Enzymatic synthesis method of dehydrogenase mutant and levoribastine hydrochloride intermediate
Through the biocatalytic reaction of dehydrogenase mutants, the complex synthesis process of levocasubstine hydrochloride intermediates was solved and the problems of environmental pollution were achieved, green and efficient enzyme catalytic synthesis was achieved, which increased yield and reduced waste production, and had good industrialization potential.
Patent Information
- Application Number
- CN202510635895.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-16
- Publication Date
- 2025-08-15
AI Technical Summary
In the prior art, the synthesis process of levocaspersine hydrochloride is complex and unfriendly to the environment, and lacks a method for preparing chiral intermediates catalyzed by green and non-contamination-free enzymes.
The dehydrogenase mutant is used to prepare levocaspertin hydrochloride intermediates through biocatalytic reactions in the presence of coenzyme, enzyme circulating hydrogen donor, coenzyme circulating enzyme, cosolvent and buffer. The specific steps include using NAD+, NADH, NADP+ or NADPH as coenzyme, glucose, isopropanol or formic acid as enzyme circulating hydrogen donor, methanol, ethanol or isopropanol as cosolvent, PB buffer as buffer, glucose dehydrogenase, ethanol dehydrogenase or formate dehydrogenase as coenzyme circulating enzyme, and compound II as substrate for reaction.
Environmentally friendly enzyme catalytic synthesis is achieved, which improves yield and reduces waste production, and has good industrialization potential.
Smart Images

Figure CN120485145A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biopharmaceutical technology, and specifically relates to an enzyme-catalyzed synthesis method of a dehydrogenase mutant and a levocabastine hydrochloride intermediate. Background Art
[0002] Levocabastine hydrochloride (structural formula shown below) is a cyclohexane derivative antihistamine developed by Janssen Pharmaceuticals GmbH of Belgium. It was first launched in Denmark in 1991 and is currently available in many countries around the world. Levocabastine hydrochloride is highly specific for the H1 receptor and exhibits very strong H1 receptor affinity when competing with histamine, thereby eliminating the allergic symptoms caused by histamine binding to the receptor.
[0003]
[0004] Levocabastine hydrochloride (CAS: 79516-68-0)
[0005] Levocabastine hydrochloride, a nasal antihistamine, is superior to second-generation oral antihistamines in relieving nasal congestion symptoms. Studies have shown that nasal antihistamines such as Levocabastine hydrochloride are effective for patients who are not effectively controlled by second-generation oral antihistamines.
[0006] Synthetic chiral intermediates of levocabastine hydrochloride The reduction of the chiral carbonyl group is crucial. Currently, there are few reports on the synthetic process routes of levocabastine hydrochloride at home and abroad. It is mainly synthesized by chemical methods (Takeda H, Tachinami T, Aburatani M, et al. Efficient asymmetric hydrogenation of α-aminoacetophenone derivatives leading to practical synthesis of (S)-(-)-levamisole[J]. Tetrahedron letters, 1989, 30(3): 363-366.), but because of its complex synthesis process, it is not environmentally friendly. Therefore, this field needs to develop a green and pollution-free enzyme-catalyzed route for preparing chiral intermediates. Summary of the Invention
[0007] The object of the present invention is to provide an enzyme-catalyzed synthesis method for a dehydrogenase mutant and a levocabastine hydrochloride intermediate.
[0008] To achieve the above object, the present invention provides the following technical solutions:
[0009] A dehydrogenase mutant, whose nucleotide sequence is shown in SEQ ID NOs: 3, 5, and 7; and whose amino acid sequence is shown in SEQ ID NOs: 4, 6, and 8.
[0010] A method for the enzymatic synthesis of a levocabastine hydrochloride intermediate comprises: using compound II as a substrate, in the presence of the dehydrogenase mutant of claim 1, a coenzyme, an enzyme cycle hydrogen donor, a coenzyme cycle enzyme, a cosolvent, and a buffer, conducting a biocatalytic reaction to produce a levocabastine hydrochloride intermediate, namely compound I. The specific synthetic route is as follows:
[0011]
[0012] Furthermore, the coenzyme is at least one of NAD+, NADH, NADP+ or NADPH.
[0013] Furthermore, the coenzyme cycle hydrogen donor is at least one of glucose, isopropanol or formic acid.
[0014] Furthermore, the co-solvent is selected from at least one of methanol, ethanol, and isopropanol.
[0015] Furthermore, the feed ratio of the compound II to the crude dehydrogenase mutant enzyme solution is 1 g: 10-100 mL.
[0016] Furthermore, the buffer solution is PB buffer solution with a concentration of 0.2 mM and a pH of 6.8 to 8.0.
[0017] Furthermore, the coenzyme cycle enzyme is at least one of glucose dehydrogenase, alcohol dehydrogenase, and formate dehydrogenase.
[0018] Furthermore, the mass volume ratio of compound II to the co-solvent is 1 g:1-10 mL.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] Compared to traditional methods that use purely chemical routes to synthesize the levocabastine hydrochloride intermediate (Compound I), the enzymatic synthesis method of the present invention does not require chemical reagents that are highly environmentally polluting, reducing waste generation and being environmentally friendly. Furthermore, the dehydrogenase mutant of the present invention exhibits excellent stereoselectivity, effectively improving yield and possessing excellent potential for industrialization. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 This is the recombinant expression plasmid map. DETAILED DESCRIPTION
[0022] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0023] Example 1 Preparation of dehydrogenase
[0024] The original dehydrogenase sequence (nucleotide sequence shown in SEQ ID NO: 1) and mutant sequences (nucleotide sequences shown in SEQ ID NO: 3, 5, 7) were synthesized by DNA sequencing and then amplified by PCR. The primer sequences were shown in SEQ ID NO: 9-10.
[0025] F: CCCATATG ATGGGCCAGTTTGATAATAAAGTTGCTCT
[0026] R: CCGCTCGAG TTACTGGGCGGTATAGCCACCG
[0027] Then, the NdeI and XhoI restriction sites of the expression vector pET-30a(+) were introduced to obtain the recombinant expression plasmid. The plasmid map is shown in FIG. Figure 1 The strains were transformed into Escherichia coli BL21 (DE3) and screened for antibiotic resistance by plating on antibiotic-resistant plates to obtain cloned strains. After successful recombination, the resulting strains were activated overnight in LB medium at 37°C and added to 200 mL of fermentation broth (LB medium) and cultured to an OD600 value of 0.6-0.8. IPTG was added to a final concentration of 0.5 mM and cultured for 20 hours (20-25°C). The strains were then harvested by centrifugation and washed with 0.2 M PB buffer (pH 6.8). The wet cells were then ultrasonically disrupted in 10 mL of buffer to obtain crude dehydrogenase enzymes ADH-WT, ADH-02, ADH-063, and ADH-067, respectively.
[0028] Example 2 Preparation of Levocabastine Hydrochloride Intermediate
[0029]
[0030] In a 250 mL conical flask, add 60 mL PB buffer (0.2 mM, pH 6.8), 6 mL isopropanol, 10 mL original crude enzyme solution (ADH-02, amino acid sequence as shown in SEQ ID NO: 4), 0.5 g glucose, 1 g glucose dehydrogenase (Shanghai Suntech Biopharmaceuticals, catalog number #ES-GDH-101), 5 mg NADP + , 1 g of substrate was mixed and reacted at 30°C and 220 rpm for 16 h (pH was controlled at 6.8-7.0) to obtain compound I. The reaction results were detected by HPLC, with a conversion rate of 93.9% and an ee value of 98.5%.
[0031] Example 3 Preparation of Levocabastine Hydrochloride Intermediate
[0032]
[0033] In a 250 mL conical flask, add 60 mL PB buffer (0.2 mM, pH 6.8), 6 mL isopropanol, 10 mL original crude enzyme solution (ADH-063, amino acid sequence as shown in SEQ ID NO: 6), 0.5 g glucose, 1 g glucose dehydrogenase (Shanghai Suntech Biopharmaceuticals, catalog number #ES-GDH-101), 5 mg NADP + , 0.5 g of substrate was mixed and reacted at 30°C and 220 rpm for 16 h (pH was controlled at 6.8-7.0) to obtain compound I. The reaction results were detected by HPLC, with a conversion rate of 93.7% and an ee value of 99.0%.
[0034]
[0035] Example 4 Preparation of Levocabastine Hydrochloride Intermediate
[0036]
[0037] In a 250 mL conical flask, add 60 mL PB buffer (0.2 mM, pH 6.8), 6 mL isopropanol, 10 mL original crude enzyme solution (ADH-067, amino acid sequence as shown in SEQ ID NO: 8), 0.5 g glucose, 1 g glucose dehydrogenase (Shanghai Suntech Biopharmaceuticals, catalog number #ES-GDH-101), 5 mg NADP + , 0.5 g of substrate was mixed and reacted at 30°C and 220 rpm for 16 h (pH was controlled at 6.8-7.0) to obtain compound I. The reaction results were detected by HPLC, with a conversion rate of 96.1% and an ee value of 100%.
[0038] Comparative Example Preparation of Levocabastine Hydrochloride Intermediate
[0039]
[0040] In a 250 mL conical flask, add 60 mL PB buffer (0.2 mM, pH 6.8), 6 mL isopropanol, 10 mL crude enzyme solution (ADH-WT, amino acid sequence as shown in SEQ ID NO: 2), 0.5 g glucose, 1 g glucose dehydrogenase (Shanghai Suntech Biopharmaceuticals, catalog number #ES-GDH-101), 5 mg NADP + , 0.5 g of substrate was mixed and reacted at 30°C and 220 rpm for 16 h (pH was controlled at 6.8-7.0) to obtain compound I. The reaction results were detected by HPLC, with a conversion rate of 53.6% and an ee value of 98.7%.
[0041] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.
Claims
1. A dehydrogenase mutant, characterized in that: The nucleotide sequence of the dehydrogenase mutant is shown in SEQ ID NOs: 3, 5, and 7; the amino acid sequence of the dehydrogenase mutant is shown in SEQ ID NOs: 4, 6, and 8.
2. An enzymatic synthesis method of a levocabastine hydrochloride intermediate, characterized in that: Compound II is used as a substrate, and in the presence of the dehydrogenase mutant according to claim 1, a coenzyme, an enzyme cycle hydrogen donor, a coenzyme cycle enzyme, a cosolvent, and a buffer, a biocatalytic reaction is carried out to produce a levocabastine hydrochloride intermediate, namely, compound I. The specific synthetic route is as follows:
3. The enzymatic synthesis method of the levocabastine hydrochloride intermediate according to claim 2, characterized in that: The coenzyme is at least one of NAD+, NADH, NADP+ or NADPH.
4. The enzymatic synthesis method of the levocabastine hydrochloride intermediate according to claim 2, characterized in that: The coenzyme cycle hydrogen donor is at least one of glucose, isopropanol or formic acid.
5. The enzymatic synthesis method of the levocabastine hydrochloride intermediate according to claim 2, characterized in that: The co-solvent is selected from at least one of methanol, ethanol and isopropanol.
6. The enzymatic synthesis method of the levocabastine hydrochloride intermediate according to claim 2, characterized in that: The feeding ratio of the compound II to the crude dehydrogenase mutant enzyme solution is 1 g: 10-100 mL.
7. The enzymatic synthesis method of the levocabastine hydrochloride intermediate according to claim 2, characterized in that: The buffer solution is PB buffer solution with a concentration of 0.2 mM and a pH of 6.8-8.
0.
8. The enzymatic synthesis method of the levocabastine hydrochloride intermediate according to claim 2, characterized in that: The coenzyme cycle enzyme is at least one of glucose dehydrogenase, alcohol dehydrogenase, and formate dehydrogenase.
9. The enzymatic synthesis method of the levocabastine hydrochloride intermediate according to claim 2, characterized in that: The mass volume ratio of compound II to the co-solvent is 1g:1-10mL.