Application of plant stomatal density in biomass

By regulating the expression of the functional domain and signal peptide domain of STOMAGEN protein, the stomatal density is moderately increased, the problems of excessive water loss and energy consumption are solved, and the improvement of plant biomass and the enhancement of drought resistance are achieved.

CN120485209APending Publication Date: 2025-08-15CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510630743.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-15
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

In the prior art, methods of increasing stomatal density by changing the expression of the STOMAGEN gene to increase plant biomass have failed to effectively solve the problems of excessive water loss and energy consumption, resulting in failure to increase biomass.

Method used

By regulating the expression of the functional domain and signal peptide domain of STOMAGEN protein, the stomatal density is moderately increased, and the stomatal density is 1.4-2.5 times that of the control is achieved, promoting the increase of plant photosynthesis and biomass.

Benefits of technology

The drought resistance and biomass of plants are improved without reducing the stomatal conductivity and carbon assimilation capacity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005406437740000011
    Figure HDA0005406437740000011
  • Figure HDA0005406437740000021
    Figure HDA0005406437740000021
  • Figure HDA0005406437740000031
    Figure HDA0005406437740000031
Patent Text Reader

Abstract

The invention relates to application of plant stomatal density in biomass, in particular to a plant containing a functional structural domain of STOMAGEN protein and a signal peptide structural domain of the STOMAGEN protein, a relation between stomatal density and biomass of the plant and application of the plant.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to the relationship between plant stomatal density and plant biomass and their application. Background Art

[0002] Stomata are tiny pores on the surface of plants. They serve as pathways for the exchange of gases (such as carbon dioxide, water, and oxygen) between plants and the atmosphere. Large amounts of water are lost from plants and diffuse into the atmosphere through these pores. Thus, stomata help control a plant's water status. Furthermore, stomata participate in photosynthesis, as carbon dioxide enters the plant through them. In other words, stomata control a plant's access to carbon. Beyond these functions, stomata also play a vital role in many biological processes.

[0003] The mechanisms of stomatal development have been intensively studied, and numerous genes involved in stomatal development have been discovered. The EPF family comprises a series of genes encoding signal peptides. Research has focused on EPF1, EPF2, and STOMAGEN. Within the EPF family, genes EPF1 / 2 negatively regulate stomatal development, while EPFL9 positively regulates it. Mutants and overexpression lines of EPF1 / 2 exhibit altered stomatal density in multiple species, while mutants and overexpression lines of STOMAGEN also exhibit altered stomatal density across species, suggesting that the functions of these EPF family genes are conserved throughout evolution. Because affecting these genes alters stomatal density, many studies have genetically manipulated these genes to alter stomatal conductance, thereby altering transpiration and photosynthetic rate. Theoretically, these genetic manipulations would result in changes in photosynthetic rate, leading to changes in plant biomass. Therefore, it seems reasonable to conclude that increased photosynthetic rate, resulting from increased stomatal density, can increase plant biomass. However, studies have shown that although the number of stomata in STOMAGEN overexpressing lines increased significantly, overexpression of STOMAGEN did not increase the biomass of Arabidopsis. A possible reason for the failure to increase biomass is that there are too many stomata in the transgenic lines, as too many stomata may cause excessive water loss in the plant and stomatal movement consumes too much energy. Recently, stomatal density modified by genetic engineering has reached a level of fine control, which has an impact on the drought resistance of plants. In this study, they found that only lines with appropriately reduced stomatal density were able to improve drought resistance without reducing stomatal conductance, carbon assimilation, and temperature regulation capacity. This study supports the view that changing stomatal density to an appropriate level is more valuable than an excessively high level. Summary of the Invention

[0004] The present invention proposes that altered expression of FSTOMAGEN and moderately increased stomatal density will increase biomass. In the present invention, FSTOMAGEN overexpression lines with different stomatal densities were tested.

[0005] The present invention provides a nucleic acid construct comprising:

[0006] (1) a coding sequence of a functional domain of a STOMAGEN gene or a sequence having at least 90% identity or homology thereto, and

[0007] (2) The coding sequence of the signal peptide domain of the STOMAGEN gene or a sequence having at least 90% identity or homology thereto.

[0008] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family.

[0009] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from a plant of the genus Flaveria and / or Arabidopsis.

[0010] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis thaliana.

[0011] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from Flaveria bidentis, and its coding sequence is shown in SEQ NO ID: 1.

[0012] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from Arabidopsis thaliana, and its coding sequence is shown in SEQ NO ID: 2.

[0013] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family.

[0014] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from a plant of the genus Flaveria and / or Arabidopsis.

[0015] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis thaliana.

[0016] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from Flaveria bidentis, and its coding sequence is shown in SEQ NO ID:3.

[0017] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from Arabidopsis thaliana, and its coding sequence is shown in SEQ NO ID:4.

[0018] In one or more embodiments, the coding sequence for the signal peptide domain of the STOMAGEN protein is operably linked to the coding sequence for the functional domain of the STOMAGEN protein.

[0019] In one or more embodiments, the nucleic acid construct has the following elements from 5' to 3': a promoter (such as a 35S promoter sequence), a coding sequence for the signal peptide domain of the STOMAGEN protein, a coding sequence for the functional domain of the STOMAGEN protein, and a terminator.

[0020] The present invention provides an application of plant stomatal density for regulating plant biomass.

[0021] In one or more embodiments, the use is:

[0022] (1) increasing the plant's stomatal density so that the stomatal density is 1.4-2.5 times that of the control, thereby (i) promoting plant photosynthesis and (ii) increasing plant biomass; or (2) increasing or decreasing the plant's stomatal density so that the stomatal density is not 1.4-2.5 times that of the control, thereby (i) inhibiting plant photosynthesis and (ii) decreasing plant biomass.

[0023] In one or more embodiments, the plant contains a functional domain of a STOMAGEN protein or a sequence at least 90% identical or homologous thereto.

[0024] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family.

[0025] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from a plant of the genus Flaveria and / or Arabidopsis.

[0026] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis thaliana.

[0027] In one or more embodiments, the plant further contains a STOMAGEN protein signal peptide domain operably linked to the functional domain of the STOMAGEN protein.

[0028] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family.

[0029] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from a plant of the genus Flaveria and / or Arabidopsis.

[0030] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis thaliana.

[0031] In one or more embodiments, upregulating the stomatal density of a plant comprises upregulating the expression of a functional domain of a STOMAGEN protein in the plant.

[0032] In one or more embodiments, upregulating the expression or activity of the functional domain of the STOMAGEN protein in the plant comprises: transferring the coding sequence of the functional domain of the STOMAGEN protein into the plant to obtain a transformed plant.

[0033] In one or more embodiments, downregulating the stomatal density of the plant comprises downregulating the expression of a functional domain of a STOMAGEN protein in the plant.

[0034] In one or more embodiments, downregulating the expression or activity of a functional domain of a STOMAGEN protein in a plant comprises:

[0035] (1) specifically interfere with the transcription and / or expression of the functional domain of the STOMAGEN protein, or

[0036] (2) Functional domains of STOMAGEN proteins with reduced expression activity in plants.

[0037] In one or more embodiments, (1) the interference is interference with the transcription of the coding sequence of the functional domain of the STOMAGEN protein or the translation of its transcript.

[0038] In one or more embodiments, the nucleic acid that specifically interferes with the transcription and / or expression of the functional domain of the STOMAGEN protein is derived from the following group: (1) dsRNA, antisense nucleic acid, small interfering RNA, microRNA, shRNA, reRNA, sgRNA that targets the coding sequence of the functional domain of the STOMAGEN protein or its transcript for inhibition or silencing, or (2) a construct that can express or form (1).

[0039] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from Flaveria bidentis, and its coding sequence is shown in SEQ NO ID: 1.

[0040] In one or more embodiments, the signal peptide domain of the STOMAGEN protein is derived from Arabidopsis thaliana, and its coding sequence is shown in SEQ NO ID:4.

[0041] In one or more embodiments, the up-regulating stomatal density means that the stomatal density of the plant after up-regulation is 1.4-2.5 times, preferably 2-2.5 times, that of the control.

[0042] In one or more embodiments, the promoting plant photosynthesis refers to increasing the plant photosynthetic rate; and the inhibiting plant photosynthesis refers to reducing the plant photosynthetic rate.

[0043] In one or more embodiments, the plant is a plant of the Asteraceae and / or Cruciferae family.

[0044] In one or more embodiments, the plant is a Flaveria bidentata and / or Arabidopsis plant.

[0045] In one or more embodiments, the plant is Flaveria bidentis and / or Arabidopsis thaliana.

[0046] The present invention provides a method for regulating plant biomass, which comprises regulating the stomatal density of the plant.

[0047] In one or more embodiments, the method is:

[0048] (1) increasing the plant's stomatal density so that the stomatal density is 1.4-2.5 times that of the control, thereby (i) promoting plant photosynthesis and (ii) increasing plant biomass; or (2) increasing or decreasing the plant's stomatal density so that the stomatal density is not 1.4-2.5 times that of the control, thereby (i) inhibiting plant photosynthesis and (ii) decreasing plant biomass.

[0049] In one or more embodiments, the plant contains a functional domain of a STOMAGEN protein or a sequence at least 90% identical or homologous thereto.

[0050] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family.

[0051] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from a plant of the genus Flaveria and / or Arabidopsis.

[0052] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis thaliana.

[0053] In one or more embodiments, the plant further contains a signal peptide of a STOMAGEN protein.

[0054] In one or more embodiments, the signal peptide of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family.

[0055] In one or more embodiments, the signal peptide of the STOMAGEN protein is derived from a plant of the genus Flaveria and / or Arabidopsis.

[0056] In one or more embodiments, the signal peptide of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis thaliana.

[0057] In one or more embodiments, upregulating the stomatal density of a plant comprises upregulating the expression or activity of a functional domain of a STOMAGEN protein in the plant.

[0058] In one or more embodiments, upregulating the expression of the functional domain of the STOMAGEN protein in the plant comprises: transferring the functional domain sequence of the STOMAGEN protein into the plant to obtain a transformed plant.

[0059] In one or more embodiments, downregulating the stomatal density of a plant comprises downregulating the expression or activity of a functional domain of a STOMAGEN protein in the plant.

[0060] In one or more embodiments, downregulating the expression or activity of the functional domain of the STOMAGEN protein in the plant comprises:

[0061] (1) specifically interfere with the transcription and / or expression of the functional domain of the STOMAGEN protein, or

[0062] (2) Functional domains of STOMAGEN proteins with reduced expression activity in plants.

[0063] In one or more embodiments, (1) the interference is interference with the transcription of the functional domain of the STOMAGEN protein or the translation of its transcript.

[0064] In one or more embodiments, the nucleic acid that specifically interferes with the transcription and / or expression of the functional domain of the STOMAGEN protein is derived from the following group: (1) dsRNA, antisense nucleic acid, small interfering RNA, microRNA, shRNA, reRNA, sgRNA that targets the coding sequence of the functional domain of the STOMAGEN protein or its transcript for inhibition or silencing, or (2) a construct that can express or form (1).

[0065] In one or more embodiments, the functional domain of the STOMAGEN protein is derived from Flaveria bidentis, and its coding sequence is shown in SEQ NO ID: 1.

[0066] In one or more embodiments, the signal peptide of the STOMAGEN protein is derived from Arabidopsis thaliana, and its coding sequence is shown in SEQ NO ID:4.

[0067] In one or more embodiments, the up-regulation of stomatal density means that the stomatal density of the plant after up-regulation is 1.4-2.5 times, preferably 2-2.5 times, that of the wild-type plant.

[0068] In one or more embodiments, the promoting plant photosynthesis refers to increasing the plant photosynthetic rate; and the inhibiting plant photosynthesis refers to reducing the plant photosynthetic rate.

[0069] In one or more embodiments, the plant is a plant of the Asteraceae and / or Cruciferae family.

[0070] In one or more embodiments, the plant is a Flaveria bidentata and / or Arabidopsis plant.

[0071] In one or more embodiments, the plant is Flaveria bidentis and / or Arabidopsis thaliana.

[0072] The present invention also provides a method for screening candidate substances for regulating plant biomass, comprising the steps of:

[0073] (1) bringing the substance into contact with the system, and

[0074] (2) Detect the stomatal density in the system and compare it with the stomatal density of the control system.

[0075] If the stomatal density is 1.4-2.5 times that of the control, the substance is a candidate substance for up-regulating plant biomass; otherwise, the substance is a candidate substance for down-regulating plant biomass.

[0076] In one or more embodiments, the control is the same system without the substance.

[0077] In one or more embodiments, the system is a solution system, a cell system, a tissue system, or a plant model.

[0078] In one or more embodiments, the plant is a plant of the Asteraceae and / or Cruciferae family.

[0079] In one or more embodiments, the plant is a Flaveria bidentata and / or Arabidopsis plant.

[0080] In one or more embodiments, the plant is Flaveria bidentis and / or Arabidopsis thaliana.

[0081] In one or more embodiments, the pore density is higher than the control, which means that the pore density is 1.4-2.5 times, preferably 2-2.5 times, the pore density of the control.

[0082] The present invention also provides a method for screening candidate substances capable of regulating plant biomass, comprising the steps of:

[0083] (1) contacting a substance with a system comprising a coding sequence of a STOMAGEN protein or a functional domain thereof, and

[0084] (2) Detecting the stomatal density and the expression of STOMAGEN protein or its functional domain in the system, and comparing them with those in the control system;

[0085] If the stomatal density is 1.4-2.5 times that of the control and the expression of the STOMAGEN protein or its functional domain is increased, the substance is a candidate substance for up-regulating plant biomass; otherwise, the substance is a candidate substance for down-regulating plant biomass.

[0086] The present invention provides a method for obtaining a transgenic plant, comprising the steps of:

[0087] (1) Providing Agrobacterium carrying the nucleic acid construct described in any embodiment of the present invention;

[0088] (2) contacting the plant cells, tissues or organs with the Agrobacterium in step (1), thereby transferring the nucleic acid construct into the plant tissues or organs;

[0089] (3) selecting plant tissues, organs or seeds into which a nucleic acid sequence has been introduced, wherein the nucleic acid sequence is: (a) a coding sequence for a functional domain of a STOMAGEN protein and / or a coding sequence for a signal peptide domain of a STOMAGEN gene operably linked to a functional domain of a STOMAGEN protein, or (b) a nucleic acid sequence that specifically interferes with the transcription and / or expression of a functional domain of a STOMAGEN protein and / or a nucleic acid sequence that specifically interferes with the transcription and / or expression of a signal peptide domain of a STOMAGEN protein operably linked to a functional domain of a STOMAGEN protein;

[0090] (4) regenerating the plant tissue, organ or seed in step (3) into a plant; and

[0091] (5) Detecting the stomatal density of the plant. If the stomatal density is 1.4-2.5 times that of the control, the transgenic plant is a plant with increased biomass.

[0092] The beneficial effects of the present invention are:

[0093] The present invention discovers the relationship between stomatal density and biomass and related applications and methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0094] Figure 1The increase in FSTOMAGE expression leads to an increase in stomatal density, accompanied by changes in plant growth phenotype. Figure A shows the different growth phenotypes of different overexpressing transgenic lines, at day 24; Figure B shows the gradual increase in stomatal density of different overexpressing transgenic lines; and Figure C shows the gradual increase in FSTOMAGEN expression in different overexpressing transgenic lines as stomatal density increases.

[0095] Figure 2 The biomass of some strains differed from that of the strain with the lowest stomatal density. A represents the dry weight of some strains relative to that of the strain with the lowest stomatal density. The horizontal axis represents strains 8, 15, 5, 4, 14, 11, 12, 30, and 9 from left to right. B represents the fresh weight of some strains relative to that of the strain with the lowest stomatal density. C represents the statistically significant difference in dry weight among the three levels of stomatal density.

[0096] Figure 3 The relationship between water content and biomass. A represents the strain with the lowest relative stomatal density, and some strains have different water contents. B represents a positive correlation between water content and dry weight.

[0097] Figure 4 The following are the changes in leaf area over time for different strains in the early growth stage. A shows the changes in leaf area over time; B shows the changes in increased leaf area over time; and C shows the line graph of the changes in leaf area over time.

[0098] Figure 5 Figure 1 shows the stomatal density of an AFSTO-overexpressing transgenic line and a comparison of the stomatal density of an FSTO-overexpressing transgenic line. Figure A shows the gradual increase in stomatal density of an AFSTO-overexpressing transgenic line; Figure B shows the comparison of the stomatal density of an AFSTO-overexpressing transgenic line with that of an FSTO-overexpressing transgenic line; and Figure C shows the gradual increase in AFSTO expression in an overexpressing transgenic line. Note: AFSTO is a recombinant gene formed by combining the signal peptide of Arabidopsis thaliana with the functional region of Flaveria bidentis.

[0099] Figure 6 The growth phenotypes of transgenic plants at different stages: A is the 19th day; B is the 22nd day; C is the 30th day; and D is the 33rd day. DETAILED DESCRIPTION

[0100] The present invention proposes that moderately increasing stomatal density through altered FSTOMAGEN expression may increase biomass. In this study, FSTOMAGEN-overexpressing lines with varying stomatal densities were tested. The hypothesis that moderately altering stomatal density through FSTOMAGEN expression can increase Arabidopsis biomass was verified.

[0101] As used herein, the plant is a plant of the Asteraceae family and / or the Cruciferae family. Preferably, the plant is a plant of the genus Flaveria and / or Arabidopsis.

[0102] Herein, STOMAGEN genes or STOMAGEN proteins include, but are not limited to, STOMAGEN genes or STOMAGEN proteins derived from Asteraceae and / or Cruciferae plants, or variants thereof having more than 90% homology or identity thereto. In one or more embodiments, STOMAGEN genes or STOMAGEN proteins include, but are not limited to, (1) STOMAGEN genes or STOMAGEN proteins derived from Asteraceae and / or Cruciferae plants, or (2) variants thereof derived from Asteraceae and / or Cruciferae plants having more than 90% homology or identity thereto. Preferably, the STOMAGEN gene or STOMAGEN protein is a STOMAGEN gene or STOMAGEN protein of a plant of the genus Flaveria and / or Arabidopsis.

[0103] In one or more embodiments, the functional domain of the STOMAGEN protein described herein is derived from Flaveria bidentis, and its sequence is shown in SEQ NO ID: 1, or a variant thereof having 90% or more homology or identity thereto, or the functional domain of the STOMAGEN protein is derived from Arabidopsis thaliana, and its sequence is shown in SEQ NO ID: 2, or a variant thereof having 90% or more homology or identity thereto. In one or more embodiments, the signal peptide domain of the STOMAGEN protein described herein is derived from Flaveria bidentis, and its sequence is shown in SEQ NO ID: 3, or a variant thereof having 90% or more homology or identity thereto, or the signal peptide domain of the STOMAGEN protein is derived from Arabidopsis thaliana, and its sequence is shown in SEQ NO ID: 4, or a variant thereof having 90% or more homology or identity thereto.

[0104] In the context of two or more polypeptide or nucleic acid molecule sequences, the terms "identity" or "percent identity" refer to two or more sequences or subsequences that are identical or wherein a certain percentage of amino acid residues or nucleotides are identical over a specified region (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical) when compared and aligned for maximum correspondence over a comparison window or specified region using methods known in the art, such as sequence comparison algorithms, by manual alignment and visual inspection. For example, preferred algorithms suitable for determining percent sequence identity and percent sequence similarity are the BLAST and BLAST 2.0 algorithms, as described in Altschul et al. (1977) Nucleic Acids Res. 25:3389 and Altschul et al. (1990) J. Mol. Biol. 215:403, respectively.

[0105] The present invention includes nucleic acid molecules encoding the functional domains or signal peptide domains of the STOMAGEN proteins described herein. As used herein, the terms "nucleic acid," "nucleotide," "polynucleotide," or "nucleic acid sequence" may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA may be single-stranded or double-stranded. DNA may be the coding strand or the non-coding strand. When referring to nucleic acids, the term "variant," as used herein, may refer to naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include degenerate variants, substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a nucleic acid that may contain one or more nucleotide substitutions, deletions, or insertions that do not substantially alter the function of the encoded protein. Nucleic acids of the present invention may comprise nucleotide sequences that have at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% sequence identity to the nucleic acid sequence. The present invention also relates to nucleic acid fragments that hybridize to the aforementioned sequences. As used herein, a "nucleic acid fragment" is at least 15 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides in length. Nucleic acid fragments can be used in nucleic acid amplification techniques (e.g., PCR).

[0106] It should be understood that although the STOMAGEN gene of the present invention is preferably obtained from the Asteraceae plant Flaveria bidentis, other genes highly homologous to the Flaveria bidentis STOMAGEN gene (e.g., having more than 80%, such as 85%, 90%, 95%, or even 98% sequence identity) obtained from other plants (e.g., Arabidopsis thaliana) or genes with degeneracy therewith are also contemplated by the present invention. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST.

[0107] The full-length nucleotide sequence of the present invention or its fragment can usually be obtained by PCR amplification, recombinant method or artificial synthesis method. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available DNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified in the correct order. Once the relevant sequence is obtained, the relevant sequence can be obtained in large quantities by recombinant method. Usually, it is cloned into a vector, then transferred into cells, and then the relevant sequence is isolated from the host cells after proliferation by conventional methods. In addition, the relevant sequence can also be synthesized by artificial synthesis method. At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0108] The present invention also provides nucleic acid constructs of the sequences, such as vectors. As a preferred embodiment, the recombinant vector contains a multiple cloning site or at least one restriction enzyme cleavage site downstream of the promoter. When it is desired to express the target gene of the present invention, the target gene is ligated into a suitable multiple cloning site or restriction enzyme cleavage site, thereby operably linking the target gene to the promoter. As another preferred embodiment, the recombinant vector comprises (from 5' to 3' direction): a promoter (e.g., a 35S promoter), a target gene, and a terminator. If desired, the recombinant vector may further comprise elements selected from the following groups: a 3' polynucleotide signal; an untranslated nucleic acid sequence; a transport and targeting nucleic acid sequence; a resistance selection marker (e.g., dihydrofolate reductase, neomycin resistance, hygromycin resistance, and green fluorescent protein); an enhancer; or an operator. The vector may be an expression vector or an integration vector. The former is used to express genes, dsRNA, related enzymes, sgRNA, etc.; the latter is used to integrate the desired expressed nucleic acid sequence into the genome. Methods for preparing recombinant vectors are well known to those of ordinary skill in the art, such as the pCAMBIA-3300 vector. The expression vector can be a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus or other vectors. In short, any plasmid and vector can be used as long as it can replicate and be stable in the host.

[0109] The present invention also provides a use of plant stomatal density for regulating plant biomass. "Regulation" herein includes "up-regulation" and "down-regulation". Therefore, the regulation described herein is (1) up-regulating the stomatal density of plants so that the stomatal density is 1.4-2.5 times that of the control (e.g., 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5 times or a range between any two of the above values, such as 1.5-2.4, 1.6-2.3, 1.7-2.2, 1.8-2.1, 1.9-2.0, etc.), thereby (i) promoting plant photosynthesis, and (ii) up-regulating plant biomass; or (2) up-regulating or down-regulating the stomatal density of plants so that the stomatal density is not 1.4-2.5 times that of the control (e.g., greater than 0 times and less than 1.4 times, or greater than 2.5 times), thereby (i) inhibiting plant photosynthesis, and (ii) down-regulating plant biomass.

[0110] Any substance that can increase plant stomatal density can be used in the present invention as a "promoter" of plant stomatal density to regulate plant biomass, such as a vector that increases the expression or activity of the functional domain of the STOMAGEN protein.

[0111] Alternatively, to increase plant stomatal density, a promoter for the functional domain of the STOMAGEN protein may be contacted with the plant. Promoters for the functional domain of the STOMAGEN protein include, but are not limited to, small molecule compounds, nucleic acid molecules, or combinations thereof. Preferably, the nucleic acid molecule is a nucleic acid construct containing a coding sequence for the functional domain of the STOMAGEN protein. The nucleic acid construct is an expression vector or an integration vector.

[0112] On the other hand, any substance that can reduce plant stomatal density can be used in the present invention as a plant stomatal density inhibitor. The inhibitor can be used to regulate plant biomass.

[0113] For example, in order to lower the stomatal density of plants, a molecule that specifically interferes with the transcription and / or expression of the functional domain of the STOMAGEN protein can be introduced into cells or plants so that the cells or plants do not express or reduce the expression of the functional domain of the STOMAGEN protein. The inhibitory molecule uses the coding sequence of the functional domain of the STOMAGEN protein or its transcript as the inhibition target. Therefore, the inhibitory molecule can use the sequence shown in SEQ ID NO: 1 or 2 as the inhibition target. The inhibitory molecule can be an antisense nucleic acid, microRNA, siRNA, shRNA, dsRNA, or sgRNA that interferes with the expression of the gene encoding the functional domain of the STOMAGEN protein.

[0114] In addition, in order to lower the expression or activity of the functional domain of STOMAGEN protein, a gene knockout vector can be transferred into the cell. Therefore, the inhibitor can be a reagent, such as sgRNA, that knocks out or knocks down the coding sequence of the functional domain of STOMAGEN protein using a technology selected from ZFN, TALEN and CRISPR. ZFN, TALEN and CRISPR / Cas9 technology suitable for the present invention are well known in the art. Each technology realizes the knockout of the target gene by the joint action of DNA recognition domain and nuclease. In these embodiments, the inhibitor also includes a Cas enzyme (such as Cas9), its coding sequence, and / or a nucleic acid construct expressing the Cas enzyme.

[0115] Herein, the up-regulation of stomatal density refers to that the stomatal density of the plant after up-regulation is 1.4-2.5 times that of the control, preferably 2-2.5 times; the promotion of plant photosynthesis refers to increasing the photosynthetic rate of the plant; and the inhibition of plant photosynthesis refers to reducing the photosynthetic rate of the plant. In one or more embodiments, the plant is a plant of the Asteraceae and / or Cruciferae family, preferably a plant of the genus Flaveria and / or Arabidopsis. In one or more embodiments, the plant is Arabidopsis thaliana, and the up-regulation of stomatal density refers to that the stomatal density of the plant after up-regulation is 279-484 / mm 2 , preferably 401-484 pieces / mm2 .

[0116] Based on the inventors' novel findings, the present invention provides a method for screening substances capable of regulating plant biomass, comprising the steps of: (1) providing Agrobacterium carrying the nucleic acid construct described in any embodiment of the present invention; (2) contacting plant cells, tissues, or organs with the Agrobacterium in step (1), thereby transferring the nucleic acid construct into the plant tissues or organs; and (3) selecting plant tissues, organs, or seeds into which a nucleic acid sequence has been transferred, wherein the nucleic acid sequence is: (a) a coding sequence for a functional domain of a STOMAGEN protein, and / or a sequence operably linked to a functional domain of a STOMAGEN protein. (b) a coding sequence of a STOMAGEN protein signal peptide domain, or (b) a nucleic acid sequence that specifically interferes with the transcription and / or expression of a functional domain of a STOMAGEN protein, and / or a nucleic acid sequence that specifically interferes with the transcription and / or expression of a STOMAGEN protein signal peptide domain operably connected to a functional domain of a STOMAGEN protein; (4) regenerating the plant tissue, organ or seed in step (3) into a plant; and (5) detecting the stomatal density of the plant, if the stomatal density is 1.4-2.5 times that of the control, the transgenic plant is a plant with increased biomass. In this article, the plant model is a plant of the Asteraceae and / or Cruciferae family, preferably a plant of the genus Flaveria and / or Arabidopsis. In one or more embodiments, the stomatal density higher than the control means that the stomatal density is 1.4-2.5 times, preferably 2-2.5 times, that of the control.

[0117] The candidate substances can be selected from the group consisting of peptides, polymeric peptides, peptidomimetics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, organic small molecules, inorganic small molecules, and nucleic acid sequences. Depending on the type of substance to be screened, those skilled in the art will understand how to select an appropriate screening method.

[0118] Other aspects of the present invention will be apparent to those skilled in the art from the disclosure herein. The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form a preferred technical solution.

[0119] Example

[0120] Experimental methods

[0121] 1. Construction of Constructs

[0122] In previous research, we overexpressed FSTOMAGEN (a homolog of STOMAGEN in the genus Flaveria) in Arabidopsis thaliana. Specifically, the 35S promoter was used to drive FSTOMAGEN overexpression. FSTOMAGEN was amplified from cDNA of Flaveria thaliana (F. rob). In the strain used in this study, the signal peptide of FSTOMAGEN from Flaveria thaliana was replaced with the signal peptide of STOMAGEN from Arabidopsis thaliana. These fragments were inserted into the pCAMBIA-3300 vector (other vectors for plant gene overexpression, such as pBI and pUC, can also be used) via homologous recombination (Novozymes Biotech). The pCAMBIA-3300 vector was then transformed into Escherichia coli. This vector was then transformed into Agrobacterium tumefaciens GV3101 (Agrobacterium tumefaciens strain). Transgenic lines were obtained by the floral dip method. Transgenic lines were selected using a 2000-fold dilution of glufosinate ammonium (Basta). The T2 generation of transgenic Arabidopsis thaliana was selected for subsequent experiments.

[0123] 2. Growth conditions

[0124] In the first experiments, transgenic Arabidopsis lines were initially grown under a light intensity of approximately 100 μmol photo / m² / s (PPFD). After 19 days, the transgenic lines were transferred to an environment with a light intensity of approximately 300 μmol photo / m² / s (PPFD). Subsequently, these transgenic lines were transferred to an environment with a light intensity of approximately 500 μmol photo / m² / s (PPFD).

[0125] 3. Calculation of water content

[0126] The relative water content is calculated using the following formula:

[0127] (Fresh weight - dry weight) / Fresh weight

[0128] 4. Photographing Arabidopsis

[0129] After transplanting the plants into the soil, the plants were photographed for 7 days at two-day intervals using a Canon EOS 1500D camera (Canon, Japan).

[0130] Example 1: Transgenic lines with moderately increased stomatal density exhibit increased rosette leaf area and biomass

[0131] We obtained nine transgenic lines of Arabidopsis thaliana that overexpress FSTOMAGEN (a gene homologous to STOMAGEN in Flaveria). Our previous studies have shown that stomatal density increases gradually and there is a positive correlation between stomatal density and expression level ( Figure 1 , BC). It is noteworthy that the total leaf area of these transgenic lines varied ( Figure 1 , A). Compared with other lines, the total leaf area of two lines (lines 11 and 12) was significantly larger ( Figure 1 , A). This prompted us to examine the biomass of these transgenic Arabidopsis lines. Consistent with the total leaf area, differences in biomass were observed between the lines, with lines 11 and 12 showing increases in both fresh and dry weight biomass ( Figure 2 , AB).

[0132] Example 2: There is a positive correlation between Arabidopsis biomass and water content

[0133] In the late growth period, the rosette leaves of some strains of Arabidopsis thaliana turned purple, brown and dried up ( Figure 6 , CD). Since these transgenic lines had increased stomatal density, this change in the rosette leaves could be due to water loss. The water content of a plant significantly affects photosynthesis. Therefore, we measured the water content of these transgenic plants. We found that the lines with increased stomatal density had lower water content ( Figure 3 , A). In particular, the water content of strain 30, which had a high stomatal density, was extremely low ( Figure 3 , A), and the purple and brown colors of the leaves of this strain were the most obvious ( Figure 6 , D). More importantly, the leaves of this line became wilted. These results indicate that these transgenic lines experienced water limitation during growth.

[0134] Example 3: Transgenic lines with increased stomatal density showed increased leaf area and leaf growth rate in the early stages

[0135] We observed the leaf growth rate of these transgenic lines in the early stage. We found that during this period, the leaf area and leaf growth rate of these transgenic lines gradually increased with the increase of stomatal density ( Figure 4 , AC). In particular, due to the gradual increase in leaf growth rate ( Figure 4 , C; shown as derivatives in the figure), this result is consistent with the theory that increased stomatal density leads to increased photosynthetic rate, which in turn increases the rate of biomass accumulation (we believe that leaf growth rate is almost equivalent to biomass accumulation rate). These increased biomass accumulation rates lead to differences in final biomass and leaf area. It is worth noting that the growth rate pattern after 20 days is different from that before this period ( Figure 4 , C). There was a large difference in growth rate between these lines between 15 and 20 days ( Figure 4 , C).

[0136] Results and Discussion:

[0137] 1. Moderately increasing stomatal density can increase plant biomass

[0138] Increasing stomatal conductance can increase the photosynthetic rate. Therefore, increasing plant biomass by increasing stomatal conductance is very promising. The enhancement of stomatal conductance can be achieved by increasing stomatal density or increasing stomatal volume. In this study, we increased stomatal density by regulating the expression of STOMAGEN homologous genes (genes homologous to STOMAGEN in Antheraea plants) through genetic manipulation. Our results showed that plant lines with moderately increased stomatal density had higher biomass than plant lines with lower stomatal density. Consistent with previous studies, our study also found that the biomass of plant lines with extremely high increased stomatal density did not change, or even decreased. The reason may be that too many stomata greatly enhance transpiration, and the amount of water lost through the stomata exceeds the amount of water absorbed by the roots, which causes the plant to be in a water-deficient state. Therefore, the growth of the plant is restricted and the biomass is reduced. This explanation is shown in Figure ( Figure 3 , B) was supported. There is a positive correlation between plant biomass and water content ( Figure 3 , B), indicating that plant water content affects plant growth. Another possible explanation is that in plant strains with too many stomata, stomatal development and movement consume excessive energy. The energy gained through the enhanced CO2 assimilation capacity of stomata is insufficient to offset this energy consumption, which would reduce the biomass that should have been increased in these plant strains with too many stomata.

[0139] Our study showed that replacing the signal peptide did not affect the function of this gene in controlling stomatal density ( Figure 5 ), indicating that the information conveyed by the combination of the signal peptide and the gene functional region does not affect stomatal density. The functions of the signal peptide and the gene functional region are relatively independent, and the function of the signal peptide should be limited to accurately locating the gene. At most, it may be necessary to consider whether differences in the signal peptide sequence affect the speed of signal peptide transport. Therefore, many signal peptides that can accurately locate the gene can be used to replace the gene's original signal peptide.

[0140] 2. Increasing stomatal density to an appropriate level through genetic engineering can help reduce CO2 concentrations. The mechanisms of stomatal development are conserved across species. Many genes identified in Arabidopsis also control stomatal development in other species. This means that genetic manipulation of these genes could be used to alter stomatal density in plants beyond Arabidopsis, as demonstrated in this study. Increased atmospheric CO2 concentrations lead to rising temperatures, which in turn impact and alter the global environment. This could lead to extreme and unusual climate and environmental conditions and trigger natural disasters such as droughts and floods. Therefore, it is essential to explore strategies to address rising atmospheric CO2 concentrations. Our research provides insights into this approach. This study demonstrates that appropriately increasing stomatal density can increase plant biomass. This suggests that increasing stomatal density can enhance a plant's net CO2 assimilation rate and strengthen its ability to absorb CO2 from the environment. Since the functions of the genes identified in Arabidopsis in stomatal development are conserved in other species that play a more important role in reducing atmospheric CO2 concentrations, it is possible that increasing stomatal density to an appropriate level in these species could significantly reduce current atmospheric CO2 concentrations. Furthermore, the increased biomass in plants could be of use to humans. For example, the biomass increased by plants can be wood, which can then be used in industry and manufacturing. Plant biomass contains a lot of cellulose, so it can also be used to produce some products that require cellulose.

[0141] 3. Our study showed that increasing stomatal density through genetic manipulation increased plant biomass in an environment with sufficient water and high light intensity, indicating that the synergy between genetic engineering and environmental regulation is an important means to address the complexity of traits.

[0142] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions, without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been described herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made using conventional techniques known in the art, outside the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

[0143] Part of this article sequence:

[0144] SEQ ID NO: 1: Functional domain coding sequence of Flaveria bidentis STOMAGEN protein

[0145] ATCGGGTCGGTGAAGCCAACGTGCACGTACAACGAATGCAGGGGGTGCAGGTCGCGGTGCAGAGCCGAACAAGTTCCGGTTGAAGGGAATGACCCCATAAATAGTGCTTACCATTATAGATGTATTTGCCATAGGTAA

[0146] SEQ ID NO: 2: Functional domain coding sequence of Arabidopsis thaliana STOMAGEN protein

[0147] atagggtcgacagcaccaacttgtacgtacaacgagtgcagaggatgcagatacaagtgcagagcagagcaagttccagtcgaaggaaatgaccctatcaacagtgcttatcattatagatgtgtttgtcatagataa

[0148] SEQ ID NO: 3: Signal peptide domain coding sequence of Flaveria bidentis STOMAGEN protein

[0149] ATGACTACCAATTCATGTGTTCTTCAAACCACAACAATGGCTTCCCCATCAAAATTCAACTTTCTCTTCTTCTTCATATGGGCAACACTAGTCCTCCAAGGAATTGCAGGGTCCAGAACACTAGCACTGCTTCCTCAACAGAATTCTGCAACTGAAAAAGAGTTAAACTTGCAGAGTACAAGCAACAAAATGATGAGGAGAAGATCAATG

[0150] SEQ ID NO: 4: Signal peptide domain coding sequence of Arabidopsis thaliana STOMAGEN protein

[0151] atgaagcatgaaatgatgaacatcaagccaagatgcataaccatcttctttcttctttttgctttgcttcttggaaattatgtagttcaagcctcaagacctcgttctatcgaaaatacggtctcccttctcccacaagtacatctcctgaattcaaggaggaggcatatg

[0152] SEQ ID NO: 5: cDNA sequence of F. rob

[0153]

Claims

1. A nucleic acid construct comprising: (1) a coding sequence of a functional domain of a STOMAGEN protein or a sequence having at least 90% identity or homology thereto, and (2) The coding sequence of the signal peptide domain of the STOMAGEN protein or a sequence having at least 90% identity or homology thereto.

2. The nucleic acid construct according to claim 1, wherein The functional domain of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family; preferably, the functional domain of the STOMAGEN protein is derived from plants of the genus Flaveria and / or Arabidopsis; more preferably, the coding sequence of the functional domain of the STOMAGEN protein is as shown in SEQ ID NO: 1 or 2, and / or The signal peptide domain of the STOMAGEN protein is derived from Asteraceae and / or Cruciferae plants; preferably, the signal peptide domain of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis plants; more preferably, the coding sequence of the functional domain of the STOMAGEN protein is shown in SEQ ID NO: 3 or 4.

3. A use of plant stomatal density for regulating plant biomass, wherein: The purpose is, (1) increasing the stomatal density of the plant to 1.4-2.5 times that of the control, thereby (i) promoting plant photosynthesis and (ii) increasing plant biomass; or (2) Up-regulating or down-regulating the stomatal density of plants so that the stomatal density is not 1.4-2.5 times that of the control, thereby (i) inhibiting plant photosynthesis and (ii) down-regulating plant biomass.

4. The use according to claim 3, characterized in that The plant contains the functional domain of the STOMAGEN protein or a sequence having at least 90% identity or homology thereto; preferably, the plant further contains a signal peptide domain of the STOMAGEN protein operably linked to the functional domain of the STOMAGEN protein.

5. The use according to claim 3, characterized in that The method of increasing the plant stomatal density comprises the steps of increasing the expression or activity of the functional domain of the STOMAGEN protein in the plant; the method of decreasing the plant stomatal density comprises the steps of decreasing the expression or activity of the functional domain of the STOMAGEN protein in the plant. Preferably, the functional domain of the STOMAGEN protein is operably linked to the signal peptide domain of the STOMAGEN protein.

6. The use according to claim 4 or 5, characterized in that The functional domain of the STOMAGEN protein is derived from plants of the Asteraceae and / or Cruciferae family; preferably, the functional domain of the STOMAGEN protein is derived from plants of the genus Flaveria and / or Arabidopsis; more preferably, the sequence of the functional domain of the STOMAGEN protein is as shown in SEQ ID NO: 1 or 2, and / or The signal peptide domain of the STOMAGEN protein is derived from Asteraceae and / or Cruciferae plants; preferably, the signal peptide domain of the STOMAGEN protein is derived from Flaveria bidentis and / or Arabidopsis plants; more preferably, the sequence of the functional domain of the STOMAGEN protein is shown in SEQ ID NO: 3 or 4.

7. The use according to claim 5, characterized in that The method of increasing the expression or activity of the functional domain of the STOMAGEN protein in the plant comprises: transferring the coding sequence of the functional domain of the STOMAGEN gene into the plant to obtain a transformed plant; The down-regulation of the expression or activity of the functional domain of the STOMAGEN protein in the plant includes: (1) specifically interfering with the transcription and / or expression of the functional domain of the STOMAGEN protein, or (2) expressing the functional domain of the STOMAGEN protein with reduced activity in the plant.

8. A method for regulating plant biomass, comprising: (1) increasing the stomatal density of the plant to 1.4-2.5 times that of the control, thereby (i) promoting plant photosynthesis and (ii) increasing plant biomass; or (2) Up-regulating or down-regulating the stomatal density of plants so that the stomatal density is not 1.4-2.5 times that of the control, thereby (i) inhibiting plant photosynthesis and (ii) down-regulating plant biomass.

9. A method for screening candidate substances capable of regulating plant biomass, comprising the steps of: (1) bringing the substance into contact with the system, and (2) Detect the stomatal density in the system and compare it with the stomatal density of the control system. If the stomatal density is 1.4-2.5 times that of the control, the substance is a candidate substance for up-regulating plant biomass; otherwise, the substance is a candidate substance for down-regulating plant biomass.

10. A method for screening candidate substances capable of regulating plant biomass, comprising the steps of: (1) contacting a substance with a system comprising a coding sequence of a STOMAGEN protein or a functional domain thereof, and (2) Detecting the stomatal density and the expression of STOMAGEN protein or its functional domain in the system, and comparing them with those in the control system; If the stomatal density is 1.4-2.5 times that of the control and the expression of the STOMAGEN protein or its functional domain is increased, the substance is a candidate substance for up-regulating plant biomass; otherwise, the substance is a candidate substance for down-regulating plant biomass.

11. A method for obtaining a transgenic plant, comprising the steps of: (1) Providing Agrobacterium carrying the nucleic acid construct according to claim 1 or 2; (2) contacting the plant cells, tissues or organs with the Agrobacterium in step (1), thereby transferring the nucleic acid construct into the plant tissues or organs; (3) selecting plant tissues, organs or seeds into which a nucleic acid sequence has been introduced, wherein the nucleic acid sequence is: (a) a coding sequence for a functional domain sequence of a STOMAGEN protein, and / or a coding sequence for a signal peptide domain of a STOMAGEN protein operably linked to a functional domain of a STOMAGEN protein, or (b) a nucleic acid sequence that specifically interferes with the transcription and / or expression of a functional domain of a STOMAGEN protein, and / or a nucleic acid sequence that specifically interferes with the transcription and / or expression of a signal peptide domain of a STOMAGEN protein operably linked to a functional domain of a STOMAGEN protein; (4) regenerating the plant tissue, organ or seed in step (3) into a plant; and (5) Detecting the stomatal density of the plant. If the stomatal density is 1.4-2.5 times that of the control, the transgenic plant is a plant with increased biomass.

Citation Information

Patent Citations

  • Stomate-increasing agent, polypeptide, method for increasing number and / or density of stomates in plant, and method for increasing yield of plant

    CN102918054A

  • Application of DT1 proteins to regulating stomatal density of plants and improving drought resistance thereof

    CN106636178A

  • Application of rape gene in improving drought resistance and yield of rape

    CN112011568A

  • Compositions and methods for mediating plant stomatal development in response to carbon dioxide and applications for engineering drought tolerance in plants

    US20150315606A1