LAC gene related to polymerization of proanthocyanidins, overexpression vector of LAC gene and detection method of oligomer proanthocyanidins of LAC gene

Abstract

The invention relates to the technical field of molecular biology, in particular to an LAC gene related to polymerization of proanthocyanidins, construction of an overexpression vector of the LAC gene and a detection method of oligomer proanthocyanidins. Plant laccase (Laccase, LAC) is an enzyme widely existing in the plant field, and plays an important role in the physiological process and secondary metabolism of plants. The invention provides an LAC gene, an overexpression vector construction method and a method for detecting oligomer proanthocyanidins of the LAC gene. Comprising the following steps: inserting a target gene into an overexpression vector, transferring a plasmid which is correctly sequenced into GV3101 agrobacterium, carrying out heterologous transformation on tobacco and determining the content of proanthocyanidins in a positive seedling, and finally providing a stable and effective overexpression vector construction method. The method has the advantages that the expression product of the target gene can be stably and effectively identified, and gene function research and product development are facilitated.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a LAC gene related to proanthocyanidin polymerization, an overexpression vector thereof, and a method for detecting oligomeric proanthocyanidins. Background Art

[0002] Different parts of the lotus have different focuses on the types of active ingredients. There are more studies on alkaloids and flavonoids in lotus leaves, seeds and flowers (Liu Jiushi, 2015). In the experiment of detecting the content of proanthocyanidins in various non-edible parts of lotus (lotus stems, lotus nodes, lotus leaves, lotus pods, etc.), it was found that the proanthocyanidin content in the lotus pods was the highest (Ling Zhiqun, 2001). The research on polyphenols in lotus flowers mainly focused on proanthocyanidins and concentrated them in the lotus pods, where proanthocyanidins are the main active ingredients (Zhao Xiaoliang et al., 2012).

[0003] Early studies of plant laccases (LACs) found that laccases isolated from Rhus verniciflua and Myceliophthora can catalyze the polymerization of catechins into polymers (Hosny and Rosazza, 2002; Motoichi et al., 2003). Laccases isolated from Aspergillus can oxidize catechins into dimers and catalyze the conversion of proanthocyanidin B2 to type A proanthocyanidins (Osman et al., 2007; Osman and Wong, 2007). Pourcel et al. (2005) showed that laccases can catalyze the polymerization of oligomeric proanthocyanidins into polymeric proanthocyanidins.

[0004] The conformational changes and polymerization reactions of proanthocyanidins are likely mediated by a class of polymerases, but the nature of these polymerases remains unclear. Laccase is currently suspected to be a candidate. Therefore, it is essential to identify differentially expressed LAC genes within the transcriptome based on proanthocyanidin content phenotypes and to determine their functions. Combining multiplex analysis with correlation analysis is a feasible strategy for identifying target functional genes.

[0005] In response to the current bottleneck problem of unclear candidate polymerases related to proanthocyanidin polymerization, the purpose of the present invention is to use the lotus reference genome, lotus transcriptome and phenotypic data of proanthocyanidin content and polymerization degree differences among different varieties to identify lotus whole-genome LAC genes and to explore important LAC genes that can affect the proanthocyanidin polymerization phenotype, in order to provide a certain scientific basis for the genetic breeding of lotus with high content of oligomeric proanthocyanidins. Summary of the Invention

[0006] The present invention first provides a LAC gene related to proanthocyanidin polymerization, wherein the LAC gene is a Laccase gene, and the Laccase gene is Nn_laccase15 as shown in SEQ ID NO.1.

[0007] The present invention also provides the use of the above-mentioned LAC gene related to proanthocyanidin polymerization in identifying or assisting in identifying the oligomeric proanthocyanidin polymerization traits of species.

[0008] In certain embodiments, the species is Lotus.

[0009] The present invention also provides the use of a substance for detecting the above-mentioned LAC gene related to proanthocyanidin polymerization in identifying or assisting in identifying the oligomeric proanthocyanidin polymerization trait of a species.

[0010] The present invention also provides an overexpression vector, which comprises the above-mentioned LAC gene related to proanthocyanidin polymerization.

[0011] The present invention also provides a method for detecting the LAC gene as described above, which comprises the step of amplifying the LAC gene.

[0012] In certain embodiments, the method further comprises the steps of obtaining phenotypic data of different lotus varieties and performing association analysis on the phenotypic data and candidate differential genes.

[0013] In some embodiments, the method specifically includes the following steps:

[0014] S1. By measuring the proanthocyanidin content of different lotus varieties, two varieties with large differences in oligomeric proanthocyanidin content were selected for transcriptome sequencing.

[0015] S2. Through multiple analysis and correlation network analysis, differentially expressed genes that may be related to the synthesis and accumulation of proanthocyanidins were discovered.

[0016] S3. Perform correlation analysis between the differentially expressed genes and the proanthocyanidin content phenotype data to obtain the possible Nn_laccase15.

[0017] The present invention also provides a kit for identifying or assisting in identifying the polymerization characteristics of oligomeric proanthocyanidins in species, wherein the kit contains a substance for detecting the above-mentioned LAC gene related to proanthocyanidin polymerization.

[0018] The present invention finally provides the use of the above-mentioned kit in any of the following:

[0019] (A1) Identify or assist in identifying the polymerization characteristics of oligomeric proanthocyanidins in species;

[0020] (A2) Identify or assist in identifying germplasm resources that polymerize proanthocyanidins;

[0021] (A3) Breeding for oligomeric proanthocyanidin polymerization;

[0022] Optionally, the species is Lotus.

[0023] Compared with the prior art, the present invention has at least the following beneficial effects:

[0024] The present invention provides a method for constructing a LAC gene overexpression vector and detecting oligomeric proanthocyanidins. The method involves constructing an overexpression vector with a target gene, performing a gradient screening of expression-inducing conditions, and detecting successful induction of the LAC gene by SDS-PAGE. Ultimately, this method provides a rapid and effective prokaryotic expression induction method. The advantage of the present invention is that it can quickly and effectively identify the expression products of the target gene, facilitating gene function research and protein product development. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Phylogenetic tree analysis of the amino acid sequence of the LAC gene and the amino acid sequences of 100 other species.

[0026] Figure 2 Figure 2 shows a correlation network analysis of compounds and candidate polymerases, as well as the relative expression levels of candidate genes detected by RT-qPCR. (A) Correlation network analysis of compounds and candidate polymerases. (B) Relative expression levels of candidate genes. Relative expression levels were quantified using RT-qPCR.

[0027] Figure 3 for Nn_laccase15 Overexpression vector construction and tobacco transfection.

[0028] Figure 4 Identification of positive tobacco seedlings and determination of proanthocyanidin content. (A) The process of heterologous transformation of tobacco; (B) Glue image of positive seedling identification; (C) Comparison of proanthocyanidin content between positive seedlings and wild-type plants. DETAILED DESCRIPTION

[0029] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0030] SEQ ID No.1

[0031] >Nn_laccase15

[0032] AGGCGAGCTTCTTCCTGTTCACCATTCTTCACTATGAACACAGCATTCATT

[0033] CCCCACGTAAGACGACGTTCCAAATGGCAATGCATGAACCACATTCCAG

[0034] GATTATCTGCTCGGAATCTAATGGCACTCCACCCATTCTTGGGGACCAAA

[0035] ATGGTGTTCAATTCAGGAGGATCAACGAGGTTATACCTCAAGGGGTCCTT

[0036] CTTTTTGTCAAAATTCCCGAAACCCCATCCAACCATATAAAAGCTGTAGC

[0037] CATGTAGATGCATTGGATGGTCTTCTCCTGCAACCAAGTTAGTCCCTTGA

[0038] AACACAAGCTCTACCGCAGAGTTATAATCCAGGAACTTCACCTCAGTACC

[0039] CCTTCTGGGCGTCTGCAGACTCTGAGGCAAGAACTGGGCTGTGTAGTTG

[0040] AAAACAAAAGGTGGCTTATCAGGAAAACGACTACCAAAATCCCCATTTA

[0041] TTCCATAGTAATAAGCCTGTAATATGTCAATCGGTGGGTTCACAAAGCTTA

[0042] TGTTGTTCATTCTAGCAGCCAGTCGTGTCCCGTTTGTCCCTTGACATGAAT

[0043] TGTATGGGCACCGGAAGGTGTTAGCGGAAATTGTGGCGATGATTCGAGT

[0044] GTCCACAGTTAATGGAACATCGATGGGGTGCTCTTCATTTGCTAAGCTCC

[0045] TCAGAGCGTTGGGAAGCCAACTGCGGCATTTGTGTCGTTGTACAAAGGG

[0046] AGAAAGGGCAGAGAATATGGGGGCGACGTTGCAGCGTAGTTGCCCCTGC

[0047] CAGAGTACTGGAGAAATGCTGTGGTGGTCGTGTTATCGAAGTTGACACC

[0048] CTGACCACTGGAGTAAGCTCTGGCAGCGATGTAGTACTGGTTTTGTGGTT

[0049] GATTGGCCTCTAACAAGGCGTCAATGGTCTGGCCTGGGGATATCAAGATG

[0050] TAGTCTCTTGTTAGTGGCTTGTTGTAGCTAGCGTCTCTTCCCACGACTGTA

[0051] AGTTTATGTTGAGCGATGGCGAAGAAGAGATTATCGTTCATTGCAGCGTT

[0052] GACTATTCGGAGTAGATAGGTCTTTCCTTGTTCCACAGGAAGCTTAAATG

[0053] TTCCTGGTTTTGAGCATGGAAAGAGATCACCTGGTTGTCCGTTTATGGTG

[0054] AAAGCATCAGAGATATTGGGTTGACCTCCCGTTCTAAGGGCTTGCCGTAG

[0055] CACCTGCATTACGTCTCTCTTCCACCACTCTCCTAGTATGAGGACTTGTTC

[0056] TGCAACAGGCTTGGGGAAAGGGTAGGCAGTTCCATGCTTGGGATAAATG

[0057] GCGATGGCGCCGTGGACAGTGATTCGATTCCAATCGGTATGAGCGTGCCA

[0058] CCACAATGTCCCTTCCTCTTTGGCAAATATGATCTCGTACGAAAACATTCC

[0059] TCCAGGTTAATCGGGCACTGCGTAATATATGCAGGCCCATCCGACCATG

[0060] GATTCCTCGGTTGCCTCACTCCATGCCAGTGAATGGTGATGTTATGGTTTG

[0061] CCTTGTTATAAACATCGACGATCAACGTATCTCCCCTATGAACATGTAGAG

[0062] TAGGCCCCGGAAATTGCCCATTTACAGTCAAGATTTTCTTCGTGCTGCACAGCCTTGTGTAAGGC;

[0063] Example 1 Phylogenetic tree analysis of the amino acid sequence of the lotus LAC gene and the amino acid sequences of 100 other species

[0064] Annotation files were obtained based on the lotus genome and transcriptome. The conserved domains of LAC proteins were obtained from the Pfam database. The top 100 species containing conserved domains of LAC genes were selected from NCBI through conserved domain search and screening. Multiple sequence alignment of LAC gene protein sequences was performed using Mega10 software to obtain phylogenetic relationships; then, a phylogenetic tree was drawn using the online Itol software (https: / / itol.embl.de / ). Figure 1 ).

[0065] Example 2 Acquisition of Lotus Proanthocyanidin Phenotypic Data

[0066] Total proanthocyanidins (PCIs) were extracted from 12 lotus flower samples of different varieties and parts, and 0.5 g of each sample was accurately weighed. The extract was then semi-quantitatively analyzed by ultrahigh-performance liquid chromatography-mass spectrometry (UHPLC-MS). The samples were processed as follows: 1) Grind the sample into a powder using a grinder, pass it through a 40-mesh sieve, and extract it with 20 mL of analytical-grade methanol (0.5 g of the sample was accurately weighed and ground with liquid nitrogen). The sample was allowed to stand for 30 minutes, then sonicated for 30 minutes at 40°C (room temperature, 160W). After a ten-minute pause, sonication was repeated for another 30 minutes, followed by an hour of standing to obtain an extract. 2) Filter the extract under reduced pressure using a Buchner funnel, and then dry it in a vacuum concentrator. 3) Dissolve the extract in chromatographic-grade methanol and filter it using a filter. Then, filter it twice using a disposable syringe through a 0.45 μm microporous membrane. After filtering twice, dilute the volume to a 25 mL volumetric flask with chromatographic-grade methanol and store it in a refrigerator at 2-5°C until further use. 4) The resulting sample was analyzed by high-performance liquid chromatography-mass spectrometry (UHPLC-MS). A Thermo Fisher Scientific UltiMate 3000 HPLC-MS / HPLC system was used, using a Thermo Fisher Scientific Hypersil-GOLD C18 column, 23002-102130 (particle size 1.9 µl, 100 x 2.1 mm). Chromatographic conditions included a water-95% methanol solution as the mobile phase, with a retention time of 0-10 min, A as the water solution, and B as the 95% methanol solution, at a mobile phase flow rate of 0.3 ml / min. Mass spectrometry conditions included positive ionization mode, an ESI source, an injection volume of 0.3 µl, a mass-to-charge ratio of m / z 100-1000 Da, a heating temperature of 300°C, a sheath gas flow rate of 35 arb, an auxiliary gas flow rate of 15 arb, a purge gas flow rate of 2 arb, a spray voltage of 3.5 V, an ion transfer tube temperature of 350°C, a tube transfer voltage of 1 V, a tube lens voltage of 45 V, and a mass range of 100-1000 m / z. The mass spectrometry data in the positive ion mode were analyzed by Thermo Xcalibur, and the mass spectrometry information of the six proanthocyanidin target substances was extracted. The quantitative ion of each substance was [M+H]+. The peak area values of all substances in each sample were obtained according to the mass spectrometry peak area of the substance, as shown in Table 1.

[0067] Table 1. Peak areas of 6 proanthocyanidin target substances

[0068]

[0069]

[0070] Example 3 Correlation analysis between LAC genes with differential transcriptome mining and phenotypes

[0071] In total, we identified 15 LACs among the differentially expressed genes in the entire transcriptome. In order to more intuitively show the correlation between these three types of genes and the different proanthocyanidins detected by HPLC, we performed a correlation network analysis. The six proanthocyanidins are catechin and epicatechin (C / EC) monomers, gallocatechin and epigallocatechin (GC / EGC) monomers, A-type proanthocyanidin (PAA) dimers, B-type proanthocyanidin (PAB) dimers, C-type proanthocyanidin (PAC) trimers, and oligomeric proanthocyanidins with a degree of polymerization of 2 to 5 (OPC) ( Figure 2 -A). Data with a p-value greater than 0.5 were selected for visualization. Orange circles represent different proanthocyanidins, and yellow circles represent LACs. Straight lines indicate positive correlations, and dotted lines indicate negative correlations. A total of 8 LACs were considered to be positively and negatively correlated with proanthocyanidins. RT-qPCR was used to quantify the relative expression of Nn_laccase15, a gene that may be related to proanthocyanidin polymerization. The results showed that Nn_laccase15 was expressed in the immature, nearly mature, and mature developmental stages of lotus pods of different varieties, but was only expressed in immature lotus seed shells ( Figure 2 -B).

[0072] Example 4 Construction of Overexpression Vector of Nn_laccase15 and Tobacco Transfection

[0073] Construction of overexpression vector:

[0074] (1) Obtaining the insert: PCR amplification was performed using primers with homology arms using cDNA as a template. The PCR product was run on a gel and the target band was cut and recovered. (2) Vector linearization: The S1300 vector was used for overexpression, and the linearized vector was obtained by double digestion with EcoRI and XbaI. (3) Recombination reaction: The linearized vector and the recovered fragment of the target gene with homology arms were mixed in a certain ratio, and reacted at 37°C for 30 minutes under the catalysis of the homologous recombinase ExnaseII to complete the recombination reaction. The target fragment was connected to the vector to form a circular plasmid. (4) Transformation of recombinant plasmid into Escherichia coli DH5α: The recombinant plasmid was transformed into Escherichia coli DH5α competent cells by heat shock transformation method, spread on LB plates containing antibiotics corresponding to the vector resistance, sealed and inverted at 37°C overnight. Single colonies were picked for PCR test and positive strains were sent for sequencing based on the test results. (5) Transformation of Agrobacterium GV3101 with positive plasmid: Take the competent cell of Agrobacterium GV3101 stored at -80℃ and place it at room temperature or in the palm of your hand for a while. When it partially melts and is in an ice-water mixture, place it on ice. Add the plasmid confirmed by sequencing (samples returned by the company), including the S1300 vector plasmid containing the target fragment (0.01-1μg), to 50μL competent cell, gently pat it with your hand to mix, and then place it on ice for 5 minutes, liquid nitrogen for 5 minutes, 37℃ water bath for 5 minutes, and ice bath for 5 minutes. Add 500μL of LB liquid culture medium without antibiotics and incubate it at 28℃ and 200r / min on a shaker for 1 hour. Centrifuge at 4000r / min for 2 minutes, remove the supernatant, and keep about 150μL to resuspend the bacterial block and then spread it on an LB plate containing the antibiotic corresponding to the vector resistance. Seal it and incubate it upside down at 28℃ for 2-3 days. Pick a single colony and run PCR for positive identification. Then mix the positive bacteria with 50% glycerol in a 1:1 ratio and store in a -80℃ refrigerator for later use. Figure 3 shown.

[0075] Example 5 Functional verification of the Nn_laccase15 gene

[0076] Leaf disc transformation method to transform tobacco plants ( Figure 4 -A):

[0077] (1) Take 50ul of the preserved Agrobacterium culture in a clean bench and add it to 10ml of LB liquid medium with kana resistance. Cultivate it in a shaker at 28℃ and 200rpm until the OD value is between 1.0 and 2.0. (2) Use scissors to cut fresh, tender, thick tobacco leaves with good growth and no wounds. Gently rinse the leaf surface with distilled water 3 to 5 times to remove dust and other dirt remaining on the leaves. (3) Disinfect in 75% alcohol for 10 seconds, then rinse with sterile water 3 times. (4) Soak the leaves in 1% mercuric chloride solution for 10 minutes, then rinse with sterile distilled water 3 times. (5) Transfer the leaves to filter paper and use a knife and tweezers treated in an infrared sterilizer to cut the main vein of the leaf edge. Small squares of 1cm in size are placed in the co-cultivation culture dish. (6) Dilute the shaken culture solution to 100ml with 90ml MS, pour it into the cut tobacco leaves, and infect for 20 minutes. (7) Carefully pick out the infected tobacco leaves, spread them flat on sterilized filter paper, and absorb the bacterial liquid on them. (8) Spread the leaves with the front side facing up on the co-culture medium, wrap them with a film, and culture them in the dark for 3 days. (9) After 3 days, transfer the leaves to the differentiation culture medium, and replace the new culture medium every 15 days. (10) Cut the grown adventitious buds and transfer them to the bud-strengthening culture medium. (11) After 15 days, transfer the buds to the rooting culture bottle and wait for them to take root. (12) When the plant has a large number of strong and healthy roots, open the bottle cap and harden the seedlings for 5 days. After the transgenic tobacco is tested positive, transfer them to the matrix soil. The test results of the positive seedlings are as follows Figure 4 -B.

[0078] The proanthocyanidins in tobacco positive seedlings were extracted by methanol ultrasonic and ethyl acetate, and the proanthocyanidins content was detected by high performance liquid chromatography. Figure 4 A comparison of proanthocyanidin content in the laccase gene-overexpressing strain and the wild type revealed that, after crude extraction, the content of type B proanthocyanidins was 1.8 times that of the wild type, while the content of type C proanthocyanidins was 3.8 times that of the wild type. Proanthocyanidin content measurements in transgenic tobacco plants indicate that the laccase gene in lotus is primarily involved in the polymerization of type B proanthocyanidin dimers and type C proanthocyanidin trimers.

[0079] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A LAC gene related to proanthocyanidin polymerization, characterized in that The LAC gene is a Laccase gene, and the Laccase gene is Nn_laccase15 as shown in SEQ ID NO.

1.

2. Use of the LAC gene related to proanthocyanidin polymerization as claimed in claim 1 in identifying or assisting in identifying different polymer traits of proanthocyanidins in species.

3. The use according to claim 2, characterized in that: The species is lotus.

4. Use of the substance for detecting the LAC gene related to proanthocyanidin polymerization as claimed in claim 1 in identifying or assisting in identifying different polymer traits of proanthocyanidins in species.

5. An overexpression vector, characterized in that The overexpression vector comprises the LAC gene related to proanthocyanidin polymerization as claimed in claim 1.

6. A method for detecting the LAC gene according to claim 1, characterized in that: The method includes the step of amplifying the LAC gene.

7. The detection method according to claim 6, wherein: The method also includes the steps of obtaining phenotypic data of different lotus varieties and performing association analysis on the phenotypic data and candidate differential genes.

8. The detection method according to claim 7, characterized in that The specific steps include: S1. By measuring the proanthocyanidin content of different lotus varieties, two varieties with large differences in oligomeric proanthocyanidin content were selected for transcriptome sequencing. S2. Through multiple analysis and correlation network analysis, differentially expressed genes that may be related to the synthesis and accumulation of proanthocyanidins were discovered. S3. Perform correlation analysis between the differentially expressed genes and the proanthocyanidin content phenotype data to obtain the possible Nn_laccase15.

9. A kit for identifying or assisting in identifying species proanthocyanidin oligomers, characterized in that: The kit contains a substance for detecting the LAC gene related to oligomeric proanthocyanidin polymerization as claimed in claim 1.

10. Use of the kit according to claim 9 in any of the following: (A1) Identify or assist in identifying the polymerization characteristics of oligomeric proanthocyanidins in species; (A2) Identify or assist in identifying proanthocyanidin-polymerized germplasm resources; (A3) Breeding for oligomeric proanthocyanidin polymerization; Optionally, the species is Lotus.

Images