Pseudovibrio habitans and application thereof in red tide treatment
By using Pseudovibrio ascidiaceicola C-3 and its bacterial agent, the algae cell structure and organelles structure were destroyed, and the frequent occurrence of red tides was solved, and effective algae inhibition and red tide control were achieved.
Patent Information
- Application Number
- CN202510625775.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-15
- Publication Date
- 2025-08-15
AI Technical Summary
The frequent occurrence of red tides poses a serious threat to the marine environment, and it is difficult for the existing technology to effectively prevent and control algae growth and control red tides.
Pseudovibrio ascidiaceicola C-3 and its bacterial agent are used to destroy algae cell structure and organellar structure, inhibit algae growth, dissolve algae and kill algae, reduce chlorophyll content, and control red tides.
It significantly inhibits algae growth, dissolves algae, reduces chlorophyll content, effectively controls red tides, and solves the problem of frequent red tides.
Smart Images

Figure HDA0005403903050000011 
Figure HDA0005403903050000021 
Figure HDA0005403903050000031
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microorganisms, and relates to Pseudomonas aeruginosa and application thereof in controlling red tide. Background Art
[0002] A red tide is an ecological phenomenon characterized by discoloration of the water caused by the sudden proliferation or aggregation of certain phytoplankton, protozoa, or bacteria in seawater under certain environmental conditions. Red tides can occur not only in red, but also in white, yellow, brown, and green. The increasing pollution of coastal areas and the irrational exploitation of marine resources have placed tremendous pressure on the ecological environment, leading to the frequent occurrence of localized red tides and causing ecological disasters in the marine environment. This ecological disaster has resulted in the contamination of water sources, the depletion of energy resources, and the reduction of dissolved oxygen in the water, posing a serious threat to the living environment. Some red tide organisms also produce toxins that directly poison aquatic life, causing significant losses to coastal economies and aquaculture.
[0003] my country is prone to red tides, and the incidence of harmful red tides is increasing annually. According to statistics from the State Oceanic Administration, the frequency of red tides in my country has tripled every decade since the 1970s. Since the beginning of the 2000s, there have been an average of over 30 large-scale red tides annually. According to the 2017 China Marine Disaster Bulletin, 66 red tides were observed across China's oceans in 2017, covering a total area of 8,890 square kilometers and causing direct economic losses exceeding 100 million yuan. Among the 12 dominant algae species causing red tides, Prorocentrum donghaiense has the most outbreaks, with 29. Next is Noctiluca scintillans, which has caused nine red tides. Karenia mikimotoi and Red Algae have each caused five outbreaks, Heterosigma akashiwo and Goniocarpus multistriata have each caused four, Carrionella oceanica, Skeletonema costatum, and Phaeocystis globosum have each caused three, and Chrysotrichum antrophaeum, Gymnodinium spp., Thalassiocarpus marinum, Steinerella conicalis, and Goniocarpus striata have each caused one.
[0004] Based on the trend of increasing frequency, expanding scope and increasing harm of red tide disasters in recent years, effective prevention and control of the occurrence of red tides (or red tide algae) is the primary prerequisite for protecting the marine environment. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a bacterial strain capable of killing algae.
[0006] The strain provided by the present invention is Pseudovibrio ascidiaceicola C-3, and its deposit number in Guangdong Provincial Microbiological Culture Collection Center is GDMCC No. 62508.
[0007] The present invention also provides a bacterial agent, the active ingredient of the bacterial agent is the Pseudovibrio ascidiaceicola C-3.
[0008] The above-mentioned bacterial agent can be any one of the following bacterial agents 1) to 5):
[0009] 1) Bacterial agents used to inhibit the growth and / or reproduction of algae;
[0010] 2) Bacterial agents used to dissolve algae;
[0011] 3) Bacterial agents used to kill algae;
[0012] 4) Bacterial agents used to reduce the chlorophyll content of algae;
[0013] 5) Bacterial agents used to control red tides.
[0014] In the above-mentioned microbial agent, the algae dissolving can be manifested in the destruction of algae cell structure (such as cell membrane) and / or organelle (such as chloroplast) structure; the red tide is a red tide caused by algae or algae in combination with other organisms;
[0015] And / or, the algae is Scrippsiella trochoidea.
[0016] The above-mentioned microbial agent may further include a carrier. The carrier may be a solid carrier or a liquid carrier. The solid carrier may be a mineral material, a plant material, or a polymer compound; the mineral material may be at least one of clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica, and diatomaceous earth; the plant material may be at least one of corn flour, soy flour, and starch; and the polymer compound may be polyvinyl alcohol and / or polyglycol. The liquid carrier may be an organic solvent, vegetable oil, mineral oil, or water; the organic solvent may be decane and / or dodecane. In the microbial agent, the active ingredient may be present in the form of cultured living cells, a fermentation broth of living cells, a filtrate of a cell culture, or a mixture of cells and a filtrate. The composition may be in a variety of dosage forms, such as a liquid, an emulsion, a suspension, a powder, a granule, a wettable powder, or a water-dispersible granule.
[0017] As needed, surfactants (such as Tween 20, Tween 80, etc.), binders, stabilizers (such as antioxidants), pH regulators, etc. may be added to the bacterial agent.
[0018] The present invention also provides any of the following uses of the Pseudovibrio ascidiaceicola C-3 or the bacterial agent:
[0019] 1) Bacterial agents used to inhibit the growth and / or reproduction of algae;
[0020] 2) Bacterial agents used to dissolve algae;
[0021] 3) Bacterial agents used to kill algae;
[0022] 4) Bacterial agents used to reduce the chlorophyll content of algae;
[0023] 5) Bacterial agents used to control red tides.
[0024] In the above application, the algae dissolution may be reflected in the destruction of algae cell structure and / or organelle structure; the red tide is a red tide caused by algae or algae in combination with other organisms;
[0025] And / or, the algae is Scrippsiella trochoidea.
[0026] The present invention also provides any of the following methods:
[0027] A1) A method for inhibiting the growth and / or reproduction of algae, comprising: treating algae with the Pseudovibrio ascidiaceicola C-3 or the bacterial agent to inhibit the growth and / or reproduction of algae;
[0028] A2) A method for dissolving algae, comprising: treating algae with the Pseudovibrio ascidiaceicola C-3 or the bacterial agent to dissolve the algae;
[0029] A3) A method for killing algae, comprising: treating algae with the Pseudovibrio ascidiaceicola C-3 or the bacterial agent to kill the algae;
[0030] A4) A method for reducing the chlorophyll content of algae, comprising: treating the algae with the Pseudovibrio ascidiaceicola C-3 or the bacterial agent to reduce the chlorophyll content of the algae;
[0031] A5) A method for controlling red tides, comprising: adding the Pseudovibrio ascidiaceicola C-3 or the bacterial agent to water where red tides occur, thereby controlling the red tides.
[0032] In the above method, the algae dissolution may be reflected in the destruction of algae cell structure and / or organelle structure; the red tide is a red tide caused by algae or algae in combination with other organisms;
[0033] And / or, the algae is Scrippsiella trochoidea.
[0034] The present invention also provides a method for culturing the Pseudovibrio ascidiaceicola C-3, which comprises the step of culturing the Pseudovibrio ascidiaceicola C-3 in a culture medium for culturing Pseudovibrio ascidiaceicola.
[0035] The present invention also provides a preparation method of the bacterial agent, which comprises the following steps: using the Pseudovibrio ascidiaceicola C-3 as an active ingredient to obtain the bacterial agent.
[0036] The present invention discloses a Pseudovibrio ascidiaceicola C-3 that kills algae cells, and the killing effect is dose-dependent. After the algae cells are treated with Pseudovibrio ascidiaceicola C-3, algae vacuoles are present, a large amount of solutes are visible, the algae cells undergo plasmolysis, morphological characteristics and even structural damage are obvious, and organelles are blurred. Cytoplasm and organelles overflow from the cells, and the number of multivesicular bodies increases significantly. The algae chloroplast structure is severely damaged, the organelle membrane integrity is significantly lost, and thylakoid outflow is observed. This indicates that the present invention can be used to kill algae and further be used for the control of red tides.
[0037] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0038] Description of biological material deposit
[0039] Taxonomic nomenclature: Pseudovibrio ascidiaceicola
[0040] Strain number: C-3
[0041] Name of depository institution: Guangdong Provincial Microbial Culture Collection Center
[0042] Abbreviation of depository unit: GDMCC
[0043] Address of the depository: Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong, China, Postal Code: 510070
[0044] Deposit date: June 1, 2022
[0045] GDMCC registration number: GDMCC No.62508 BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 This is the result of agarose gel electrophoresis of the PCR amplification product of the 16SrRNA coding gene of Pseudovibrio ascidiaceicola C-3.
[0047] Figure 2 400× optical microscopic images of Styrax coniformis samples. (a) Blank control; (b) C-3 treated for one day, showing algal vacuoles and algal cell lysate. Caption: 20.75 μm.
[0048] Figure 3 Transmission electron micrographs of the lysis of St. truncatula by the action of Pseudovibrio ascidiaceicola C-3. (1-5) In St. truncatula cells, the control group showed normal cells with chloroplasts and mitochondria, showing dense and intact chloroplasts and mitochondria, and the cytoplasm, cell wall, and cell membrane remained intact. (6, 7) Plasmolysis of St. truncatula cells occurred 24 hours after C-3 treatment. (8, 9, 10) St. truncatula cells were damaged 24 hours after C-3 treatment. After treatment with 10% bacterial solution, the experimental group cells showed obvious morphological and even structural damage. Significant plasmolysis was observed, and organelles were blurred. Cell membrane integrity and organelle structure were severely damaged. Cytoplasm and organelles overflowed from the cells, and the number of multivesicular bodies increased significantly. Compared with normal algal cells not exposed to the strain, this algicidal effect caused severe damage to the chloroplast structure, with a significant loss of organelle membrane integrity and observed thylakoid efflux. C: chloroplast; M: mitochondria. Ratio (1, 2, 3, 6, 8, 9, 10): 2 μm; (4): 500 nm; (5, 7): 1 μm. DETAILED DESCRIPTION
[0049] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0050] In the following examples, the LB medium formulation is as follows: 10.0 g of tryptone, 5.0 g of yeast extract, and 10.0 g of NaCl are added to 950 ml of deionized water. The container is shaken until the solutes are dissolved. The pH is adjusted to 7.0 with 5 mol / L NaOH. The medium is then sterilized by steam sterilization at 15 psi for 20 min.
[0051] The specific formula of f / 2 culture medium is as follows (mass of inorganic salts per liter of seawater): Na2EDTA 4.16g, FeCl3·6H2O 3.15g, CuSO4·5H2O 0.01g, ZnSO4·7H2O 0.022g, CoCl2·6H2O 0.01g, MnCl2·4H2O 0.18g, Na2MoO4·2H2O 0.006g, Vitamin B 12 0.0005 g, thiamine B1 hydrochloride 0.1 g, biotin 0.0005 g, NaNO3 0.075 g, NaH2PO4·2H2O 0.00565 g, make up to 1 L with filtered natural seawater. Adjust the pH to 8.0 with 1 M NaOH or HCl. Sterilize by autoclaving at 15 psi for 15 minutes and cool to room temperature.
[0052] Scrippsiella trochoidea: (Shanghai Guangyu Biotechnology Co., Ltd., catalog number 202DB6954).
[0053] Example 1. Screening, identification and characteristics of strains
[0054] 1. Screening of strains
[0055] On August 21, 2017, a localized red tide occurred near the coast of South China (in the surface waters of Shenzhen's Yantian Port). The algae responsible for this red tide were a mixed species, with the dominant species including Scrippsiella trochoidea, Karenia mikimotoi, and Scrippsiella trochoidea. Water samples were collected from the area and brought back to the laboratory. They were filtered through gauze to remove impurities and large particles, then through a 100μm metal mesh to remove debris, and finally through a 10μm membrane filter to remove algal cells. The filtrate was then coated and screened for bacteria.
[0056] The prepared filtrate was serially diluted, and 20 μL of each was spread onto LB solid medium (formula: peptone 10 g, yeast extract 5 g, sodium chloride 10 g, ddH2O 1 L, agar 15 g) and cultured overnight until clear single colonies emerged. A total of 180 culturable bacterial strains were selected.
[0057] Then, a single clone was picked and cultured in LB liquid medium (10 mL) at 30°C for 12 h. 5 CFU / mL to 1 × 10 7 CFU / mL was added to the culture medium of St. Petersburg (the culture medium obtained by culturing St. Petersburg in f / 2 culture medium) as the experimental group, and the inhibition of algae growth was continuously monitored for two weeks. The control group was set up without adding monoclonal strains. The algae density was detected by counting under a binocular microscope (4×10 magnification). Each sample was counted 3 times and the results were averaged. The experimental results showed that (1×10 7 CFU / mL group, for example. Adding the bacterial solution inhibited algal growth 48 hours later. After 48 hours, the algal cell density in the high-concentration group decreased to 20.6% of the control group, a significant difference. After 96 hours, the algal cell density in the low-concentration group decreased to 11.04% of the control group, with a significant difference in algal biomass compared to the control group (P < 0.05). By 264 hours, algal growth in the experimental group had essentially ceased, with over 99% of algal growth inhibited. The algal biomass showed a highly significant difference compared to the control group (P < 0.01) (Table 1).
[0058] Therefore, it was considered that the strain (C-3) was obtained in the preliminary screening.
[0059] 2. Identification of strain (C-3)
[0060] DNA of strain (C-3) was extracted using bacterial 16S rRNA universal primers (forward primer as shown in SEQ ID NO: 1, reverse primer as shown in SEQ ID NO: 2).
[0061] Forward primer: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1).
[0062] Reverse primer: CTGAGCCAGGATCAAACTCT (SEQ ID NO: 2).
[0063] The amplified PCR product is the coding gene of 16SrRNA. The PCR product is subjected to electrophoresis detection. The results are as follows Figure 1 As shown, the product with a band size of 1500 bp was sent for sequencing, and the sequencing results showed that the PCR product (16SrRNA encoding gene) had the nucleotide sequence shown in SEQ ID NO: 3.
[0064] After sequence comparison, it was found that the 16S rRNA coding gene of strain (C-3) had 99% similarity with the 16S rRNA coding gene of Pseudovibrio ascidiaceicola, belonging to the Bacteria kingdom, Proteobacteria phylum, Gammaproteobacterium class (Gammaproteobacterium), and the genus Pseudovibrio ascidiaceicola (GenBank ID: OMPG01000013.1). Therefore, the above strain (C-3) belongs to the Bacteria kingdom, Proteobacteria phylum, Gammaproteobacterium class (Gammaproteobacterium), and the genus Pseudovibrio ascidiaceicola, and the strain is designated as Pseudovibrio ascidiaceicola C-3.
[0065] Pseudovibrio ascidiaceicola C-3 was deposited in the Guangdong Provincial Microbial Culture Collection Center (GDMCC for short, address: Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province, Postal Code: 510070) on June 1, 2022, with the deposit number GDMCC No. 62508.
[0066] Example 2: Application of Pseudovibrio ascidiaceicola C-3 in algae inhibition
[0067] 1. Method of inhibiting algae with Pseudovibrio ascidiaceicola C-3
[0068] 1. High-density culture of Pseudovibrio ascidiaceicola C-3
[0069] The Pseudovibrio ascidiaceicola C-3 obtained in Example 1 was cultured in a 50 mL Erlenmeyer flask (LB liquid medium: 10 g peptone, 5 g yeast extract, 10 g sodium chloride, 1 L ddH2O, pH adjusted to 7.0 with 5 mol / L NaOH. Steam sterilized at 15 psi high pressure for 20 min). The culture conditions were 30° C., 200 r / min, and 6 h. The strain density was close to OD 600=0.5, transferred to a 250 mL Erlenmeyer flask for secondary culture (still LB liquid medium), culture conditions are 30 ° C, rotation speed 200 r / min, time 6 h, centrifugation, removal of supernatant, precipitation in a 250 mL Erlenmeyer flask for tertiary culture for 24 h (f / 2 culture medium, formula: Na2EDTA 4.16 g, FeCl3·6H2O 3.15 g, CuSO4·5H2O 0.01 g, ZnSO4·7H2O 0.022 g, CoCl2·6H2O 0.01 g, MnCl2·4H2O 0.18 g, Na2MoO4·2H2O 0.006 g, vitamin B 12 0.0005g, thiamine B1 hydrochloride 0.1g, biotin 0.0005g, NaNO3 0.075g, NaH2PO4·2H2O 0.00565g, make up to 1L with filtered natural seawater. Adjust the pH to 8.0 with 1M NaOH or HCl. Sterilize by autoclaving at 15 psi for 15 minutes and cool to room temperature until the strain density reaches 1×10 5 CFU / mL-1×10 7 When the concentration of CFU / mL reaches 0.05, the C-3 culture medium is collected for later use.
[0070] 2. Cultivation of algal cells for experiments
[0071] The algae species used in the experiment was Scrippsiella trochoidea. The algae species cultured in the laboratory (initial density was 5×10 4 / L), and divided into 15 250mL triangular flasks (100mL of liquid in each bottle), and cultured in 20℃, f / 2 culture medium and continuously monitored. When the algae are in the early logarithmic growth phase, that is, the algae density is 1×10 5 When the density of algae in the algae culture medium is 400 μg / mL, the algae culture medium is taken for the following group test. The test is divided into three groups, and each group has 3 parallel groups.
[0072] The culture conditions of algae are as follows: temperature is 20℃, light duration L∶D=12h∶12h, and light intensity is 3000Lx.
[0073] The groups are as follows:
[0074] The blank group (without Pseudovibrio ascidiaceicola C-3 and culture medium for strain cultivation) was treated by continuing to culture the algae culture solution;
[0075] Bacterial density 1.0×10 5CFU / mL group: Add the C-3 culture medium obtained in step 1 above to the algae culture medium in the triangular flask to make the concentration of bacteria C-3 in the triangular flask 1.0×10 5 CFU / mL, continue culturing;
[0076] Bacterial density 1.0×10 7 CFU / mL group: Add the C-3 culture medium obtained in step 1 above to the algae culture medium in the triangular flask to make the concentration of bacteria C-3 in the triangular flask 1.0×10 7 CFU / mL and continue culturing.
[0077] Various substances were added to the above groups, and the day was recorded as the 0th day of continued culture (the time of entering the culture program after adding various substances was set as the 0th day).
[0078] 2. Testing
[0079] 1. The inhibitory effect of adding bacteria on algae
[0080] The algal cells of the above three groups of culture products were counted under a binocular microscope (4×10 magnification). Each sample was counted three times, and the results were averaged.
[0081] The results showed that in the blank group, algal cells were evenly distributed and the algal culture medium was relatively clear; however, when a high concentration of Pseudovibrio ascidiaceicola C-3 was added, the algal cell culture medium began to become turbid after 2-4 days of culture, and some algal cells dissolved and sank to the bottom until they died completely (Table 1).
[0082] Table 1. Statistical data on the effects of different bacterial doses on algal density (cell / mL).
[0083] Continued cultivation time (days) Blank group <![CDATA[C-3 low-dose bacterial concentration group (10 5 CFU / mL)]]> <![CDATA[High-dose C-3 bacterial concentration group (10 7 CFU / mL)]]> 0 83000±200 79000±600 79000±500 2 126000±600 53000±100* 26000±300* 4 163000±400 25000±700* 18000±500* 6 157000±900 19000±400** 11000±400** 8 135000±500 6000±400** 3000±100** 11 101000±600 3000±200** 800±70** 14 92000±400 130±20** 420±50**
[0084] Note: * indicates significant difference compared with the blank group at the same time (P<0.05); ** indicates extremely significant difference compared with the blank group at the same time (P<0.01).
[0085] As can be seen from Table 1, starting from microscopic examination on day 0, Pseudovibrio ascidiaceicola C-3 had a killing effect on algal cells, and the killing effect showed a dose-dependent manner. On the second day, the killing rate reached 57.9%-79.4%. As the concentration increased, the killing effect became more significant, reaching a killing rate of 87.9%-92.9% on the sixth day. The algal inhibition effect reached its peak at 14 days of culture.
[0086] 2. Effects of Pseudovibrio ascidiaceicola C-3 on Chlorophyll of S. conoides
[0087] The chlorophyll content of the three groups of continuously cultured algae was measured using a phytoplankton classification fluorometer (PHYTO-PAM). The specific procedure was as follows: 3 ml of algal solution (from the continuous culture) was placed in a measuring cup and placed in a dark box. The algae were dark-adapted for 20 minutes. The Phyto-PAM modulated pulse fluorometer was turned on and set to a wavelength of 520 nm and an intensity of 0.1 μmol / (m 2 The measurement process is controlled by Phytowin software. The measurement light (ML) is turned on. After the light signal stabilizes, the saturation pulse key is turned on to record the chlorophyll (ChI) content.
[0088] The effects of Pseudovibrio ascidiaceicola C-3 on the chlorophyll content (mg / L) of S. conoides are shown in Table 2.
[0089] Table 2. Chlorophyll (ChI) content test results of different groups (unit: μg / mL)
[0090] Time (days) Blank group <![CDATA[C-3 low-dose bacterial concentration group (10 5 CFU / mL)]]> <![CDATA[High-dose C-3 bacterial concentration group (10 7 CFU / mL)]]> 0 160.31±6.27 160.31±5.82 160.31±4.35 2 272.21±14.63 113.64±12.46 92.61±10.94 4 307.53±13.32 67.42±7.85* 38.92±5.45* 6 391.72±14.52 42.85±5.04* 19.06±4.24** 8 340.64±16.25 16.15±3.17** 10.95±2.36** 11 207.87±10.46 3.15±2.75** 1.92±1.89** 14 73.35±5.47 0.62±0.28** 0.12±0.06**
[0091] Note: * indicates significant difference compared with the blank group at the same time (P<0.05); ** indicates extremely significant difference compared with the blank group at the same time (P<0.01).
[0092] It can be seen from Table 2 that the high-dose bacterial concentration (bacterial density 1.0×10 7 CFU / ml group) and low-dose bacterial concentration (bacterial density 1.0×10 5 CFU / ml group) compared with the blank group, starting from the second day, its chlorophyll level was significantly lower than that of the blank group, and its value was only 34.02%-41.74% of that of the blank group. By the eighth day, its chlorophyll level was only 3.2%-4.7% of that of the blank group (P<0.05).
[0093] In summary, the results of the effect of Pseudovibrio ascidiaceicola C-3 on the chlorophyll content of red tide algae indicate that the presence of Pseudovibrio ascidiaceicola C-3 causes physiological stress in the algae, and the algae's own energy is used to cope with environmental stress, thereby reducing its ability to capture light energy.
[0094] 3. Morphological observation of algae lysis
[0095] In order to verify the lytic effect of Pseudovibrio ascidiaceicola C-3 on Scrippsiella trochoidea cells, the inventors observed the algal cells in the experimental group and the blank group using an optical microscope and an electron microscope.
[0096] Figure 2 The results of 400× optical microscope show that the morphology of the cone-shaped algae sample in the blank group is relatively complete, with no vacuolation or dissolved state; while in the experimental group (bacterial density 1.0×10 7 CFU / mL group), many algae had algal vacuoles, and a large amount of dissolved matter was visible in the field of view.
[0097] The electron microscopy results are as follows Figure 3 As shown in the figure, the blank group cells of Steinernema coniformis showed complete chloroplasts and mitochondria, and the cytoplasm, cell wall and cell membrane remained intact. 7 After 24 hours of treatment with the 100 CFU / mL group (S. truncatula), plasmolysis of the cells of Steinernea coniformis was observed; morphological features and even structural damage were evident, with blurred organelles. Cytoplasm and organelles overflowed from the cells, and the number of multivesicular bodies increased significantly. Compared to the control group of algal cells not exposed to Pseudovibrio ascidiaceicola C-3, this algicidal effect caused severe damage to the chloroplast structure, with a significant loss of organelle membrane integrity and observed thylakoid efflux.
[0098] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
Claims
1. Pseudovibrio ascidiaceicola C-3, whose deposit number in Guangdong Provincial Microbiological Culture Collection Center is GDMCC No.62508.
2. A bacterial agent, characterized in that: The active ingredient of the bacterial agent is the Pseudovibrio ascidiaceicola C-3 described in claim 1.
3. The microbial agent according to claim 2, characterized in that: The bacterial agent is any one of the following 1) to 5) : 1) Bacterial agents used to inhibit the growth and / or reproduction of algae; 2) Bacterial agents used to dissolve algae; 3) Bacterial agents used to kill algae; 4) Bacterial agents used to reduce the chlorophyll content of algae; 5) Bacterial agents used to control red tides.
4. The microbial agent according to claim 3 or 4, characterized in that: The algae dissolution is manifested in the destruction of algae cell structure and / or organelle structure; the red tide is a red tide caused by algae or algae in combination with other organisms; And / or, the algae is Scrippsiella trochoidea.
5. Any of the following uses of the Pseudovibrio ascidiaceicola C-3 of claim 1 or the bacterial agent of any one of claims 2 to 4: 1) Bacterial agents used to inhibit the growth and / or reproduction of algae; 2) Bacterial agents used to dissolve algae; 3) Bacterial agents used to kill algae; 4) Bacterial agents used to reduce the chlorophyll content of algae; 5) Bacterial agents used to control red tides.
6. The use according to claim 5, characterized in that: The algae dissolution is manifested in the destruction of algae cell structure and / or organelle structure; the red tide is a red tide caused by algae or algae in combination with other organisms; And / or, the algae is Scrippsiella trochoidea.
7. Any of the following methods: A1) A method for inhibiting the growth and / or reproduction of algae, comprising: Treating algae with the Pseudovibrio ascidiaceicola C-3 of claim 1 or the bacterial agent of any one of claims 2 to 4 to inhibit the growth and / or reproduction of the algae; A2) A method for dissolving algae, comprising: treating the algae with the Pseudovibrio ascidiaceicola C-3 of claim 1 or the bacterial agent of any one of claims 2 to 4, thereby dissolving the algae; A3) A method for killing algae, comprising: treating algae with the Pseudovibrio ascidiaceicola C-3 of claim 1 or the bacterial agent of any one of claims 2 to 4, thereby killing the algae; A4) A method for reducing the chlorophyll content of algae, comprising: treating the algae with the Pseudovibrio ascidiaceicola C-3 of claim 1 or the bacterial agent of any one of claims 2 to 4, thereby reducing the chlorophyll content of the algae; A5) A method for controlling red tides, comprising: adding the Pseudovibrio ascidiaceicola C-3 of claim 1 or the bacterial agent of any one of claims 2 to 4 to water where red tides occur, thereby controlling the red tides.
8. The method according to claim 7, wherein: The algae dissolution is manifested in the destruction of algae cell structure and / or organelle structure; the red tide is a red tide caused by algae or algae in combination with other organisms; And / or, the algae is Scrippsiella trochoidea.
9. A method for culturing the Pseudovibrio ascidiaceicola C-3 according to claim 1, comprising the step of culturing the Pseudovibrio ascidiaceicola C-3 in a culture medium for culturing Pseudovibrio ascidiaceicola.
10. A method for preparing the bacterial agent according to claim 2, 3 or 4, comprising the following steps: using the Pseudovibrio ascidiaceicola C-3 according to claim 1 as an active ingredient to obtain the bacterial agent.