Cell-penetrating inhibitory peptide and its application in breast cancer treatment

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a cell penetration inhibitory peptide and application thereof in breast cancer. Specifically, aiming at the interaction between circHIF-1alpha (11, 12) and IGF2BP2, a novel compound named cell penetration IGF2BP2 inhibitory peptide (IIP) is designed to intervene, so as to inhibit the energy metabolism re-regulation and tumor progression of breast cancer. The application first discloses a new use of IIP as an inhibitor of circHIF-1alpha (11, 12). In-vitro experiments prove that IIP can significantly inhibit the energy metabolism reprogramming and tumor progression of breast cancer cells. In summary, the application provides an innovative breast cancer treatment method based on the interaction between circRNA and protein, and successfully intervenes the disease process of breast cancer through the design and application of IIP, which opens up a new direction and possibility for the development of breast cancer treatment.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a cell membrane penetration inhibitory peptide and application thereof in breast cancer. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing the understanding of the background of the present application and should not be taken as an acknowledgement or any form of suggestion that this information forms prior art that is already widely known in a field of endeavor.

[0003] Breast cancer is one of the most common malignant tumors in women, with an increasing incidence worldwide, posing a serious threat to women's health. Circular RNA (circRNA) plays an important role in cell regulation. Compared with linear RNA, they have high stability, low immunogenicity and strong conservation. In recent years, circRNA research has attracted much attention, showing its important role in transcriptional regulation, cell survival, etc. Especially in the field of tumors, abnormal expression of circRNA is closely related to the occurrence and development of tumors. Research on circRNA can help to better understand gene regulation and provide new ideas for tumor diagnosis and treatment. In particular, in breast cancer and other tumors, research on circRNA is expected to reveal its mechanism in the occurrence and development of cancer and provide a theoretical basis for developing more effective treatment methods.

[0004] However, despite some progress in the study of circRNA, the expression profile and regulatory mechanism of circRNA in breast cancer remain to be elucidated. SUMMARY

[0005] To solve the above problems in the prior art, the present application provides a cell membrane penetration inhibitory peptide and its application in breast cancer. Specifically, the present application discloses and utilizes the characteristics of the interaction between circHIF-1α(11,12) and IGF2BP2 to design a cell membrane penetration IGF2BP2 inhibitory peptide (IIP), which successfully inhibits the proliferation of breast cancer cells and tumor progression, providing a new strategy for the treatment of breast cancer. Based on the above research results, the present application is completed.

[0006] Specifically, the present application relates to the following technical solutions:

[0007] In a first aspect, the present application provides a cell membrane penetration inhibitory peptide, which comprises a polypeptide with cell membrane penetration function and a polypeptide targeting circHIF-1α(11,12).

[0008] The polypeptide with cell-penetrating function can be a transactivative transcription protein (TAT) which is a polypeptide rich in arginine sequence found in human immunodeficiency virus, has the property of penetrating peptide, and its amino acid sequence is YGRKKRRQRRR (SEQ ID NO: 1).

[0009] The polypeptide targeting circHIF-1α (11, 12) has an amino acid sequence of TQAVGAIIGK-KGATSA-EVIVPR-DQT (SEQ ID NO: 2).

[0010] In a specific embodiment of the present application, the cell-penetrating inhibitory peptide has an amino acid sequence of YGRKKRRQRRR-TQAVGAIIGK-KGATSA-EVIVPR-DQT (SEQ ID NO: 3).

[0011] Further, for the convenience of tracking the cell-penetrating inhibitory peptide, biotin and a fluorescent label can be provided at both ends thereof, and the fluorescent label can be FITC, which is not specifically limited herein.

[0012] In a second aspect of the present application, the cell-penetrating inhibitory peptide is provided for use in the preparation of a circHIF-1α (11, 12) inhibitor.

[0013] In a third aspect of the present application, a circHIF-1α (11, 12) inhibitor is provided, and the active ingredient of the circHIF-1α (11, 12) inhibitor at least comprises the cell-penetrating inhibitory peptide.

[0014] In a fourth aspect of the present application, the cell-penetrating inhibitory peptide or the circHIF-1α (11, 12) inhibitor is provided for use in the preparation of an antitumor drug.

[0015] Specifically, the present application finds that the cell-penetrating inhibitory peptide inhibits the pro-cancer function of circHIF-1α (11, 12) by competitively binding to IGF2BP2.

[0016] It should be noted that the tumor is used as known by those skilled in the art, which includes benign tumor and / or malignant tumor. The benign tumor is defined as excessive proliferation of cells that cannot form invasive and metastatic tumors in the body. On the contrary, the malignant tumor is defined as cells with various cell abnormalities and biochemical abnormalities that can form systemic diseases (such as tumor metastasis in distant organs).

[0017] In yet another embodiment of the present application, the medicament of the present application can be used for treating a malignant tumor. Examples of the malignant tumor that can be treated by the medicament of the present application include solid tumors and hematological tumors. The solid tumor can be a tumor of breast, bladder, bone, brain, central and peripheral nervous system, colon, endocrine glands (e.g., thyroid and adrenal cortex), esophagus, endometrium, germ cells, head and neck, liver, lung, larynx and hypopharynx, mesothelioma, ovary, pancreas, prostate, rectum, kidney, small intestine, soft tissue, testis, stomach, skin (e.g., melanoma), ureter, vagina and vulva. The hematological tumor is a group of malignant tumors originating from the hematopoietic system, including leukemia, lymphoma, multiple myeloma, etc., which are not specifically limited herein. In addition, the malignant tumor includes a primary tumor in the organ and a corresponding secondary tumor (tumor metastasis) in a distal organ.

[0018] Further, the tumor is a tumor closely related to expression of circHIF-1α (11, 12), further a tumor highly expressing circHIF-1α (11, 12); still further, the tumor is breast cancer.

[0019] Accordingly, in a fifth aspect of the present application, there is provided an anti-tumor medicament, wherein the active ingredient of the anti-tumor medicament comprises the cell-penetrating inhibitory peptide or the circHIF-1α (11, 12) inhibitor.

[0020] According to the present application, the medicament can further comprise at least one other non-active ingredient.

[0021] The non-active ingredient can be a carrier, excipient, diluent, etc. commonly used in pharmacy. Moreover, according to the common method, the medicament can be prepared into a dosage form of powder, granule, suspension, emulsion, syrup, spray, etc. for oral administration, external use, suppository, and sterile injection solution.

[0022] The non-active ingredient that can be contained in the medicament is well known in the art, and a person of ordinary skill in the art can determine that it meets the clinical standard.

[0023] In yet another embodiment of the present application, the medicament of the present application can be administered into the body by a known method. For example, it can be delivered into the tissue of interest by intravenous systemic delivery or local injection (e.g., intratumoral injection). Such administration can be performed via a single dose or multiple doses. It is understood by a person of ordinary skill in the art that the actual dose to be administered in the present application can vary to a great extent depending on various factors, such as target cells, biological type or tissue thereof, general condition of the subject to be treated, administration route, administration method, etc.

[0024] In another embodiment of the present application, the subject of drug administration can be a human or a non-human mammal, such as a mouse, a rat, a guinea pig, a rabbit, a dog, a monkey, a chimpanzee, etc.

[0025] In a sixth aspect of the present application, a method for treating a tumor is provided, which comprises administering to a subject a therapeutically effective amount of the drug described above.

[0026] The subject refers to an animal, preferably a mammal, and most preferably a human, who has been the object of treatment, observation or experiment. The "therapeutically effective amount" refers to the amount of an active compound or pharmaceutical agent, including the compound of the present application, which elicits the biological or medical response that is being sought in a tissue system, animal or human by a researcher, veterinarian, medical doctor or other medical person, including alleviation or partial alleviation of the symptoms of the disease, syndrome, condition or disorder being treated. It must be appreciated that the optimal dosage and spacing of administration of the active ingredients described in the present application are determined by their properties and external conditions such as the form, route and site of administration, and the specific mammal being treated, and this optimal dosage can be determined using conventional techniques. It must also be appreciated that the optimal course of treatment, i.e. the daily dosage of the compound within a given period of time, can be determined using methods known in the art.

[0027] The tumor can be a tumor closely related to the expression of circHIF-1α(11,12), and can be particularly a tumor with high expression of circHIF-1α(11,12); further, the tumor can be breast cancer.

[0028] The above technical solution has the following beneficial technical effects:

[0029] 1. Inhibition of tumor proliferation: by taking advantage of the property of circHIF-1α(11,12) interacting with IGF2BP2, the present application successfully designs and synthesizes IIP, a cell-penetrating inhibitory peptide. In in vitro cell experiments, IIP can significantly inhibit the proliferation of breast cancer cells, providing a new and efficient means for tumor treatment.

[0030] 2. Blocking of tumor progression: the present application also effectively blocks the progression of tumors by interfering with the interaction between circHIF-1α(11,12) and IGF2BP2. This property makes the treatment method particularly beneficial in treating advanced tumors or tumors with high invasiveness.

[0031] 3. Superiority in cell penetration and biological safety: as a cell-penetrating peptide, IIP has good cell penetration ability and can quickly enter the interior of tumor cells to exert its effect. It also has anti-tumor activity and biological safety, ensuring the reliability of the treatment effect and the biological safety of the patient.

[0032] 4. Innovative drug design: The synthesis and application of IIP not only bring new ideas for the treatment of tumors such as breast cancer, but also provide feasibility for drug design in the field of tumor treatment.

[0033] 5. Future clinical application prospects: The treatment method provided by the present application has good application prospects and is expected to become one of the important treatment strategies for tumors such as breast cancer. The flexibility and adjustability of its structure also provide the possibility for further optimization and adaptation to different types of tumors, opening up a new direction for clinical tumor treatment. BRIEF DESCRIPTION OF DRAWINGS

[0034] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced below. Obviously, the drawings in the following description are only embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of the provided drawings.

[0035] Figure 1 circHIF-1α(11,12) promotes aerobic glycolysis and tumor progression of breast cancer; wherein A is the energy absorption of glucose of the cell after knocking down circHIF-1α(11,12) in the breast cancer cell is reduced; B is the lactic acid production capacity of the cell after knocking down circHIF-1α(11,12) in the breast cancer cell is reduced; C is the glucose absorption capacity of the cell after overexpressing circHIF-1α(11,12) in the breast cancer cell is increased; D is the lactic acid production capacity of the cell after overexpressing circHIF-1α(11,12) in the breast cancer cell is increased; E is the proliferation ability of the cell after knocking down circHIF-1α(11,12) in the breast cancer cell is reduced; F is the migration and invasion ability of the cell after knocking down circHIF-1α(11,12) in the breast cancer cell is reduced.

[0036] Figure 2 is a result graph of IIP inhibiting the binding ability between circHIF-1α(11,12) and IGF2BP2; A-B are the effects of IIP on the binding ability between IGF2BP2 and circHIF-1α(11,12) verified by RIP experiment. The results show that, in breast cancer cells, compared with the control group CTLP, IIP can significantly inhibit the binding of IGF2BP2 and circHIF-1α(11,12).

[0037] Figure 3Figure 1 shows the results of IIP reversing the promoting effect of circHIF-1a (11, 12) on the glycolytic capacity of breast cancer; A-B show that IIP can reverse the promoting effect of circHIF-1a (11, 12) on the glucose uptake capacity of breast cancer cells; C-D show that IIP can reverse the promoting effect of circHIF-1a (11, 12) on the lactic acid production capacity of breast cancer cells.

[0038] Figure 4 Figure 2 shows the results of IIP reversing the promoting effect of circHIF-1a (11, 12) on the progression capacity of breast cancer; A shows that IIP can reverse the promoting effect of circHIF-1a (11, 12) on the proliferation capacity of breast cancer cells; B shows that IIP can reverse the promoting effect of circHIF-1a (11, 12) on the migration capacity of breast cancer cells. DETAILED DESCRIPTION

[0039] It should be noted that the following detailed description is merely illustrative in nature and is intended to provide further description of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0040] It is also important to note that the terms used herein are not intended to limit the exemplary embodiments to the specific embodiments described herein, and it is contemplated that the exemplary embodiments can be practiced with other embodiments that are now known or which become known in the future. As used herein, unless otherwise clear from context, the singular forms "a," "an," and "the" are intended to include the plural forms as well, and it is further understood that when "comprising" is used, it is intended to include the more restrictive term "consisting of." It is also understood that the terms "including" and / or "having" have the same meaning as "comprising" and / or "containing."

[0041] Terminology:

[0042] Cell penetrating peptides (CPPs) are a class of small volume, short amino acid sequence polypeptide sequences with high affinity to lipid bilayer binding. These polypeptide sequences are responsible for membrane translocation when combined with the cell membrane, prompting the internalization of penetrating peptides into cells. Generally, CPPs are endocytosed by cells through direct cell membrane penetration and / or endocytosis. CPPs have been widely used to deliver membrane-permeable drugs, polypeptides, proteins and nucleic acids to target cells and tissues, and are considered to be a promising alternative to viral vectors. This technology is expected to provide new possibilities for overcoming obstacles in drug delivery and improving therapeutic effects.

[0043] Transactivative transcription protein (TAT) is a polypeptide rich in arginine sequence found in human immunodeficiency virus, which has the property of penetrating peptide. The amino acid sequence is YGRKKRRQRRR. The chemical structural formula is as follows:

[0044]

[0045] There are many advantages in using TAT to mediate polypeptide transduction: ① The transduction process does not depend on receptors and transporters, and can still be carried out at 4℃. ② The transduction efficiency is high and easy to control. ③ Low toxicity, less damage to cells.

[0046] As mentioned above, although some progress has been made in the study of circRNA, the expression profile and regulatory mechanism of circRNA in breast cancer still need to be elucidated.

[0047] The present application identifies and characterizes a circRNA-circHIF-1α(11,12), which is a circular RNA formed by the head-to-tail splicing of exon 11 and 12 regions of its host gene HIF-1α (the nucleotide sequence is shown as SEQ ID NO. 4). It can promote the energy metabolism reprogramming (aerobic glycolysis) and tumor progression of breast cancer. EIF4A3 is involved in inducing the circularization and nuclear translocation of circHIF-1α(11,12), and promotes the up-regulation of circHIF-1α(11,12) in breast cancer by binding to the circHIF-1α(11,12) precursor. Further studies have found that circHIF-1α(11,12) can act as a scaffold to recruit IGF2BP2 and HIF-1α mRNA to form an RNA-protein ternary complex. Through this complex, circHIF-1α(11,12) promotes the binding of IGF2BP2 to HIF-1α mRNA to enhance its stability, and up-regulates the expression of its target genes, including LDHA, GLUT1 and PDK1.

[0048] The present application finds and discloses the key role of circHIF-1α(11,12) in promoting tumor aerobic glycolysis and progression in breast cancer. Blocking the interaction between circHIF-1α(11,12) and IGF2BP2 may open up a new way for the treatment and management of breast cancer.

[0049] In view of this, the present application designs a polypeptide with the functions of targeting circHIF-1α(11,12) and cell membrane penetration, which is a tandem peptide composed of TAT and a targeting sequence. Meanwhile, the tandem peptide is labeled with biotin and FITC fluorescence on both sides, so as to track the tandem peptide. Because it can bind to circHIF-1α(11,12) by competition, thereby specifically inhibiting the promotion of cancer function of circHIF-1α(11,12) through IGF2BP2.

[0050] The present application is further explained and described by the following examples, but does not constitute a limitation on the present application. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. Breast cancer cells MDA-MB-231, MDA-MB-468, BT-474 and MCF-7 are available from ATCC. The tandem peptide IIP used in the examples is synthesized by Platinum Biotechnology Co., Ltd. (Shanghai) as an agent, and its amino acid sequence is as follows: IIP: biotin-YGRKKRRQRRR-TQAVGAIIGK-KGATSA-EVIVPR-DQT-FITC, purity ≥ 95%, powder, -20°C light dry storage.

[0051] Example 1. circHIF-1α(11,12) can promote aerobic glycolysis and tumor progression of breast cancer

[0052] Our experimental results show that when we reduce the expression of circHIF-1α(11,12), the aerobic glycolysis ability of breast cancer cells is significantly inhibited. It is manifested as a decrease in lactic acid production and a decrease in glucose uptake ability. At the same time, CCK8 proliferation experiment and Transwell chamber experiment show that the proliferation and migration ability of cells are also significantly inhibited. On the contrary, when we overexpress circHIF-1α(11,12), we observe the opposite results, i.e. the aerobic glycolysis ability of breast cancer cells is enhanced, and the tumor progression is also promoted. Therefore, we conclude that circHIF-1α(11,12) can promote aerobic glycolysis and tumor progression of breast cancer. Figure 1 ) The following is the specific test method.

[0053] 1. Lactic acid production experiment

[0054] (1) 3000-5000 cells per well in a 96-well plate, after the cells adhere, in the experimental group, add IIP with a final concentration of 5 μM, while in the control group, add the same amount of negative control CTLP. Continue to culture the cells for 4 hours, then replace with new complete culture medium and continue to culture. Take 10 μl of cell supernatant for detection after 6-12 h.

[0055] (2) Using 2 mM standard, prepare the standard as shown in the following table:

[0056] Table 1 Standard preparation method

[0057]

[0058] (3) Prepare the working solution according to the instructions. Add 50 μl of working solution to each sample and standard, and mix thoroughly by tapping the plate.

[0059] (4) Immediately detect the absorbance value of each well at 450 nm wavelength using the enzyme marker, and then read the absorbance value again after incubating at 37°C for 30 minutes.

[0060] (5) The calculation process is as follows: first, draw a standard curve according to the absorbance value and the concentration of the standard. Then, use the standard curve to calculate the concentration of lactic acid in each well, and multiply it by the corresponding dilution factor.

[0061] 2. Glucose uptake experiment

[0062] (1) Seed 3000-5000 cells per well in a 96-well plate, and after the cells adhere, add IIP at a final concentration of 5 μM to the experimental group, and add an equal amount of negative control CTLP to the control group. Continue to culture until 4 h, and then replace the serum-free medium and culture overnight.

[0063] (2) The next day, wash the cells with PBS 3 times, and incubate the starved cells with 100 μl of KRPH / 2% BSA buffer for 40 min, and perform standard gradient dilution.

[0064] (3) Use 0.01 mM 2-DG6P standard to prepare the standard curve diluent according to the following steps.

[0065] Table 2 Standard preparation method

[0066]

[0067] (4) Add 10 μl of 2-DG at a final concentration of 10 mM to the experimental group and incubate for 20 minutes, while the sample background control group does not add 2-DG. Then, wash the cells with PBS 3 times to remove the exogenous 2-DG.

[0068] (5) Add 80 μl of lysis buffer to the sample and shake well to fully lyse.

[0069] (6) Subject the cell lysate to a freeze / thaw cycle, then heat at 85°C for 40 minutes, and finally cool on ice for 5 minutes.

[0070] (7) Add 10 μl of neutralization buffer and mix well by inverting.

[0071] (8) Dilute the sample by 1:10, i.e. add 45 μl of assay buffer to 5 μl of sample.

[0072] (9) Add 10 μl of reaction mixture A to each sample and standard well, mix and incubate at 37°C for 1 hour.

[0073] (10) Add 90 μl of lysis buffer to each well, seal with sealing film and heat at 90°C for 40 minutes.

[0074] (11) Cool on ice for 5 minutes and add 12 μl of neutralization buffer to neutralize the reaction.

[0075] (12) Add 38 μl of reaction mixture B to each well, mix and incubate at 37°C in the dark. Measure the absorbance value at 412 nm using a microplate reader every 2-3 minutes until the absorbance value of standard 6 (100 pmol / well) is reached.

[0076] (13) Data analysis: First, plot a standard curve according to the absorbance value and the concentration of the standard. Then, calculate the concentration of glucose in each well according to the standard curve, and multiply it by the corresponding dilution factor.

[0077] 3. CCK8 proliferation experiment

[0078] (1) Plate seeding: Seed breast cancer cells in a 96-well plate at 5000 cells per well, with 5 replicates in each experimental group. After the cells adhere, in the experimental group, add IIP at a final concentration of 5 μM, while in the control group, add an equal amount of negative control CTLP. Continue to culture the cells for 4 hours, then replace with fresh complete culture medium. Detect at 24 hours, 48 hours and 72 hours.

[0079] (2) Detection: Add 10 μl of CCK8 detection solution to each well, then place the plate in the cell incubator for 2 hours. Then, measure the absorbance value (wavelength 450 nm) using a microplate reader.

[0080] 4. Transwell chamber experiment (cell migration ability)

[0081] (1) The breast cancer cells were seeded in 6-well plates, and after the cells adhered, in the experimental group, IIP with a final concentration of 5 μM was added, while in the control group, an equal amount of negative control CTLP was added. After the cells adhered, the culture medium was replaced with fresh complete culture medium, and the cells were cultured. After trypsin digestion, the cells were resuspended in 180-200 μl of serum-free incomplete culture medium and added to the upper layer of the Transwell chamber. 600-800 μl of complete culture medium containing serum was added to the lower layer of the 24-well plate.

[0082] (2) After 16 h of infiltration and 24 h of migration, the Transwell chamber was removed, the culture medium was aspirated, and 600 μl of 4% paraformaldehyde was added, and incubated at room temperature for 30 min.

[0083] (3) After the paraformaldehyde was aspirated, 600 μl of crystal violet was added, and incubated at room temperature for 15 min. The crystal violet was prepared as follows: 0.05 g of crystal violet + 40 ml of PBS + 10 ml of methanol.

[0084] (4) The crystal violet was aspirated, and the residual crystal violet on the upper layer of the Transwell chamber was rinsed with flowing double-distilled water, and then the water on the upper layer of the Transwell chamber was wiped dry with a cotton swab.

[0085] (5) The number of cells was observed, photographed, and counted under an inverted microscope.

[0086] Example 2. IIP can inhibit the binding of circHIF-1α(11,12) to IGF2BP2

[0087] We confirmed by RIP experiment that when IIP was added to the cells, the content of circHIF-1α(11,12) in the IGF2BP2 protein pull-down product was reduced compared with the negative control group CTLP, suggesting that IIP can inhibit the binding of circHIF-1α(11,12) to IGF2BP2 by competitively binding to circHIF-1α(11,12), thereby inhibiting its pro-cancer function. Figure 2 ) The following is the method of the RIP test.

[0088] 1. Cell lysis:

[0089] (1) The breast cancer cells were seeded in 6-well plates, and after the cells adhered, in the experimental group, IIP with a final concentration of 5 μM was added, while in the control group, an equal amount of negative control CTLP was added. After the cells adhered, the culture medium was replaced with fresh complete culture medium, and the cells were cultured. After trypsin digestion, the cells were resuspended in 180-200 μl of serum-free incomplete culture medium and added to the upper layer of the Transwell chamber. 600-800 μl of complete culture medium containing serum was added to the lower layer of the 24-well plate. 2 (2) After 16 h of infiltration and 24 h of migration, the Transwell chamber was removed, the culture medium was aspirated, and 600 μl of 4% paraformaldehyde was added, and incubated at room temperature for 30 min. 2 (3) After the paraformaldehyde was aspirated, 600 μl of crystal violet was added, and incubated at room temperature for 15 min. The crystal violet was prepared as follows: 0.05 g of crystal violet + 40 ml of PBS + 10 ml of methanol. (4) The crystal violet was aspirated, and the residual crystal violet on the upper layer of the Transwell chamber was rinsed with flowing double-distilled water, and then the water on the upper layer of the Transwell chamber was wiped dry with a cotton swab. (5) The number of cells was observed, photographed, and counted under an inverted microscope.

[0090] (2) Add 10 ml PBS to the flask, scrape the cells to form a cell suspension, and place the flask in a centrifuge tube at 4°C. Centrifuge at 1500 rpm for 5 minutes, discard the supernatant, and leave the precipitate.

[0091] (3) Prepare 100 μl complete lysis buffer for each sample: Add 0.5 μl ribonuclease inhibitor and 0.25 μl protease inhibitor cocktail to 100 μl RIP lysis buffer. Add the prepared complete lysis buffer to the cell precipitate, mix thoroughly by blowing, and place on ice for 5 minutes for complete lysis. Continue with the next step or temporarily store in a -80°C refrigerator.

[0092] 2. Immunoprecipitation magnetic bead preparation:

[0093] (1) Pre-mix the magnetic beads at 4°C, and take 50 μl of magnetic beads for each group into an EP tube.

[0094] (2) Add 500 μl of washing buffer to each EP tube, mix briefly by vortexing, place on a magnetic stand, and let stand for 1 minute. Discard the supernatant and repeat the washing once.

[0095] (3) Add 100 μl of washing buffer to each group, mix thoroughly. Add 1 μg of IgG antibody to the negative control group, and add the same species-derived IGF2BP2 antibody to the experimental group. Incubate at room temperature for 30 minutes.

[0096] (4) Vortex briefly and centrifuge, place the EP tube on a magnetic stand, and let stand for 1 minute. Discard the supernatant.

[0097] (5) Add 500 μl of washing buffer to the EP tube, mix gently, and place on a magnetic stand for 1 minute. Discard the supernatant and repeat the washing once.

[0098] (6) Add another 500 μl of washing buffer to the EP tube, mix gently, and place on ice for later use.

[0099] 3. Immunoprecipitation of RNA-binding protein / RNA complex

[0100] (1) Prepare 900 μl of immunoprecipitation buffer (860 μl of RIP washing buffer + 5 μl of ribonuclease inhibitor + 35 μl of 0.5M EDTA) for each group.

[0101] (2) Centrifuge the lysate obtained in the above step at 4°C at 14000 rpm for 10 minutes. Transfer the supernatant to a new enzyme-free EP tube, and take 10 μl of the supernatant as Input and temporarily store it at -80°C.

[0102] (3) Each group took 100 μl supernatant into 900 μl immunoprecipitation buffer, and incubated overnight at 4°C.

[0103] (4) The EP tube was vortexed for instant centrifugation, and placed on a magnetic stand for 1 minute. The supernatant was discarded.

[0104] (5) 500 μl of washing buffer was added, and after gentle mixing, the mixture was placed on a magnetic stand for 1 minute. The supernatant was discarded. The washing was repeated 6 times.

[0105] 4. Purification

[0106] (1) 150 μl of proteinase K buffer (117 μl of washing buffer + 18 μl of proteinase K + 15 μl of 10% SDS) was prepared for each group. 140 μl of proteinase K buffer was prepared for the corresponding Input group, and added to the above-mentioned washed magnetic beads, and gently mixed.

[0107] (2) Incubated at 55°C for 30 minutes.

[0108] (3) Instant vortex centrifugation, and the EP tube was placed on a magnetic stand for 1 minute. The supernatant was transferred to a new enzyme-free EP tube, and 250 μl of washing buffer was added.

[0109] (4) 400 μl of phenol:chloroform:isopropyl alcohol was added to the EP tube, vortexed for 15 seconds, and centrifuged at 14000 rpm at room temperature for 10 minutes. 350 μl of the upper aqueous phase was taken into a new enzyme-free EP tube.

[0110] (5) 400 μl of chloroform was added to the tube, vortexed for 15 seconds, and centrifuged at 14000 rpm at room temperature for 10 minutes. 300 μl of the upper aqueous phase was taken into a new enzyme-free EP tube.

[0111] (6) 50 μl of salt solution I, 15 μl of salt solution II, and 5 μl of precipitation enhancer were added to the tube, and 850 μl of anhydrous ethanol was added, and vortexed. The mixture was placed in a -80°C refrigerator for 1 hour or overnight.

[0112] (7) Centrifuged at 14000 rpm at 4°C for 30 minutes, the supernatant was discarded, and the precipitate was washed once with 80% ethanol. Centrifuged at 14000 rpm at 4°C for 15 minutes, the supernatant was discarded, and the precipitate was centrifuged at 14000 rpm at 4°C for 5 minutes. The supernatant was carefully aspirated, and the cap was opened to dry the residual alcohol.

[0113] (8) 7 μl of DEPC water was added to each tube to dissolve the RNA.

[0114] (9) The enrichment of circHIF-1α (11, 12) was detected by RT-qPCR using all the RNA of the experimental group and the control group and 1 μg of RNA of the Input group.

[0115] Example 3. IIP can reverse the promoting effect of circHIF-1a(11,12) on glycolytic capacity of breast cancer

[0116] We confirmed that overexpression of circHIF-1a(11,12) can significantly promote the lactic acid production and glucose uptake capacity of breast cancer cells through energy metabolism related experiments, i.e. lactic acid production and glucose uptake experiments. However, when IIP was added at the same time, the lactic acid production and glucose uptake of the cells were no longer affected compared with the negative control group CTLP. It proves that IIP can reverse the promoting effect of circHIF-1a(11,12) on glycolytic capacity of breast cancer Figure 3 ) The experimental method is the same as method 1 and 2 in the embodiment case 1.

[0117] Example 4. IIP can reverse the promoting effect of circHIF-1a(11,12) on progression capacity of breast cancer

[0118] We confirmed that overexpression of circHIF-1a(11,12) can significantly promote the proliferation and migration capacity of breast cancer cells through cell proliferation experiment and Transwell chamber experiment. However, when IIP was added at the same time, the promoting effect was significantly reversed compared with the negative control group CTLP. It proves that IIP can reverse the promoting effect of circHIF-1a(11,12) on progression capacity of breast cancer Figure 4 ) The experimental method is the same as method 3 and 4 in the embodiment case 1.

[0119] Nucleotide sequence information of circHIF-1a(11,12):

[0120] CCTAATAGTCCCAGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGTTGGAATTGGTAGAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGATTTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACTACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAAATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCATCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGTCAAAG (SEQ ID NO: 4)

[0121] It should be noted that the above examples are only used to illustrate the technical solutions of the present application but not to limit it. Although the present application is explained in detail with reference to the given examples, the technical solutions of the present application can be modified or replaced equivalently according to the needs without departing from the spirit and scope of the technical solutions of the present application.

Claims

1. A cell-penetration-inhibiting peptide, characterized in that, The amino acid sequence of the cell-penetration-inhibiting peptide is shown in SEQ ID NO:

3.

2. The cell-penetration-inhibiting peptide as described in claim 1, characterized in that, The cell-penetrating inhibitory peptide is labeled with biotin and fluorescent markers at both ends.

3. The cell-penetration-inhibiting peptide as described in claim 2, characterized in that, The fluorescent label is FITC.

4. The use of the cell-penetrating inhibition peptide according to any one of claims 1-3 in the preparation of an anti-breast cancer drug.

5. An anti-breast cancer drug, characterized in that, The active ingredient of the anti-breast cancer drug comprises the cell-penetration inhibitory peptide according to any one of claims 1-3.

6. The anti-breast cancer drug as described in claim 5, characterized in that, The drug also includes at least one other inactive pharmaceutical ingredient.

7. The anti-breast cancer drug as described in claim 5, characterized in that, The drugs are administered to humans and non-human mammals.

Images