Nucleic acid aptamer specifically combined with endometriosis cells and application of nucleic acid aptamer

Abstract

The invention provides a nucleic acid aptamer specifically combined with endometriosis cells and application of the nucleic acid aptamer, and belongs to the technical field of biology. The nucleic acid aptamer capable of being specifically combined with the endometriosis cells is screened out through the Cell-SELEX technology with living cells as screening objects, and the nucleic acid aptamer has the advantages of being high in specificity, high in affinity, high in specificity, high in specificity and high in specificity. The probe can be used for early diagnosis of endometriosis, tissue biopsy, ectopic endometrial tissue excision guided by fluorescence, targeted drug development and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a nucleic acid aptamer specifically binding to endometriosis cells and an application thereof. Background Art

[0002] Endometriosis currently has no cure, primarily due to delayed diagnosis and a lack of precise treatment strategies. Endometriosis is a chronic gynecological disease characterized by the appearance, growth, and infiltration of endometrial glands or stroma outside the uterus, leading to recurrent bleeding, pain, infertility, and other symptoms. It often presents with symptoms similar to those of other diseases, and the condition can be insidious and difficult to detect. Early diagnosis and precise treatment are crucial for improving fertility and quality of life in patients with endometriosis.

[0003] Although several screening tools and tests have been proposed and tested, none can accurately identify or predict the early stages of endometriosis. Imaging, surgery / laparoscopy, and pathological analysis can accurately identify endometriotic tissue, but their sensitivity is limited and they cannot identify early lesions. Therefore, the search for new, more sensitive, and specific tools that can bind to endometriotic cells has become an important research direction.

[0004] Aptamers are oligonucleotides (DNA or RNA) isolated and screened through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process. They are capable of binding with high affinity and specificity to diverse targets, such as peptides, proteins, drugs, organic and inorganic molecules, and even entire cells. Among the numerous aptamer screening technologies, Cell-SELEX (Cell-based Systematic Evolution of Ligands by Exponential amplification) involves screening aptamers in living cells. Its core principle is to incubate a library of random oligonucleotides synthesized in vitro with living cells and, through multiple rounds of screening, enrich for aptamers that specifically bind to specific targets on the cell surface. Notably, this technology eliminates the need to predetermine the specific binding sites on the cell surface; it can generate aptamers that specifically bind to unknown, differentially expressed proteins in their natural conformation on the target cell surface. Therefore, while the molecular mechanisms underlying the development and progression of endometriosis remain unclear, the Cell-SELEX technique holds promise for screening nucleic acid aptamers that specifically recognize ectopic endometrial cells, providing a molecular tool for the early and precise diagnosis and treatment of endometriosis. This characteristic of nucleic acid aptamers can effectively overcome the bottlenecks of traditional diagnostic methods in terms of insufficient sensitivity and specificity in early detection, while also providing high-affinity molecular probes for the development of targeted drugs. Summary of the Invention

[0005] The present invention aims to provide a nucleic acid aptamer that can specifically bind to endometriotic cells. This nucleic acid aptamer exhibits high affinity for the target and has the characteristics of stable chemical properties, easy preparation and storage, and small molecular weight. It can be used for the detection, diagnosis, and treatment of endometriosis and has broad application prospects.

[0006] On the one hand, the present invention provides a nucleic acid aptamer that specifically binds to endometriotic cells, wherein the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.3; or a nucleotide sequence that has at least 30% homology with any one of SEQ ID NO.1 to SEQ ID NO.3 and binds to endometriotic cells; or a DNA sequence truncated or modified from the nucleotide sequence as shown in SEQ ID NO.1 to SEQ ID NO.3; or an RNA sequence transcribed from the nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.3.

[0007] Based on the Cell-SELEX technology, the present invention designs and synthesizes a random single-stranded DNA library and corresponding primers to screen for nucleic acid aptamers that have a small molecular weight, stable chemical properties, and are easy to store and label, and can bind to endometriosis cells with high affinity. Thus, several nucleic acid aptamers with high affinity binding to endometriosis cells were screened, namely CC1 (SEQ ID NO. 1), CC2 (SEQ ID NO. 2), and CC6 (SEQ ID NO. 3). These nucleic acid aptamers have higher affinity and specificity for endometriosis cells.

[0008] The present invention truncated SEQ ID NO. 1 to obtain SEQ ID NO. 4 (CC1-1). The truncated nucleic acid aptamer sequence also has high affinity for endometriotic cells.

[0009] It is understood that a nucleotide sequence that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology to the nucleic acid aptamer provided by the present invention and binds to endometriotic cells, for example, any nucleotide sequence of the above-mentioned nucleic acid aptamer can have a partial sequence deleted or a partial sequence added, and still have a high affinity for endometriotic cells and still fall within the scope of protection of the present invention.

[0010] In some embodiments, as an improvement to the above technical solution, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, or isotopization, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to endometriotic cells that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0011] Therefore, in some embodiments, the nucleotide sequence of the nucleic acid aptamer is modified, and the modified nucleic acid aptamer can specifically bind to endometriotic cells. The modification is selected from at least one of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, and isotopization, which is still within the scope of protection of the present invention.

[0012] On the other hand, the present invention provides a conjugate or derivative of a nucleic acid aptamer, wherein the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO. 1 to SEQ ID NO. 3; the conjugate of the nucleic acid aptamer includes a fluorescent marker; the derivative of the nucleic acid aptamer includes a thiophosphate backbone or peptide nucleic acid that binds to endometriotic cells, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

[0013] The aptamer conjugates described herein are aptamers with additional groups attached to them. For example, fluorescent markers with labeling functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA, or enzyme labels, can be attached. This allows the resulting modified aptamer sequence to possess desirable properties. For example, it can have an affinity for binding to endometriotic cells equal to or greater than that of the original aptamer sequence before modification, or it can have greater stability despite a less pronounced affinity. The FAM- and therapeutic substance-labeled aptamers are mixed with a sample and observed under a fluorescence microscope. If a fluorescent signal appears, the presence and location of endometriotic cells can be visually determined, enabling precise treatment and drug delivery.

[0014] In other words, the aptamers mentioned above, whether partially substituted or modified, all have substantially the same or similar molecular structure, physicochemical properties, and functions as the original aptamers, and can be used to bind to endometriotic cells.

[0015] In another aspect, the present invention provides a product for detecting endometriotic cells, comprising the nucleic acid aptamer as described above, or a conjugate or derivative of the nucleic acid aptamer as described above; the product is any one of a kit, a detection chip, and a chromatographic detection device.

[0016] The present invention provides a drug targeting endometriotic cells. The drug comprises the nucleic acid aptamer as described above, or a conjugate or derivative of the nucleic acid aptamer as described above.

[0017] The present invention also provides the use of the above-mentioned nucleic acid aptamer in preparing an endometriosis cell detection reagent or a drug targeting endometriosis cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The secondary structure prediction diagram of nucleic acid aptamer SEQ ID NO.1; Figure 2 This is the predicted secondary structure of the nucleic acid aptamer SEQ ID NO. 2; Figure 3 This is the predicted secondary structure of the nucleic acid aptamer SEQ ID NO. 3; Figure 4 This is the predicted secondary structure of the nucleic acid aptamer SEQ ID NO. 4; Figure 5 The flow cytometry technique was used to investigate the binding of the nucleic acid aptamer SEQ ID NO. 1 to endometriotic ESCs (ihESCs) and endometrial normal ESCs (iheESCs); Figure 6 Flow cytometry was used to investigate the binding of nucleic acid aptamer SEQ ID NO. 2 to endometriotic cells and endometrial eutopic cells; Figure 7 Flow cytometry was used to investigate the binding of nucleic acid aptamer SEQ ID NO. 3 to endometriotic cells and endometrial eutopic cells; Figure 8 Flow cytometry was used to investigate the binding of the truncated sequence (i.e., SEQ ID NO. 4) and random sequences of the nucleic acid aptamer SEQ ID NO. 1 to endometriotic cells; Figure 9 is the affinity KD value of the nucleic acid aptamer SEQ ID NO. 1 to endometriotic cells; Figure 10 is the affinity KD value of nucleic acid aptamer SEQ ID NO. 2 to endometriotic cells; Figure 11is the affinity KD value of nucleic acid aptamer SEQ ID NO. 3 to endometriotic cells.

[0019] Figure 12 The results of imaging SEQ ID NO. 1 for endometrial eutopic tissue (A) and endometriotic tissue (B); Figure 13 The results of imaging SEQ ID NO. 2 for endometrial eutopic tissue (A) and endometriotic tissue (B); Figure 14 The figures show the results of imaging SEQ ID NO. 3 for endometrial eutopic tissue (A) and endometriotic tissue (B). DETAILED DESCRIPTION

[0020] For better understanding and implementation, the technical solutions in the embodiments of the present invention will be clearly and completely described and discussed below in conjunction with the drawings of the present invention. Obviously, what is described here is only a part of the examples of the present invention, not all the examples. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0021] To facilitate understanding of the embodiments of the present invention, further explanation will be given below in conjunction with the accompanying drawings and examples, and each example does not constitute a limitation of the embodiments of the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0022] Reagents not otherwise specified in this example are all known products and were obtained by purchasing commercial products.

[0023] Example 1: Screening of nucleic acid aptamers binding to endometriotic cells The method of this embodiment for screening nucleic acid aptamers that bind to endometriosis cells comprises the following steps: 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences: Random single-stranded DNA library: 5'AGAAGGAAGGAGAGCGACAC-N40-TATCAGTGGTCGGTCGTCAT3' (SEQ ID NO.5) Here, "N40" represents a sequence consisting of 40 arbitrary nucleotide bases connected together.

[0024] The primers used for screening are shown in Table 1. The primer sequences consist of 20 bases at each end and a 40-base random sequence in the middle. Corresponding PCR primers were also designed for library preparation. A fluorescently labeled forward primer (FP-FAM) and a biotin-labeled reverse primer (RP-Biotin) were used to synthesize the ssDNA library. These primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0025] Table 1 Primers and their sequences Primer name Sequence (5'→3') DNA Pool AGAAGGAAGGAGAGCGACAC -N40- TATCAGTGGTCGGTCGTCAT(SEQ ID NO.5) FAM-FP FAM- AGAAGGAAGGAGAGCGACAC(SEQ ID NO.6) Biotin-RP Biotin-ATGACGACCGACCACTGATA(SEQ ID NO.7) The FP in the primer name represents the forward primer, and the RP in the primer name represents the reverse primer. Each primer was prepared into a 100 μM stock solution using ultrapure water and stored at -20°C until use.

[0026] 2. Cell-SELEX aptamer screening The Cell-SELEX method was used for screening, with a total of 15 rounds, and counter-screening was added in round 6. The screening pressure adjustment for each round is shown in Table 2.

[0027] Table 2 Endometriotic cell aptamer screening pressure Number of screening rounds Screening time (min) Back screening time (min) Washing times Washing solution volume (mL) Washing time (s) Screening library amount (nmol) Washing temperature (℃) Fetal bovine serum (μL) PCR cycle number 1 30 0 3 3 30 10 4 0 18 2 30 0 3 3 30 / 4 0 12 3 30 0 3 3 30 / 4 0 14 4 30 0 3 3 30 / 4 0 12 5 30 0 3 3 30 / 4 0 14 6 30 30 4 3 40 0.2 8 0 20 7 30 30 4 3 40 0.18 12 0 22 8 30 40 4 3 40 0.16 17 0 22 9 30 40 4 3 40 0.14 22 0 22 10 30 40 4 3 40 0.12 27 0 22 11 30 50 5 3 50 0.10 32 0 22 12 30 50 5 3 50 0.08 37 0 24 13 30 50 5 3 50 0.06 37 0 20 14 30 60 5 3 50 0.06 25 50 26 15 30 60 5 3 50 0.06 37 100 22 Washing buffer (WB): Weigh 0.2474 g of glucose and 0.0508 g of MgCl·6H2O, dissolve them in 50 mL of sterile PBS containing 250 mM glucose and 5 mM MgCl·6H2O, and store in a refrigerator at 4°C.

[0028] Binding buffer (BB): Weigh 0.005 g of tRNA and 0.05 g of BSA, dissolve them in 50 mL of WB containing 0.1 mg / mL tRNA and 1 mg / mL bovine serum albumin (BSA), and store in a refrigerator at 4°C.

[0029] The specific screening process is as follows: 1) Cell culture ihESCs (endometriosis cells) cell line, iheESCs cell line The DMEM / F12 medium used in the cell line contains 12% fetal bovine serum and 1% double-antibody (penicillin and streptomycin); When the cell growth density reaches 80%~90%, first discard the old culture medium in the culture flask. Then, add 2 mL of PBS buffer to wash the residual culture medium in the culture flask, and wash it 2~3 times. After discarding the old PBS, add 1 mL of trypsin digestion solution to ensure that the trypsin completely covers the cell surface. Observe under an inverted microscope. When most of the cells appear to be retracted and rounded, quickly discard the trypsin, add 2 mL of complete culture medium, and gently blow the bottom of the flask to form a single cell suspension and evenly distribute the cells. Passage cells in proportion as needed, and distribute a certain amount of cells into a new culture flask, and then add 8 mL of fresh culture medium. Finally, place the culture flask back into the 37°C, 5% CO2 incubator and continue culturing.

[0030] Screening cells are cultured in 60 mm cell culture dishes. The cell density should be above 80% before screening. Cells should be cultured for at least 24 hours after digestion to ensure normal expression of cell surface proteins, thereby increasing the success rate of screening.

[0031] 2) Anti-screening Starting from the sixth round, counter-screening was introduced. The culture medium of the iheESCs was discarded and washed three times with 3 mL of Western Blot (WB) cooled to 4°C. After washing, the processed DNA library was added to a 60 mm cell culture dish, ensuring that the library covered the dish. The dish was then incubated at 4°C for 30 minutes, gently shaking horizontally every 5 minutes to ensure even distribution of the library. After 30 minutes, the supernatant was aspirated and used for positive screening.

[0032] 3) Positive screening Pour off the culture medium of the ihESCs and wash three times with Western blotting (WB) cooled to 4°C, taking 3 mL each time. For the first round of screening, after washing, add the library to a 60 mm cell culture dish (for subsequent rounds, use the library prepared in each round; after the sixth round of reverse screening, use the reverse-screened library). Ensure that the library covers the cell culture dish and incubate at 4°C for 30 minutes, gently shaking horizontally every 5 minutes to ensure even distribution of the library. After 30 minutes, aspirate the supernatant and wash unbound ssDNA with Western blotting. Then, add 500 μL of ultrapure water to the dish, scrape the cells with a cell scraper, and aspirate them into an EP tube. Add another 500 μL of ultrapure water to wash the remaining cells, and aspirate them into the EP tube after washing, for a total of 1 mL of liquid in the EP tube. Place 1 mL of the screened solution in a 95°C water bath for 10 min to disrupt the cells and denature the protein, allowing the ssDNA incubated on the cells to fall off. Then centrifuge at 12,000 rpm for 10 minutes to separate the ruptured cells. Aspirate the supernatant, which is the aqueous solution containing ssDNA, and store it at 4°C until use.

[0033] 4) Aptamer DNA amplification In each round of screening, in order to ensure that there are not too many non-specific amplified fragments in each round of PCR and to ensure that there is enough library for the next round of screening, we need to optimize the number of PCR cycles to ensure that it can meet our screening needs. Therefore, before we use PCR to amplify a large amount of DNA, we must first use 3% agarose gel electrophoresis to analyze the PCR products of different amplification rounds, and then determine the final number of PCR cycles based on the brightness and singleness of the electrophoretic bands; for details on the number of PCR amplification rounds, see Figure 4 Amplification conditions: initial denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 60°C for 90 s, extension at 72°C for 3 min, cycle n times.

[0034] 5) Purification of aptamer DNA Centrifuge 100 µL of streptavidin-modified agarose microspheres at 5000 rpm, remove the supernatant, and then wash with 500 µL of PBS. Centrifuge and remove the supernatant. Repeat the wash step once. Mix the PCR-amplified double-stranded DNA with the agarose microspheres and incubate at room temperature for 30 minutes. The biotin on the DNA binds to the streptavidin on the agarose microspheres, capturing the DNA on the microsphere surface. The agarose microspheres are then centrifuged at 5000 rpm, the supernatant removed, and washed twice with PBS. Then, add 500 µL of 200 mM NaOH solution to the washed microspheres and allow them to react at room temperature for 15 minutes. The alkaline environment melts the double-stranded DNA into single strands, releasing the biotin-free single-stranded DNA (ssDNA). Centrifuge again at 5000 rpm for 5 minutes, and collect the supernatant.

[0035] DNA Desalting: Wash the desalting column with 5 mL of sterile water, then add the resulting ssDNA solution and allow it to drip out naturally. Add another 1 mL of sterile water and collect the dripping solution. This will yield an aqueous solution containing ssDNA. Measure the UV absorption curve of the ssDNA solution and quantify the ssDNA by absorbance at 260 nm to calculate the amount of library to be used in the next round of screening. Finally, freeze-dry the ssDNA solution. The dried DNA sample should be stored at -20°C.

[0036] Example 2: Prediction of nucleic acid aptamer secondary structure After the screening was completed, the libraries with the determined number of rounds were selected for PCR amplification and high-throughput sequencing. DNAMAN6.0 software was further used to perform homology alignment on the sequencing results and construct a family evolutionary tree. Based on the alignment results, the nucleic acid aptamer sequences with the highest enrichment were screened, namely SEQ ID NOs. 1 to 3. The secondary structures of SEQ ID NOs. 1 to 3 were predicted using nupack (https: / / www.nupack.org / ). The secondary structure prediction results are shown in the figure below. Figure 1 — Figure 3 As shown. On this basis, the primer sequences before and after SEQ ID NO. 1 were removed to obtain the truncated sequence SEQ ID NO. 4. Nupack (https: / / www.nupack.org / ) was also used to predict the secondary structure of SEQ ID NO. 4, and the results were as follows Figure 4 Comparing the secondary structure diagrams of the four chains above, it can be seen that the obtained nucleic acid aptamer has a typical stem-loop structure, and it is speculated that the sequence located between the front and back primers is the core sequence that determines the recognition.

[0037] Example 3: Investigation of specificity and affinity of nucleic acid aptamers First, the four FAM-labeled aptamers SEQ ID NO. 1-4 (at a concentration of 500 nM) were incubated with ihESCs and iheESCs cells at 4°C for 60 min. After incubation, the cells were centrifuged at 1500 rpm for 5 min, resuspended in 1 mL of BB, eluted, centrifuged again, and resuspended in 600 μL of BB. Flow cytometry was then used to analyze the binding specificity of the above aptamer chains to endometriotic cells. The flow cytometric analysis results are shown in Figure 2. Figure 5 — Figure 8 As shown, it was shown that the nucleic acid aptamer can selectively bind to endometriotic cells, but has basically no recognition on endometrial normal cells. Subsequently, the target affinity of the three nucleic acid aptamers SEQ ID NO. 1~3 was investigated. Different concentrations (0nM, 5nM, 10nM, 15nM, 25nM, 50nM,100nM, 200nM) of FAM-labeled SEQ ID NO. 1 and different concentrations (0nM, 10nM, 25nM, 50nM, 100nM, 150nM, 250nM, 500nM) of FAM-labeled SEQ ID NO. 2 and SEQ ID NO. 3 were incubated with ihESCs cell lines digested with enzyme-free digestion solution, and three parallel samples were set for each concentration, and flow cytometry analysis was used. K of nucleic acid aptamer d Through the single-point adsorption equation Y = B max X / (Kd + X) fitting (GraphPad prism 9 software), where: X is the concentration of nucleic acid aptamer, Y is the corresponding fluorescence value (fluorescence geometric mean), B max The highest binding fluorescence intensity is the K of the aptamer chain. d See the value results Figure 9 — Figure 11 .

[0038] Example 4: Application of nucleic acid aptamers in tissue biopsy In order to investigate the clinical application potential of the screened aptamers, we applied aptamers to the imaging and diagnosis of clinical tissue samples. The specific operation is as follows: ovarian metastasis tissue from patients with endometriosis and endometrial tissue from women without endometriosis were taken to prepare frozen sections with a thickness of 10 µm. Then, 20 µL of 250 nM FAM-labeled aptamer SEQ ID NO. 1~3 solution and Random Library (as a control) were added to the frozen sections, incubated for 10 min, washed with BB, and then observed under a laser confocal microscope. The observation results are shown in Figure 2. Figure 12 — Figure 14 The results showed that the three selected aptamers had a certain degree of recognition for ovarian ectopic tissue, but had almost no recognition for normal endometrial tissue. This indicates that the selected aptamers have the potential for application in tissue biopsy, helping doctors quickly identify whether the tissue being removed is endometriosis during surgery and guiding clinical diagnosis.

[0039] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to endometriotic cells, characterized in that: The nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO. 1 to SEQ ID NO. 3; or a nucleotide sequence that has at least 60% homology with SEQ ID NO. 1 to SEQ ID NO. 3 and binds to endometriotic cells; or a DNA sequence truncated or modified from the nucleotide sequence as shown in SEQ ID NO. 1 to SEQ ID NO. 3; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO. 1 to SEQ ID NO.

3.

2. The nucleic acid aptamer according to claim 1, wherein The DNA sequence truncated or modified from the nucleotide sequence shown in SEQ ID NO. 1 to SEQ ID NO. 3 is shown in SEQ ID NO.

4.

3. The nucleic acid aptamer with modified nucleotide sequence according to claim 1, characterized in that: The modification methods include one or more of amination, methylation, phosphorylation, sulfhydrylation, substitution of oxygen with selenium, substitution of oxygen with sulfur, and isotopization.

4. The nucleic acid aptamer according to claim 3, characterized in that The nucleic acid aptamer is a sequence obtained by modifying a nucleotide sequence that has at least 60% homology to any one of SEQ ID NO. 1 to SEQ ID NO. 3 and binds to endometriotic cells.

5. The nucleic acid aptamer conjugate according to claim 1, characterized in that The conjugate is composed of a nucleic acid aptamer connected to other groups, including at least one of the following: (1) Connecting radioactive substances to the aptamer; (2) attaching a fluorescent marker to the aptamer; (3) Connecting therapeutic substances to the aptamer; (4) connecting a nanoluminescent material to the nucleic acid aptamer; (5) Connecting digoxigenin to the aptamer; (6) attaching biotin to the aptamer; (7) Connecting siRNA to the aptamer; (8) Connecting a small peptide to the nucleic acid aptamer.

6. A product for detecting endometriosis cells, characterized in that: The product comprises the nucleic acid aptamer according to any one of claims 1 to 4, or the conjugate according to claim 5; the product is any one of a kit, a detection chip, and a chromatography detection device.

7. A drug targeting endometriosis cells, characterized in that: The drug comprises the nucleic acid aptamer according to any one of claims 1 to 4, or the conjugate according to claim 5.

8. The nucleic acid aptamer according to any one of claims 1 to 4, or the conjugate according to claim 5, is used for preparing an endometriosis cell detection reagent, an endometriosis tissue diagnostic reagent, or a drug targeting endometriosis cells.

Images