

[0010] (A) LcPLA2XIIB gene cloning:

[0011] Based on the LcPLA2XIIB nucleotide sequence (SEQ ID NO. 1) and its corresponding amino acid sequence (SEQ ID NO. 2), primers were designed to amplify the nucleotide sequence corresponding to the mature peptide;

[0012] (B) Construction of an expression vector carrying the LcPLA2XIIB gene:

[0013] The recombinant expression vector pET32a / LcPLA2XIIB of LcPLA2XIIB was constructed;

[0014] (C) Preparation of LcPLA2XIIB:

[0015] The obtained recombinant expression vector pET32a / LcPLA2XIIB was introduced into the host cell BL21, the host cell was induced to express, and LcPLA2XIIB was purified by affinity chromatography.

[0016] Furthermore, in the step (A), primers LcPBEF (SEQ ID NO. 3) and LcPBER (SEQ ID NO. 4) were used to amplify the DNA sequence corresponding to the mature peptide sequence of LcPLA2XIIB by PCR using the cDNA of LcPLA2XIIB as a template.

[0017] Furthermore, the preparation method of the large yellow croaker antimicrobial peptide LcPLA2XIIB specifically comprises the following steps:

[0018] (1) LcPLA2XIIB gene cloning:

[0019] Healthy large yellow croaker tissue cDNA was obtained as a template, and its mature peptide sequence, i.e. the 24th to 210th amino acid sequence, was found based on the nucleotide sequence (SEQ ID NO.1) and amino acid sequence (SEQ ID NO.2) of LcPLA2XIIB. Specific primers were designed to amplify the nucleic acid fragment corresponding to the mature peptide.

[0020] The upstream primer LcPBEF adds an EcoR I restriction site:

[0021] 5'-TACTCA GAATTC CAAGATGTAGAGGACCCAGC-3' (SEQ ID NO. 3);

[0022] The downstream primer LcPBER adds a Hind III restriction site:

[0023] 5'-TACTCAAAGCTTAAGTTCATCTTTTCTCCTCTCC-3' (SEQ ID NO. 4);

[0024] (2) Construction of an expression vector carrying the LcPLA2XIIB gene:

[0025] The amplified nucleic acid fragment was ligated into the pET32a vector to construct the pET32a / LcPLA2XIIB recombinant expression vector. The pET32a vector was double-digested with EcoRI and HindIII, and then ligated using T4 DNA ligase. The recombinant expression vector pET32a / LcPLA2XIIB of LcPLA2XIIB was constructed.

[0026] (3) Preparation of target protein LcPLA2XIIB:

[0027] The successfully constructed recombinant expression plasmid was transformed into Escherichia coli BL21 competent cells, and the product containing the target protein LcPLA2XIIB was obtained by induced expression. It was further verified that the protein was expressed in a soluble manner and that the target protein could be fused with the histidine on the pET32a vector. Therefore, the target protein LcPLA2XIIB was purified by affinity chromatography.

[0028] In a second aspect of the present invention, a large yellow croaker antimicrobial peptide LcPLA2XIIB is provided, the amino acid sequence of which is shown in SEQ ID NO.2, and the nucleotide sequence of which is shown in SEQ ID NO.1.

[0029] Furthermore, the large yellow croaker antimicrobial peptide LcPLA2XIIB is prepared using the preparation method described above.

[0030] The third aspect of the present invention provides a use of the large yellow croaker antimicrobial peptide LcPLA2XIIB as described above in the preparation of antipathogenic microbial drugs, wherein the antipathogenic microbial drugs are antibacterial drugs, antiviral drugs or antifungal drugs.

[0031] Furthermore, the bacteria are Pseudomonas aeruginosa, Aeromonas hydrophila, Vibrio parahaemolyticus, Escherichia coli, or Staphylococcus aureus. The large yellow croaker antimicrobial peptide LcPLA2XIIB of the present invention has significant inhibitory activity and killing effects on common aquatic drug-resistant bacteria (Aeromonas hydrophila, Vibrio parahaemolyticus, Pseudomonas aeruginosa), Escherichia coli, and Staphylococcus aureus.

[0032] Furthermore, the virus is infectious hematopoietic necrosis virus (IHNV).

[0033] Furthermore, the fungus is Candida albicans.

[0034] A fourth aspect of the present invention provides a use of the large yellow croaker antimicrobial peptide LcPLA2XIIB as described above in the preparation of an animal anti-pathogenic microorganism feed additive.

[0035] Furthermore, the pathogenic microorganism is a pathogenic bacterium, virus or fungus; the pathogenic bacteria is Pseudomonas aeruginosa, Aeromonas hydrophila, Vibrio parahaemolyticus, Escherichia coli or Staphylococcus aureus; the virus is IHNV; and the fungus is Candida albicans.

[0036] Furthermore, the animal is a mammal or an aquatic animal.

[0037] The large yellow croaker antimicrobial peptide LcPLA2XIIB of the present invention has no toxic effects on mammalian cell lines (human embryonic kidney cells HEK-293) and aquatic animal cell lines (carp epithelial tumor cells EPC).

[0038] The advantages of the present invention are:

[0039] This invention utilizes genetic engineering techniques to generate the recombinant expression vector pET32a / LcPLA2XIIB, which was successfully expressed in Escherichia coli BL21 and the target protein was obtained. Microbial inhibition and viral inhibition experiments confirmed the antibacterial, antiviral, and antifungal activities of LcPLA2XIIB. The LcPLA2XIIB prepared in this invention exhibits significant inhibitory and antifungal effects against pathogenic bacteria, viruses, and fungi. Cytotoxicity experiments demonstrated that LcPLA2XIIB exhibited no toxicity towards common mammalian cell lines (HEK-293) and aquatic animal cell lines (EPC), laying a solid foundation for its development as a new drug or feed additive.

[0040] It is noteworthy that, according to the data of this example, LcPLA2XIIB exhibits a strong inhibitory effect against Candida albicans, indicating that LcPLA2XIIB is a rare antifungal antimicrobial peptide. Candida albicans is a pathogenic fungus of many animals, including higher mammals. Therefore, LcPLA2XIIB can be used to develop antifungal drugs for various animals. Compared with other common antimicrobial peptides, the antimicrobial peptide LcPLA2XIIB obtained in the present invention has significant inhibitory activity and killing effects against three common aquatic drug-resistant bacteria (Aeromonas hydrophila, Vibrio parahaemolyticus, and Pseudomonas proteus). At the same time, LcPLA2XIIB has no toxic effects on common mammalian cells and aquatic animal cells, indicating that it has very attractive application prospects in the development and application of new drugs for antimicrobial infections and new anti-disease feed additives, and can be used to prevent and control drug-resistant bacteria in aquatic products.

[0041] Therefore, the development and research of the large yellow croaker antimicrobial peptide LcPLA2XIIB of the present invention meets the requirements of the development direction of green and healthy aquaculture; conforms to the industrial policy of veterinary drug development and the requirements of aquatic and related food safety; and conforms to the industrial policy of feed additive development. It is beneficial to the green, healthy and rapid development of the aquaculture industry and has important practical significance for the production of green and pollution-free aquatic products. It also meets the needs of the modern industry development of new veterinary drugs or feed additives for aquatic animals with independent intellectual property rights. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Protein electrophoresis analysis of LcPLA2XIIB expressed in the pET32a / LcPLA2XIIB recombinant expression system. M, protein marker; lane 1, protein expression without IPTG induction; lane 2, protein expression after IPTG induction; lane 3, purified LcPLA2XIIB sample.

[0043] Figure 2 Binding experiments comparing the recombinant protein LcPLA2XIIB to the bacterial polysaccharide components LTA (from Staphylococcus aureus) and PGN (from Staphylococcus aureus). The results showed that LcPLA2XIIB has significant binding activity to both LTA and PGN (this binding activity promotes the protein's inhibitory activity against bacteria).

[0044] Figure 3 Recombinant protein LcPLA2XIIB has inhibitory activity against IHNV proliferation. A, Inhibitory effect of different concentrations of LcPLA2XIIB on IHNV growth activity compared with the Ctrl blank control group and the TRX negative protein control group. A, Inhibitory effect of LcPLA2XIIB on IHNV growth activity at different time points compared with the Ctrl blank control group and the TRX negative protein control group. Compared with the control group, LcPLA2XIIB can significantly inhibit IHNV proliferation, indicating that LcPLA2XIIB has the function of inhibiting viral proliferation.

[0045] Figure 4 Cytotoxicity of LcPLA2XIIB on HEK-293 and EPC cells. A, LcPLA2XIIB showed no cytotoxicity towards HEK-293 cells; B, LcPLA2XIIB showed no cytotoxicity towards EPC cells. These results indicate that LcPLA2XIIB has no cytotoxic effects on the growth of mammalian cells (HEK-293) or aquatic cells (EPC). DETAILED DESCRIPTION

[0046] Below in conjunction with embodiment, the specific embodiment provided by the present invention is described in detail.Should be understood that these embodiments are only used to illustrate the present invention and are not used in limiting the scope of the present invention.In addition, should be understood that after reading content described in the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall equally within the scope limited by the appended claims of the present application.

[0047] Example 1: Extraction of total RNA from the hepatopancreas and cDNA synthesis

[0048] Total RNA extraction: The steps for extracting total RNA from the hepatopancreas of healthy large yellow croaker are as follows: 30 mg of tissue sample was added to 1 mL of Trizol reagent and thoroughly homogenized with a grinder under ice bath conditions; the homogenate was transferred to a sterile 1.5 mL centrifuge tube, centrifuged at 12,000 × g for 10 min at 4°C to remove the precipitate, and the supernatant was carefully transferred to a new 1.5 mL centrifuge tube and allowed to stand at room temperature for 10 min; 0.2 mL of chloroform was added, shaken vigorously for 1 min, allowed to stand at room temperature for 10 min, and centrifuged at 12,000 × g for 15 min at 4°C; the clear upper aqueous phase was aspirated into a new 1.5 mL centrifuge tube, 0.5 mL of isopropanol was added, the solution was mixed and allowed to stand at room temperature for 10 min; centrifuged at 12,000 × g for 10 min at 4°C, the supernatant was removed, 1 mL of pre-cooled 70% ethanol was added, shaken thoroughly, and centrifuged at 7,500 × g for 5 min at 4°C; the washing was repeated once and air-dried at room temperature to allow RNA to be isolated. Precipitate, add 30-50 μL DEPC water to dissolve RNA, incubate at 55-60°C for 10 min, and store at -80°C until use.

[0049] cDNA synthesis: cDNA synthesis is performed according to the reverse transcription step.

[0050] Reaction system: 1µg total RNA, 2.5µM Oligo (dT) 18 Primers, 10 U reverse transcriptase, 1× reverse transcriptase buffer, 20 U protease inhibitors, 1 mM deoxynucleotide mix, and ddH2O were added to a total volume of 20 µL.

[0051] Reaction procedure: A total volume of 20 μL of the reaction solution was mixed, centrifuged, and incubated at 65°C for 10 min, 55°C for 30 min, and 85°C for 5 min to terminate the reaction.

[0052] Example 2: Amplification of the full-length nucleic acid sequence of the large yellow croaker antimicrobial peptide LcPLA2XIIB and acquisition of the amino acid sequence

[0053] Specific primers were designed according to the LcPLA2XIIB open reading frame (ORF) cDNA sequence:

[0054] Upstream primer (LcPBAF): 5′- ATGATTCGCTGGGCCCTTCTT -3′ (SEQ ID NO. 5);

[0055] Downstream primer (LcPBAR): 5'-CTAAAGTTCATCTTTCTCCTCTC -3' (SEQ ID NO. 6). The PCR amplification system is shown in Table 1.

[0056] Table 1 Amplification system of LcPLA2XIIB ORF

[0057]

[0058] PCR reaction program: 95 °C pre-denaturation for 5 min, 94 °C denaturation for 30 s, 55 °C annealing for 40 s, and 72 °C extension for 45 s, for a total of 30 cycles; the final extension reaction was 10 min.

[0059] The amplified PCR products were subjected to 2% agarose gel electrophoresis, and the amplification results were preliminarily determined based on the size of the electrophoretic bands. The PCR products were then sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The sequencing results were analyzed for consistency with the nucleotide sequence of Genbank accession number XM_010732652 to verify the cDNA sequence of the amplified gene ORF (SEQ ID NO. 1). The full length of the LcPLA2XIIB ORF is 633 bp.

[0060] The amino acid sequence of LcPLA2XIIB (SEQ ID NO. 2) contains 210 amino acids in total, of which the 24th to 210th amino acids are its mature peptide sequence, and there is also a 23-amino acid signal peptide sequence at the front end of the mature peptide.

[0061] Example 3: Construction of LcPLA2XIIB prokaryotic expression vector

[0062] The DNA sequence corresponding to the mature peptide of LcPLA2XIIB was amplified using the upstream primer LcPBEF and the downstream primer LcPBER. PCR reaction conditions included 30 cycles of initial denaturation at 95°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 40 seconds, and extension at 72°C for 45 seconds, followed by a final extension reaction for 10 minutes. PCR products were analyzed and recovered by 2% agarose gel electrophoresis.

[0063] The expression vector pET32a was digested with EcoRI and HindIII at 37°C for 2 h, and then ligated with the recovered positive product. The ligation system is shown in Table 2.

[0064] Table 2 LcPLA2XIIB mature peptide sequence and cloning vector connection system

[0065]

[0066] Add the reaction system according to Table 2, mix well, and place at 4°C for connection overnight.

[0067] After the reaction, the ligation product was quickly transformed into DH5α cloning competent cells according to conventional transformation methods, spread on LB medium plates containing 50 μg / mL kanamycin, and grown in a 37°C incubator for 16-20 h. After picking a single colony for culture, positive results were screened by PCR and verified by sequencing. The recombinant expression plasmid pET32a / LcPLA2XIIB was successfully constructed.

[0068] Example 4: Expression of recombinant expression vector in Escherichia coli BL21

[0069] The constructed recombinant expression vector pET32a / LcPLA2XIIB was transformed into Escherichia coli BL21 competent cells, and the screened positive clones were cultured in small quantities. IPTG with a final concentration of 1.0 mM was added at 28°C to induce the expression of the target protein LcPLA2XIIB. The bacterial liquid before and after induction was collected to prepare protein samples. The expression of the target protein was detected by polyacrylamide gel electrophoresis (SDS-PAGE, gel concentration 12%). The electrophoresis results of the protein are shown in Figure 2. Figure 1 As shown: Compared with before induction, the E. coli containing the recombinant expression vector produced an additional obvious protein band, which was consistent with the molecular weight of the predicted protein. The results showed that the band was the recombinant protein LcPLA2XIIB.

[0070] Example 5: Purification of recombinant protein LcPLA2XIIB

[0071] Based on the results of pilot expression experiments, the expression strain was cultured at 28°C (200 mL) and induced with IPTG at a final concentration of 1.0 mM. The induced culture was centrifuged, the supernatant removed, and the cells resuspended in 1× phosphate buffered saline (PBS; 140 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, pH 7.4). The resuspension was sonicated on ice and then centrifuged at 12,000 rpm for 20 minutes at 4°C to separate the supernatant and precipitate. SDS-PAGE electrophoresis confirmed the expression of the target protein in the supernatant, indicating that LcPLA2XIIB was expressed in a soluble form. Therefore, the supernatant after ultrasonic disruption was subjected to affinity chromatography (Ni-NTA His Bind Resin, QIAGEN, Germany), and the eluate was collected and dialyzed. After concentration, the target protein LcPLA2XIIB was obtained.

[0072] Example 6: Recombinant protein LcPLA2XIIB has significant antibacterial activity

[0073] A protein concentration standard curve was prepared using BSA standards, and LcPLA2XIIB protein concentration was determined by the Bradford assay. The antibacterial activity of the recombinant protein LcPLA2XIIB was determined using the minimum inhibitory concentration (MIC) method of the liquid antibacterial sensitivity assay. The specific procedure was as follows: After filter sterilization, the recombinant protein was serially diluted in PBS (pH 7.4) in a 96-well plate (100 μL protein sample per well). TRX (negative control) was also treated in the same manner. Subsequently, 100 μL containing approximately 1 × 10 5 LB culture medium containing CFU bacteria was added to the corresponding protein dilution solution and incubated at 37°C for 16 hours. The selected bacterial and fungal species included: Pseudomonas aeruginosa, Aeromonas hydrophila, Vibrio parahaemolyticus, Escherichia coli, Staphylococcus aureus, yeast, and Candida albicans.

[0074] Experimental and control groups: Blank control group: 100 μL PBS and 100 μL LB medium were added; Negative control group: 100 μL PBS containing pET32a carrier protein (TRX) and 100 μL LB medium were added; Experimental group: 100 μL PBS containing LcPLA2XIIB protein and 100 μL LB medium were added;

[0075] In this application, MIC is defined as the lowest dilution concentration (OD value) of the protein that can significantly inhibit the growth of experimental bacteria compared with the negative control group.

[0076] The experimental results showed that protein TRX showed no inhibitory activity against the tested bacteria and fungi, but LcPLA2XIIB showed significant inhibitory activity against Gram-positive bacteria, Gram-negative bacteria, and Candida albicans, as shown in Table 3. The smaller the MIC value, the stronger the ability to inhibit bacterial growth or kill bacteria.

[0077] Table 3 Antibacterial activity of LcPLA2XIIB

[0078]

[0079] Example 7: Binding activity experiment of lipoteichoic acid (LTA) and peptidoglycan (PGN) of Gram-positive bacterial cell wall components

[0080] The binding activity of LcPLA2XIIB and TRX for bacterial cell wall components LTA and PGN, respectively, was compared by enzyme-linked immunosorbent assay (ELISA). The following steps were performed: 100 μL of a 30 μg / mL LTA (PGN) solution was added to a 96-well plate and incubated at 37°C until completely evaporated. 200 μL of 1 mg / mL BSA was added to each well to block for 2 h, followed by three washes with PBS. The protein was diluted at a specific ratio and 100 μL was added to each well, incubated at room temperature for 3 h, followed by three washes with PBS. 100 μL of a diluted horseradish peroxidase-labeled specific antibody (1:5000) was added to each well and incubated at 37°C for 2 h. After three washes with PBS, 100 μL of a prepared TMB chromogen was added to each well. Depending on the experimental conditions (approximately 5 min), the reaction was terminated by adding 50 μL of 2M H2SO4, and the OD value was measured at 450 nm. The carrier protein TRX served as a negative control. The results were plotted based on the experimental data. Figure 2 The results showed that compared with TRX, the recombinant protein LcPLA2XIIB had stronger binding ability to both bacterial polysaccharide components LTA and PGN. The results showed that the enhanced antibacterial activity of LcPLA2XIIB was related to its ability to bind to bacterial polysaccharides. The results of this example further explain the results of Example 6.

[0081] Example 8: LcPLA2XIIB exhibits significant antiviral activity

[0082] EPC cells were cultured in DMEM medium containing 10% fetal bovine serum in an incubator at 25°C and a CO2 concentration of 5%. The Reed-Muench method was used to determine the IHNV half-infectious dose (TCID) of tissue culture cells. 50 IHNV (100TCID 50 ) were preincubated with serially diluted recombinant protein LcPLA2XIIB (0-9.6 μM) or TRX in DMEM containing 5% FBS for 2 h. After the cells were cultured to 70%-80% confluency, the incubated mixture was transferred to the plate wells, washed twice with PBS, and incubated for a total of 2 h. DMEM containing 5% FBS was added to the wells. 48 h after infection, the cells and culture medium were collected and analyzed for IHNV proliferation.

[0083] In addition, IHNV (100 TCID 50 ) were preincubated with the recombinant protein LcPLA2XIIB (4.8 μM) or TRX in DMEM containing 5% FBS for 2 h. The mixture was then transferred to the wells containing EPC cells, washed twice with PBS, and incubated for 2 h. DMEM containing 5% FBS was then added to the wells. The cells and culture medium were collected at 12, 24, 36, and 48 h after infection, and the proliferation pattern of IHNV was analyzed. The viral copy number was calculated using a laboratory-developed virus quantitative detection method (specific primers and probes were designed according to the IHNV N gene sequence:

[0084] Upstream primer (IHNVNF): 5′- AGAGCCAAGGCACTGTGCG -3′ (SEQ ID NO. 7);

[0085] Downstream primer (IHNVNR): 5′- TTCTTTGCGGCTTGGTTGA -3′ (SEQ ID NO. 8);

[0086] Probe (IHNVNP): FAM-TGAGACTGAGCGGGACA-NFQ / MGB) (SEQ ID NO. 9).

[0087] like Figure 3 As shown, LcPLA2XIIB can significantly inhibit the proliferation of IHNV in EPC cells at concentrations between 4.8-9.6 μM; at 24, 36 and 48 h after infection, the number of IHNV pre-incubated with LcPLA2XIIB was significantly less than that of IHNV pre-incubated with TRX or untreated (blank control). The results indicate that LcPLA2XIIB has antiviral activity against IHNV.

[0088] Example 9: LcPLA2XIIB has no toxic effect on HEK-293 cells and EPC cells

[0089] HEK-293 (EPC) cells were seeded into 96-well plates at a density of 5,000 cells and cultured in DMEM containing 10% FBS at 37°C (25°C) and 5% CO2. LcPLA2XIIB (9.6 μM) or TRX was serially diluted in DMEM containing 5% FBS and added to the wells of the 96-well plate, followed by incubation at 37°C (25°C) and 5% CO2 for 48 hours. CCK-8 reagent was then added, and the optical density (OD) at 450 nm of each well was measured. Cell viability = [(OD450 of the experimental group – OD450 of the blank group / OD450 of the control group – OD450 of the blank group)] × 100%. The experimental results are shown in Figure 2. Figure 4 As shown in the results, LcPLA2XIIB had no toxic effects on HEK-293 cells and EPC cells. The results showed that LcPLA2XIIB had no toxic effects on mammalian cells and aquatic animal cells.

[0090] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art may make various equivalent modifications or substitutions without departing from the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. A method for preparing a large yellow croaker antimicrobial peptide LcPLA2XIIB, characterized in that: The following steps are involved: (A) Using the LcPLA2XIIB nucleotide sequence SEQ ID NO. 1 and its corresponding amino acid sequence SEQ ID NO. 2, primers were designed to amplify the nucleotide sequence corresponding to the mature peptide; (B) Construction of the recombinant expression vector pET32a / LcPLA2XIIB of LcPLA2XIIB; (C) The obtained recombinant expression vector pET32a / LcPLA2XIIB was introduced into host cells BL21 to induce host cell expression, and LcPLA2XIIB was purified by affinity chromatography.

2. The method for preparing the antimicrobial peptide LcPLA2XIIB from large yellow croaker according to claim 1, wherein The nucleotide sequences of the primers LcPBEF and LcPBER designed in step (A) are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

3. A large yellow croaker antimicrobial peptide LcPLA2XIIB, characterized in that The amino acid sequence is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.

1.

4. The antimicrobial peptide LcPLA2XIIB of large yellow croaker according to claim 2, characterized in that The large yellow croaker antimicrobial peptide LcPLA2XIIB is prepared by the preparation method according to claim 1 or 2.

5. A use of the large yellow croaker antimicrobial peptide LcPLA2XIIB as claimed in claim 3 in the preparation of anti-pathogenic microbial drugs, characterized in that: The anti-pathogenic microorganism drug is an antibacterial drug, an antiviral drug or an antifungal drug.

6. The use according to claim 5, characterized in that The bacteria are Pseudomonas aeruginosa, Aeromonas hydrophila, Vibrio parahaemolyticus, Escherichia coli or Staphylococcus aureus.

7. The use according to claim 5, characterized in that The virus is infectious hematopoietic necrosis virus.

8. The use according to claim 5, characterized in that The fungus is Candida albicans.

9. Use of the large yellow croaker antimicrobial peptide LcPLA2XIIB as claimed in claim 3 in the preparation of an animal anti-pathogenic microbial feed additive.

10. The use according to claim 9, characterized in that The pathogenic microorganisms are pathogenic bacteria, viruses or fungi; the pathogenic bacteria are Pseudomonas aeruginosa, Aeromonas hydrophila, Vibrio parahaemolyticus, Escherichia coli or Staphylococcus aureus; the virus is IHNV; and the fungus is Candida albicans.