Digital PCR freeze-drying reagent, preparation method and application

Abstract

The invention discloses a digital PCR freeze-drying reagent, a preparation method and application. The PCR freeze-drying reagent is obtained by performing vacuum freeze-drying on PCR. The PCR reagent is prepared from the following components: a freeze-drying hot start enzyme, Tris-hcl, KCl, MgCl2, (NH4) 2SO4, a freeze-drying protective agent, dntp, betaine, DMSO, BSA, beta-mercaptoethanol, dutp, UDG and a stabilizer. The water absorption capacity of the PCR freeze-drying reagent exposed in the environment is remarkably reduced. The PCR freeze-drying reagent can be subpackaged, capped and the like in a common low-humidity environment without influencing the water content and activity of biological products, so that the production energy consumption is greatly reduced, and the production efficiency is improved. According to the digital PCR freeze-drying reagent, after water-in-oil liquid drops generated after remelting are subjected to thermal circulation, the liquid drops are not fused, and the amplification efficiency of a biological probe is excellent.

Description

Technical Field

[0001] The present invention relates to a freeze-dried reagent, a preparation method and an application thereof, and in particular to a digital PCR freeze-dried reagent and a preparation method thereof. Background Art

[0002] Traditional molecular diagnostic kits are produced, packaged, shipped, and used in liquid form. Because the kits contain bioactive macromolecules such as DNA polymerase and reverse transcriptase, the product needs to be kept at an appropriate temperature throughout the entire process, usually -20°C or below. Such stringent requirements bring great inconvenience to transportation and production. Long-distance low-temperature transportation in the summer not only requires high transportation costs, but also easily causes product failure or substandard due to non-compliant transportation conditions. During use, the product is frozen due to storage at -20°C or below and needs to be thawed before use. Repeated freezing and thawing not only reduces product stability, but also makes the detection time longer.

[0003] Vacuum freeze-drying is a drying technology that utilizes the principle of sublimation to dehydrate materials. Freeze-drying not only maximizes the preservation of the material's original structure and shape, but also preserves the activity of bioactive substances. Prepared freeze-dried products have an extremely low moisture content (typically less than 5%), far below the relative humidity of normal environments (50%). Furthermore, the freeze-dried product has a dry, loose, and porous structure, making it highly susceptible to absorbing moisture from the air. Once moisture is absorbed, the freeze-dried product loses its bioactive properties. Therefore, handling of freeze-dried products typically requires strict humidity control.

[0004] Traditionally, pharmaceutical biological freeze-dried products are primarily freeze-dried in vials. After freeze-drying, the vials are capped using the lyophilizer's lift and lower levels, completing the initial seal. The vials are then removed from the freezer and transferred to a low-humidity workshop for secondary sealing. However, molecular diagnostic kits, often using freeze-drying containers such as PCR tubes, 8-well strips, and 96-well plates, are not standard freeze-drying containers and cannot be capped. These require manual capping and sealing after release. For freeze-dried pellets, these pellets must be dispensed into test containers after release and then capped and sealed. Therefore, for products that cannot be capped in the freeze-dryer, a low-temperature, low-humidity environment is required for all steps, including release, dispensing, and capping. To achieve this, either full-workshop humidity and temperature control is required, which results in significant energy consumption; or custom-built isolation enclosures or glove boxes are constructed, with high-purity inert gas introduced to reduce humidity. However, performing operations such as packaging and capping through thick gloves will greatly reduce production efficiency.

[0005] Currently available patent information does not explicitly mention a patent specifically for "freezeable premixes for digital PCR." Suzhou Diyin'an Biotechnology Co., Ltd. has obtained a patent for a method for acquiring fluorescence signals in digital PCR (CN112652360B). This technology improves detection sensitivity and accuracy, but does not explicitly address the formulation of the freezeable premix. Guangdong Feipeng Biological Co., Ltd. has applied for a patent for a freeze-dried protection formula for PCR premixes (CN112481253A). This technology addresses the stability issue of glycerol-containing PCR premixes after freeze-drying and is suitable for traditional PCR or qPCR, but does not explicitly mention digital PCR. Shanghai Xinwei Technology R&D Center Co., Ltd. has applied for a patent for a digital PCR quantitative detection method and equipment (CN119331952A), primarily covering fluorescence image processing and droplet analysis, but does not mention the freezeable premix. Mingchi Biotechnology (Shanghai) Co., Ltd. has obtained a patent for a digital PCR detection method for human NRAS gene mutations (CN113897429B), but similarly does not address the freezeable premix. Summary of the Invention

[0006] Purpose of the invention: The purpose of the present invention is to provide a PCR freeze-dried reagent and a preparation method thereof. The water absorption of the PCR freeze-dried reagent is significantly reduced when exposed to the environment, thereby solving the problem that operations such as subpackaging and capping cannot be performed in a normal environment after leaving the warehouse.

[0007] Technical solution: The digital PCR freeze-dried reagent is obtained by vacuum freeze-drying the PCR reagent, and its components include: 0.05-0.5 U / μL Taq lyophilizable hot start enzyme, 15-50mmol pH 7.8-8.8 Tris-HCl, 25-100mmol KCl, 1-20mmol MgCl2, 30-150mmol (NH4)2SO4, 0.5-8% lyoprotectant, 0.1-5mmol dNTP, 0.1-2mol betaine, 0.1-2% DMSO, 10-250ng / μL BSA, 0.5-2mmol β-mercaptoethanol, 0.1-0.8mol dutp, 0.05-0.1 U / μL UDG, and 0.05-5% stabilizer.

[0008] Furthermore, the Taq lyophilizable hot-start enzyme is lyophilizable without glycerol, and the amount added to the lyophilization reagent is 0.05-0.5 U / μL.

[0009] Furthermore, the stabilizer includes one or more of Tween-20, Tween 80, polyoxyethylene alcohol, PEG6000, PEG8000 or a propylene oxide block polymer.

[0010] Furthermore, the freeze-drying protective agent includes one or more of glycerol, trehalose, sorbitol or mannitol.

[0011] Another aspect of the present invention provides a method for preparing the digital PCR freeze-dried reagent, comprising the following steps: (1) Pre-freeze: 0.05-0.5 U / μL Taq lyophilizable hot start enzyme, 15-50 mmol pH 7.8-8.8 Tris-HCl, 25-100 mmol KCl, 1-20 mmol MgCl2, 30-150 mmol (NH4)2SO4, 0.5-8% lyophilization protectant, 0.1-5 mmold NTP, 0.1-2 mol betaine, 0.1-2% DMSO, 10-250 ng / μL BSA, 0.5-2 mmol β-mercaptoethanol, 0.1-0.8 mol dutp, 0.05-0.1 U / μL UDG and 0.05-5% stabilizer are mixed in proportion to obtain a premixed solution, which is then dripped into liquid nitrogen at a rate of 24-26 μL / drop. The pellets pre-frozen in liquid nitrogen are quickly transferred to a pre-cooled vacuum freeze dryer. The pre-freezing temperature of the vacuum freeze dryer is set to -50±2°C and the duration is 90-180 minutes. (2) Primary drying: divided into two stages: the first stage, the first stage is set to 0.5±0.1℃ / min temperature rise, rise to -45±2℃, after reaching the temperature, the duration is 900-960min, automatically enter the second stage; the second stage is set to -25±2℃, the duration is 50-60min; (3) Secondary drying: It is divided into two stages: In the first stage, the temperature is set at 0.5±0.1℃ / min to 0±2℃, and the duration is 50-60min after reaching the temperature, and it automatically enters the second stage; the temperature of the second stage is set at 30±2℃ and the duration is 250-300min.

[0012] Compared with the prior art, the present invention has the following beneficial effects: 1. The digital PCR lyophilized reagent described in the present invention is prepared by vacuum freeze-drying a PCR reagent. When a polysaccharide is added to the PCR reagent at a mass ratio of 0.1% to 8%, and the resulting PCR lyophilized reagent is exposed to a normal environment, its water absorption is significantly reduced. When the PCR lyophilized reagent without the polysaccharide is exposed to a normal low-humidity environment, the water content increases linearly at a high rate within a short period of time. When the PCR lyophilized reagent with 10% polysaccharide added is exposed to a normal environment, the water content does not change within 1 hour.

[0013] 2. The digital PCR freeze-dried reagents described in this invention can be shipped, packaged, and processed in a standard low-humidity environment without affecting the water content and activity of the biological product. This eliminates the need for strict temperature and humidity control throughout the entire workshop to maintain extremely low temperatures and humidity, significantly reducing energy consumption. Furthermore, custom isolation hoods or glove boxes are no longer necessary. By passing high-purity inert gas through the isolation hoods or glove boxes to reduce humidity, this reduces resource waste, facilitates operation, and significantly improves production efficiency.

[0014] 3. The water-in-oil droplets generated by the digital PCR freeze-dried reagent described herein do not fuse after thermal cycling after reconstitution. Current commercially available digital PCR reagents, after freeze-dried and reconstituted, fuse after high-temperature thermal cycling, severely impacting detection performance. To address this issue, the stabilizer mentioned in claim 1 needs to be added.

[0015] 4. The digital PCR freeze-dried reagent described in the present invention is the first of its kind, and after the freeze-dried reagent is reconstituted and subjected to PCR thermal cycling, the droplets remain stable and no fusion occurs.

[0016] 5. The PCR freeze-dried reagent has significantly reduced water absorption in a normal environment, and can be directly packaged, capped, and operated in a normal low-humidity environment after leaving the warehouse. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 For Example 1; containing 1% polysaccharide premix solution lyophilized; Figure 2 Example 2; containing 3% polysaccharide premixed solution lyophilized; Figure 3 Example 3: containing 6% polysaccharide premix solution freeze-dried; Figure 4 For application example 1; 4X digital PCR premix solution is freeze-dried; Figure 5 It is a droplet amplification after freeze-drying and reconstitution of 4X digital PCR master mix; Figure 6 This is the state of droplet amplification after 4X digital PCR premix solution is freeze-dried and reconstituted; Figure 7 Freeze-dried 4X digital PCR premix containing gene probe, primers and template; Figure 8 The 4X digital PCR master mix containing gene probe, primers and template was freeze-dried and reconstituted for amplification and reading; Figure 9 Comparison of droplet amplification generated by 4X digital PCR cryoprecipitate premix and Bio-Rad master mix. DETAILED DESCRIPTION

[0018] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be further described below.

[0019] Example 1: The specific components of the 4X digital PCR premix are as follows: 0.5 U / μL Taq lyophilizable hot start enzyme, 30 mmol pH 8.8 Tris-HCl, 60 mmol KCl, 6 mmol MgCl2, 36 mmol (NH4)2SO4, 1% polysaccharide, 2 mM dNTP, 0.3 mol betaine, 0.1% DMSO, 80 ng / μL BSA, 0.42 mmol β-mercaptoethanol, 0.5 mol dUTP, 0.06 U / μL UDG, 0.5% PEG6000, and a propylene oxide block polymer compound are added to eight tubes in a row and placed in a Boyikang Pilot2-4M 96-well metal hollow mold for lyophilization. The lyophilization process is shown in the following table:

[0020] The freeze-drying results are as follows Figure 1 .

[0021] Example 2: The specific components of the 4X digital PCR premix are as follows: 0.5 U / μL Taq lyophilizable hot start enzyme, 30 mmol pH 8.8 Tris-HCl, 60 mmol KCl, 6 mmol MgCl2, 36 mmol (NH4)2SO4, 3% polysaccharide, 2 mmole NTP, 0.3 mol betaine, 0.1% DMSO, 80 ng / μL BSA, 0.42 mmol β-mercaptoethanol, 0.5 mol dUTP, 0.06 U / μL UDG, 0.5% PEG6000 and a compound containing a propylene oxide block polymer are added to eight consecutive tubes and placed in a Boyikang Pilot2-4M 96-well metal hollow mold for lyophilization. The process route is as described in the table of the above embodiment, and the lyophilization results are as follows. Figure 2 : Example 3: The specific components of the 4X digital PCR premix are as follows: 0.5 U / μL Taq lyophilizable hot start enzyme, 30 mmol pH 8.8 Tris-HCl, 60 mmol KCl, 6 mmol MgCl2, 36 mmol (NH4)2SO4, 6% polysaccharide, 2 mmold NTP, 0.3 mol betaine, 0.1% DMSO, 80 ng / μL BSA, 0.42 mmol β-mercaptoethanol, 0.5 mol dUTP, 0.06 U / μL UDG, 0.5% PEG6000 and a compound containing a propylene oxide block polymer are added to eight consecutive tubes and placed in a Boyikang Pilot2-4M 96-well metal hollow mold for lyophilization. The process route is as described in the table of the above embodiment, and the lyophilization results are as follows. Figure 3 : Example 4: The specific components of the 4X digital PCR premix are as follows: 0.5 U / μL Taq lyophilizable hot start enzyme, 30 mmol pH 8.8 Tris-HCl, 60 mmol KCl, 6 mmol MgCl2, 36 mmol (NH4)2SO4, 9% polysaccharide, 2 mmole NTP, 0.3 mol betaine, 0.1% DMSO, 80 ng / μL BSA, 0.42 mmol β-mercaptoethanol, 0.5 mol dUTP, 0.06 U / μL UDG, 0.5% PEG6000 and a compound containing a propylene oxide block polymer are added to eight consecutive tubes and placed in a Boyikang Pilot2-4M 96-well metal hollow mold for lyophilization. The process route is as described in the table of the above embodiment, and the lyophilization results are as follows. Figure 3 : Test example: The 4X digital PCR premixes described in the above-mentioned Examples 1, 2, 3, and 4 were freeze-dried in sequence, and then tested for water content using an AKF-1 Karl Fischer moisture analyzer. The test results are shown in the following table:

[0022] As can be seen from the table above, the polysaccharide compound concentration of the 4X digital PCR premix is 6%, and the water content is the lowest.

[0023] The difference between the above-mentioned Example 1, Example 2, Example 3 and Example 4 lies in the different amounts of polysaccharide used.

[0024] Application Example 1: The specific components of 4X digital PCR premix are as follows: 0.5 U / μL Taq lyophilizable hot start enzyme, 30 mmol PH 8.8 Tris-HCl, 60 mmol KCl, 6 mmol MgCl2, 36 mmol (NH4)2SO4, 6% polysaccharide, 2 mmol dNTP, 0.3 mol betaine, 0.1% DMSO, 80 ng / μL BSA, 0.42 mmol β-mercaptoethanol, 0.5 mol dUTP, 0.06 U / μL UDG, 0.5% PEG6000 and a compound containing propylene oxide block polymer are added to eight rows of tubes and placed in a Boyikang Pilot2-4M 96-well metal hollow mold for freeze-drying. The freeze-drying results are shown in the figure below. After adding 20μL of sterile enzyme-free water to each tube in the eight rows and reconstituted, droplets were generated on the Yongnuo platform MicroDropt-100B and heated for amplification. After amplification, the droplets did not fuse and were uniform in size. Figure 4 、 5 、6.

[0025] Application Example 2: The specific components of the 4X digital PCR premix are as follows: EGFR gene upper and lower primers and template, 0.5U / μL Taq lyophilizable hot start enzyme, 30mmol pH 8.8 Tris-HCl, 60mmol KCl, 6mmol MgCl2, 36mmol (NH4)2SO4, 6% polysaccharide, 2mM dNTP, 0.3mol betaine, 0.1% DMSO, 80ng / μL BSA, 0.42mmol β-mercaptoethanol, 0.5mol dUTP, 0.06U / μL UDG, 0.5% PEG6000, and a compound containing a propylene oxide block polymer were added to eight tubes in a row and placed in a Boyikang Pilot2-4M 96-well metal hollow mold for lyophilization. The lyophilization results are shown in the figure below. The specific addition amounts are described in the table below.

[0026] After adding 20 μL of sterile enzyme-free water to each tube in the eight-row row and reconstituted, droplets were generated and amplified on the Yongnuo platform MicroDropt-100B. The results are as follows: Figure 7 As shown:

[0027] Figure 8 This showed that reconstitution of the frozen pre-mixed solution did not affect the gene amplification performance.

[0028] Upstream primer: CTCTCTGTCATAGGGACTCTGGA Downstream primer: CACATCGAGGATTTCCTTGTTG Probe 1:AGAAAGTTAAAATTCCCGTCGCTATCA Comparative Case 1: Bio-Rad premixed solution No. 1863023 was freeze-dried according to the freeze-drying process in Example 1. After freeze-drying and reconstitution, droplets were generated and amplified on the Yongnuo QX200 digital PCR platform. After amplification, the droplet micromorphology was observed using a high-speed camera. The droplets were compared with the droplets described in the application case. Figure 9 .

[0029] In summary, after the digital PCR premix solution of the present invention is freeze-dried, reconstituted and amplified, the droplet morphology is observed under a high-speed camera, which shows uniformity and no fusion. After the digital PCR premix solution of the present invention is freeze-dried, reconstituted and amplified, the droplet morphology is observed under a high-speed camera, which shows fusion of the droplets.

[0030] As mentioned above, a comparison of the moisture content of freeze-dried pellets containing three different polysaccharide concentrations exposed to a 50% humidity environment revealed a significant decrease in moisture content after the addition of polysaccharide. Furthermore, the moisture content decreased with increasing polysaccharide concentration. EGFR gene upper and lower primers and template were freeze-dried together with 4X digital PCR premix, reconstituted, and then amplified and read using the Yongnuo MicroDropt-100B platform. The amplified droplets showed no fusion and were uniform in size. The theoretical copy number was consistent with the actual copy number after readout.

[0031] Under normal production conditions, a freeze dryer can freeze-dry approximately 800 PCR tubes, and operations such as unloading, subpackaging, and capping can be completed in a very short time. The above experimental results show that adding a certain amount of polysaccharide to the PCR freeze-dried reagent can significantly reduce its water absorption when exposed to the environment. Within a short period of time, the water content is no different from that at unloading. Furthermore, unloading, subpackaging, and capping in a normal low-humidity environment have no significant effect on the water content of the PCR freeze-dried reagent, and it can meet factory standards.

[0032] The above description is merely a preferred embodiment of the present invention and does not limit the present invention in any way. Any person skilled in the art who, without departing from the scope of the present invention, makes any equivalent substitution, modification, or other changes to the technical solution and technical content disclosed in the present invention shall be deemed to be within the scope of the present invention and still fall within the scope of protection of the present invention.

Claims

1. A digital PCR freeze-dried reagent, characterized in that: The PCR lyophilized reagent is obtained by vacuum freeze-drying the PCR reagent, and the components include: 0.05-0.5 U / μL Taq lyophilizable hot start enzyme, 15-50 mmol pH 7.8-8.8 Tris-HCl, 25-100 mmol KCl, 1-20 mmol MgCl2, 30-150 mmol (NH4)2SO4, 0.5-8% lyoprotectant, 0.1-5 mmol dntp, 0.1-2 mol betaine, 0.1-2% DMSO, 10-250 ng / μL BSA, 0.5-2 mmol β-mercaptoethanol, 0.1-0.8 mol dutp, 0.05-0.1 U / μL UDG, and 0.05-5% stabilizer.

2. The digital PCR freeze-dried reagent according to claim 1, characterized in that The Taq lyophilizable hot start enzyme is lyophilizable without glycerol.

3. The digital PCR freeze-dried reagent according to claim 1, characterized in that The stabilizer includes one or more of Tween-20, Tween 80, polyoxyethylene alcohol, PEG6000, PEG8000 or a propylene oxide block polymer.

4. The digital PCR freeze-dried reagent according to claim 1, characterized in that The freeze-drying protective agent includes one or more of glycerol, trehalose, sorbitol or mannitol.

5. The method for preparing the freeze-dried digital PCR reagent according to any one of claims 1 to 4, characterized in that: The steps include: (1) Pre-freeze: 0.05-0.5 U / μL Taq lyophilizable hot start enzyme, 15-50 mmol pH 7.8-8.8 Tris-HCl, 25-100 mmol KCl, 1-20 mmol MgCl2, 30-150 mmol (NH4)2SO4, 0.5-8% lyophilization protectant, 0.1-5 mmol dNTP, 0.1-2 mol betaine, 0.1-2% DMSO, 10-250 ng / μL BSA, 0.5-2 mmol β-mercaptoethanol, 0.1-0.8 mol dUTP, 0.05-0.1 U / μL UDG and 0.05-5% stabilizer are mixed in proportion to obtain a premixed solution, which is then dropped into liquid nitrogen at a rate of 24-26 μL / drop. The pellets pre-frozen in liquid nitrogen are quickly transferred to a pre-cooled vacuum freeze dryer. The pre-freezing temperature of the vacuum freeze dryer is set to -50±2°C and the duration is 90-180 minutes. (2) Primary drying: divided into two stages: the first stage, the first stage is set to 0.5±0.1℃ / min temperature rise, rise to -45±2℃, after reaching the temperature, the duration is 900-960min, automatically enter the second stage; the second stage is set to -25±2℃, the duration is 50-60min; (3) Secondary drying: It is divided into two stages: In the first stage, the temperature is set at 0.5±0.1℃ / min to 0±2℃, and the duration is 50-60min after reaching the temperature, and it automatically enters the second stage; the temperature of the second stage is set at 30±2℃ and the duration is 250-300min.

6. Use of the lyophilized reagent according to any one of claims 1 to 4 in PCR.

Images