Pirna markers for diagnosing assessment of sepsis cardiomyopathy, kits and applications thereof

Abstract

The application discloses a kind of detection piRNA marker's material and application, including one or more of the following applications: A1) in the application in preparation diagnosis sepsis cardiomyopathy product;A2) in the application in preparation screening sepsis cardiomyopathy product;A3) in the application in preparation sepsis cardiomyopathy condition evaluation product;PiRNA marker is hsa_piR_019301, nucleotide sequence is as shown in SEQ ID No.1.The hsa_piR_019301 marker provided by the application is significantly increased in the expression amount in the plasma of sepsis cardiomyopathy patient compared with healthy control, indicating that hsa_piR_019301 is a potential sepsis cardiomyopathy biomarker.The ROC curve of the efficiency in diagnosing sepsis cardiomyopathy patient shows that hsa_piR_019301 has good diagnostic efficiency.

Description

TECHNICAL FIELD

[0001] The present application relates to a marker for diagnosing sepsis cardiomyopathy, in particular a piRNA marker, and also relates to a kit for detecting the piRNA marker and its application, belonging to the field of medical molecular diagnosis. BACKGROUND

[0002] Since 2016, sepsis has been defined as a life-threatening organ dysfunction caused by a dysregulated host response to infection. When the inflammatory state persists, it can lead to severe organ damage, among which sepsis cardiomyopathy is a systemic disease that has a very serious impact on the health of patients. Sepsis cardiomyopathy was first described in 1921 by E. Romberg in his textbook of heart and vascular diseases as infectious acute myocarditis (septic acute myocarditis), when antibiotics had not yet been invented. Infection can cause a dysregulated host response, which in turn leads to organ dysfunction, disability and even death. In this case, infusion of vasopressin is usually required to maintain blood pressure. The mortality rate of sepsis patients is about 10%, while the mortality rate of sepsis cardiomyopathy patients is usually more than 40%. Progressive cardiovascular dysfunction is usually the last stage of infectious shock, and given the central role of circulatory disorders in the destruction of multiple organ functions, it is particularly important to understand cardiac dysfunction in sepsis.

[0003] How to improve the early diagnostic ability of sepsis cardiomyopathy has always been an important topic in the field of cardiovascular disease research. The commonly used methods for clinically evaluating cardiac function include echocardiography and electrophysiological testing, but these methods can only detect abnormalities when the heart has organic changes and the function has decreased significantly. In addition, the currently commonly used biomarkers in clinical practice are mostly protein biomarkers, such as cardiac troponin (cTnI), creatine kinase isoenzyme (CK-MB) and myoglobin (Myo), etc. These markers are released by myocardial cells when myocardial damage occurs. However, these protein biomarkers have certain limitations, for example, their elevation needs to be detected after a certain period of time, so they cannot meet the needs of early diagnosis of sepsis cardiomyopathy.

[0004] With the continuous progress of high-throughput sequencing technology, piwi-interacting RNA (piRNA) has gradually attracted great interest of researchers. piRNA is a kind of small non-coding RNA with a length of 24-31 nucleotides (nt), which can be divided into three groups according to its source: messenger RNA (mRNA)-derived piRNA, transposon-derived piRNA and long non-coding RNA (lncRNA)-derived piRNA. piRNA binds to PIWI protein to form a piRNA / PIWI silencing complex, which regulates various physiological and pathological activities at the transcriptional and post-transcriptional levels in somatic and germinal tissues of different organisms. At the transcriptional level, PIWI protein and piRNA can modify histone and chromatin methylation, which is an essential epigenetic modification. At the post-transcriptional level, piRNA is involved in regulating gene and protein expression, genome rearrangement, spermatogenesis and transposon silencing (TEs). Based on these characteristics of piRNA, it is expected to become a new diagnostic biomarker for septic cardiomyopathy, providing new possibilities for early diagnosis and treatment. SUMMARY

[0005] The primary technical problem to be solved by the present application is to provide a new application of a piRNA marker, which can be used for diagnosis, screening, as a therapeutic target, septic cardiomyopathy condition assessment and distinguishing septic cardiomyopathy from other disease materials.

[0006] Another technical problem to be solved by the present application is to provide a kit for detecting a new piRNA marker, which can be used for diagnosis, screening, as a therapeutic target, septic cardiomyopathy condition assessment and distinguishing septic cardiomyopathy from other diseases.

[0007] Still another technical problem to be solved by the present application is to provide a primer for detecting a new piRNA marker.

[0008] To achieve the above technical purposes, the present application adopts the following technical solutions:

[0009] According to a first aspect of an embodiment of the present application, there is provided an application of a substance for detecting a piRNA marker, including one or more of the following applications:

[0010] A1) application in preparing a product for diagnosing septic cardiomyopathy;

[0011] A2) application in preparing a product for screening septic cardiomyopathy;

[0012] A3) application in preparing a product for treating septic cardiomyopathy;

[0013] A4) application in preparing a product for assessing the condition of septic cardiomyopathy;

[0014] A5) use in the manufacture of a product for differentiating sepsis cardiomyopathy from other diseases;

[0015] The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown as SEQ ID No. 1.

[0016] The "product" described above can be a product for diagnosing sepsis cardiomyopathy by detecting the expression level of hsa_piR_019301 through RT-PCR, real-time quantitative PCR, in situ hybridization, a chip, or a high-throughput sequencing platform.

[0017] In the above application, the expression of hsa_piR_019301 in the plasma sample of a sepsis cardiomyopathy patient is significantly up-regulated; the expression level of hsa_piR_019301 in a healthy population is significantly lower than that in a sepsis cardiomyopathy patient.

[0018] More preferably, the substance is a substance for detecting the expression level of hsa_piR_019301, or a reagent specifically recognizing hsa_piR_019301, or a reagent for detecting the content of hsa_piR_019301.

[0019] More preferably, the substance is a substance for detecting hsa_piR_019301, specifically a), b), or c) as follows

[0020] a) a primer for detecting or specifically recognizing hsa_piR_019301;

[0021] b) a reagent set containing the a);

[0022] c) a kit containing the a) or the b).

[0023] More preferably, the primer is an upstream primer shown as SEQ ID No. 2 and a downstream primer shown as SEQ ID No. 3.

[0024] According to a second aspect of the embodiment of the present application, a kit for detecting a piRNA marker is provided, and the kit comprises one or more of the following applications:

[0025] A1) use in the manufacture of a product for diagnosing sepsis cardiomyopathy;

[0026] A2) use in the manufacture of a product for screening sepsis cardiomyopathy;

[0027] A3) use in the manufacture of a product for treating sepsis cardiomyopathy;

[0028] A4) use in the manufacture of a product for evaluating the condition of sepsis cardiomyopathy;

[0029] A5) use in the manufacture of a product for differentiating sepsis cardiomyopathy from other diseases;

[0030] The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown as SEQ ID No. 1; the kit comprises reagents for detecting or specifically recognizing hsa_piR_019301, or reagents for detecting the expression amount of hsa_piR_019301.

[0031] By using the kit provided in the application, the expression of the hsa_piR_019301 characteristic gene sequence shown as SEQ ID No. 1 in the peripheral blood of the subject can be detected, and then the probability of sepsis cardiomyopathy of the subject is determined according to the information of up-regulation or down-regulation of the gene expression, so as to realize the diagnosis and screening of sepsis cardiomyopathy.

[0032] The kit provided in the application can comprise appropriate packaging and instructions for use in the methods disclosed in the application. The detection kit provided in the application is a nucleic acid detection kit, which comprises reagents required for RNA extraction and real-time fluorescent quantitative PCR (qRT-PCR). The kit can further comprise appropriate buffers and polymerases, and can also comprise control primers and / or probes.

[0033] Preferably, the reagent for detecting or specifically recognizing hsa_piR_019301 is a specific primer, and the specific primer is an upstream primer shown as SEQ ID No. 2 and a downstream primer shown as SEQ ID No. 3.

[0034] According to a third aspect of the embodiments of the application, a primer for detecting a piRNA marker is provided, and the primer comprises one or more of the following applications:

[0035] A1) use in the manufacture of a product for diagnosing sepsis cardiomyopathy;

[0036] A2) use in the manufacture of a product for screening sepsis cardiomyopathy;

[0037] A3) use in the manufacture of a product for treating sepsis cardiomyopathy;

[0038] A4) use in the manufacture of a product for evaluating the condition of sepsis cardiomyopathy;

[0039] A5) use in the manufacture of a product for differentiating sepsis cardiomyopathy from other diseases;

[0040] The primer is a primer for detecting the expression amount of hsa_piR_019301 or specifically recognizing hsa_piR_019301.

[0041] More preferably, the primers are an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present application has the following technical effects:

[0043] (1) The present application provides a piRNA marker hsa_piR_019301, which can be used as a diagnostic tool for sepsis cardiomyopathy. Clinical verification tests show that the expression level of hsa_piR_019301 in the plasma of sepsis cardiomyopathy patients is significantly higher than that of healthy controls, which indicates that hsa_piR_019301 is a potential biomarker for early diagnosis of sepsis cardiomyopathy.

[0044] (2) Further analysis shows that the efficiency of hsa_piR_019301 in diagnosing sepsis cardiomyopathy patients is verified by ROC curve, and both the sensitivity and specificity are excellent, indicating that the marker has good diagnostic efficiency. In addition, compared with traditional cardiac troponin I (cTnI), hsa_piR_019301 shows higher accuracy in predicting the 28-day mortality rate of sepsis cardiomyopathy patients, which suggests that it may have greater value in clinical application.

[0045] (3) In clinical experiments, it was found that the expression level of hsa_piR_019301 in the plasma of patients was positively correlated with CK-MB and interleukin 6 (IL-6). CK-MB is a marker of myocardial cell damage, and IL-6 reflects the inflammatory response of myocardial cells and the whole body. The combined detection of the two can reflect the severity of sepsis cardiomyopathy, and the correlation of the expression level of hsa_piR_019301 with these indicators indicates that its plasma level can effectively reflect the severity of the disease.

[0046] (4) In in vitro cell experiments, the expression change of hsa_piR_019301 was verified by AC16 myocardial cell model treated by lipopolysaccharide (LPS). The results showed that after simulating sepsis stimulation, the expression level of hsa_piR_019301 in myocardial cells increased significantly, which provided a cell molecular basis for the marker as a diagnostic tool.

[0047] (5) Finally, the impact of knocking down hsa_piR_019301 was also verified by cytological experiments. The experiments showed that knocking down hsa_piR_019301 could reduce the expression levels of CK-MB and IL-6, and alleviate the damage of sepsis cardiomyocytes. In addition, the LPS-induced increase in the expression of hsa_piR_019301 and the increase in cell death were significantly improved after knocking down the marker, which indicated that hsa_piR_019301 was not only an effective diagnostic marker, but also a potential therapeutic target for sepsis cardiomyopathy. BRIEF DESCRIPTION OF DRAWINGS

[0048] Figure 1 Volcano plot of piRNA expression difference between sepsis cardiomyopathy cell model and normal control for sequencing LPS-induced AC16 cardiomyocytes;

[0049] Figure 2 Determination of hsa_piR_019301 content in plasma of sepsis cardiomyopathy patients and normal controls by qRT-PCR method;

[0050] Figure 3 ROC curve of hsa_piR_019301 in diagnosing sepsis cardiomyopathy patients;

[0051] Figure 4 ROC curve of hsa_piR_019301 and cTnI in predicting 28-day mortality of sepsis cardiomyopathy patients in external validation cohort;

[0052] Figure 5A Relationship between CK-MB and hsa_piR_019301 expression in patients;

[0053] Figure 5B Relationship between IL-6 and hsa_piR_019301 expression in patients;

[0054] Figure 6 Relationship between the proportion of dead cells in LPS-induced cardiomyocytes and the expression of hsa_piR_019301;

[0055] Figure 7A hsa_piR_019301 expression graph after transfection of AC16 cardiomyocytes with small interfering RNA (siRNA) of hsa_piR_019301;

[0056] Figure 7B mRNA expression graph after transfection of AC16 cardiomyocytes with siRNA of hsa_piR_019301;

[0057] Figure 8AExpression of LPS-induced myocardial cell CM-MB after siRNA knockdown of hsa_piR_019301 in AC16 myocardial cells;

[0058] Figure 8B Expression of LPS-induced myocardial cell IL-6 after siRNA knockdown of hsa_piR_019301 in AC16 myocardial cells;

[0059] Figure 9 Change in the proportion of myocardial cell death after knockdown of hsa_piR_019301 and control AC16 myocardial cells after LPS treatment. DETAILED DESCRIPTION

[0060] The application will be further described below in conjunction with specific examples. These examples are only used to illustrate the application and are not used to limit the scope of the application. The experimental methods in the following examples are not specified, and are generally performed according to conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as understood by those skilled in the art. In addition, any method and material similar or equivalent to those described can be used in the present application. The preferred methods and materials described herein are only used as an example.

[0061] First, total RNA was extracted from 3 cases of LPS-induced AC16 myocardial cells and 3 cases of normal control cells, and then sent to Guangzhou Epigenetic Company for piRNA sequencing to screen piRNAs with significant differences in expression (Fold change≥2.0, P value<0.05). Then, qRT-PCR was used to determine the content of the top 10 piRNAs in the patient's plasma, and the first one with significant increase was used for subsequent experiments. Then, the inventors used in vitro experimental cell level to verify the relationship between the expression of hsa_piR_019301 and septic cardiomyopathy again, and the specific data are as follows.

[0062] Example 1 Screening of sepsis cardiomyopathy piRNA markers and correlation study

[0063] 1. Clinical samples:

[0064] Patients with sepsis and septic shock admitted to the Department of Critical Care Medicine of the General Hospital of the People's Liberation Army from 2020 to 2023 were collected, and were divided into non-septic cardiomyopathy group (50 cases) and septic cardiomyopathy group (50 cases) according to whether septic cardiomyopathy occurred.

[0065] Alternative Xie Fu Hospital external verification cohort (2022-2023): non-septic cardiomyopathy group (45 cases) and septic cardiomyopathy group (44 cases). Blood samples and related laboratory results were taken. The diagnostic criteria for septic cardiomyopathy: PiCCO monitoring of left ventricular stroke work index in patients (indicating decreased myocardial contractility) and clinical exclusion of coronary artery obstruction.

[0066] Inclusion criteria: ①Compliance with the 2016 American College of Critical Care Medicine and European Society of Critical Care Medicine joint release of sepsis 3.0 definition and diagnostic criteria: sepsis-related sequential organ failure score acute change ≥2 points; ②Sepsis shock diagnostic criteria: persistent hypotension in sepsis patients after adequate fluid resuscitation, requiring vasoactive drugs to maintain mean arterial pressure ≥65 mmHg and serum lactate level ≥2 mmol / L.

[0067] Exclusion criteria: ①Age less than 18 years or more than 70 years old; ②Complicated with acute myocardial infarction, myocarditis, cardiomyopathy, valvular heart disease, cardiopulmonary resuscitation, electric defibrillation and electric cardioversion, cardiac surgery; ③Pregnancy, lactation, tumor, extensive burns, human immunodeficiency virus (HIV) infection, long-term use of immunosuppressants; ④Length of stay in ICU <24h; ⑤Clinical data not collected within 6h of admission; ⑥Give up treatment or automatic discharge.

[0068] 2. Plasma extraction:

[0069] Human peripheral blood was collected using EDTA anticoagulation blood collection tubes, centrifuged at 2500g for 15min, and the upper plasma was transferred to 2ml sterile tubes and stored in a -80℃ freezer.

[0070] 3. RNA extraction and qRT-PCR:

[0071] 3.1. RNA extraction

[0072] Total RNA was extracted from plasma using RNA simple Total RNA Kit (DP419, TIANGEN). Add 1ml TRIZOL Reagent and 200u1 chloroform to the plasma, shake for 20s, and let stand at room temperature for 10min: 13000rpm, 4℃ centrifuge for 15min. Carefully aspirate the supernatant, add 800u1 isopropanol, invert gently, and let stand at -20℃ for 1h, 13000rpm, 4℃ centrifuge for 15min, and discard the supernatant. Add 1ml 75% ethanol, gently wash the precipitate, and remove the supernatant after 4℃ centrifugation at 13000rpm for 5min. Blow dry. Add appropriate amount of enzyme-free water, 65℃ promote 10min, detect the OD value and concentration of RNA, and store at -80℃ for standby.

[0073] 3.2. RNA reverse transcription to synthesize cDNA

[0074] 500ng of RNA was reverse transcribed into cDNA using reverse transcription kit (Takara RR037A). 3.3. Reverse transcription of piRNA:

[0075] Each reaction system was 20u1, and the following table was used:

[0076] Table 1

[0077]

[0078] 3.4. Reverse transcription of mRNA:

[0079] Each reaction system was 20u1, and the following table was used:

[0080] Table 2

[0081]

[0082] The reaction procedure was as follows: 37℃ for 45min, 85℃ for 5min, and 4℃ for maintenance.

[0083] 3.5. qRT-PCR

[0084] The piRNA primer sequence was designed according to the principle of piRNA primer design. The cDNA obtained by reverse transcription was diluted 1:10, and the following qRT-PCR reaction was performed.

[0085] Each reaction system was 20u1, and the following table was used:

[0086] Table 3

[0087]

[0088] The reaction solution was mixed, and the Real-time PCR instrument reaction procedure was as follows:

[0089] Stage 1: 95℃ for 2min;

[0090] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;

[0091] Stage 3: 95℃ for 15s, 60℃ for 1min, 95℃ for 5s;

[0092] The relative level of each mRNA was quantified by GAPDH, and expressed as a relative ratio.

[0093] 4. piRNA sequencing analysis:

[0094] Total RNA was extracted from 3 cases of LPS-induced AC16 cardiomyocytes and 3 cases of normal control cells and sent to Guangzhou Epigenetic Company for piRNA sequencing. The piRNA with significant difference in expression (Fold change ≥ 2.0, P value < 0.05) was screened, and the content of the top 10 piRNA results in the patient's plasma was determined by qRT-PCR. The first one with significant increase was taken for subsequent experiments. Figure 1 Table 4 is the top 10 piRNA with up-regulated expression obtained by sequencing, and hsa_piR_019301 with the highest expression was taken for subsequent experiments.

[0095] Table 4 is the top 10 piRNA with up-regulated expression obtained by sequencing

[0096]

[0097] 5. ROC curve drawing:

[0098] The receiver operator characteristic curve (ROC curve) is a curve obtained by plotting the true positive rate and the false positive rate. It can be used to reflect the relationship between sensitivity and specificity. It is a series of cutoff values divided according to the measured values of the test group and the control group, and the sensitivity and specificity are calculated respectively, and the given points are connected into a line, which is the ROC curve. GraphPad Prism software is used to draw the ROC curve. The ROC curve reflects the diagnostic performance of the marker for the disease.

[0099] 6. Statistical analysis:

[0100] T test and variance analysis are used for normal variables, and Mann Whitney U test and Kruskal Wallis test are used for non-normal variables. R software (v 3.4.2) and GraphPad Prism (9.1.0) software are used for statistical analysis. Biological repeats are shown as single data points superimposed on the column chart. P < 0.05 is considered to have significant difference.

[0101] 7. Experimental results:

[0102] For example Figure 2As shown, the content of hsa_piR_019301 in the plasma of patients with sepsis cardiomyopathy was determined by qRT-PCR. The results showed that the expression of hsa_piR_019301 in the plasma of patients with sepsis cardiomyopathy was significantly higher than that in the plasma of healthy controls, indicating that hsa_piR_019301 is a potential biomarker for sepsis cardiomyopathy.

[0103] As shown in FIG. 6, the ROC curve of the diagnostic efficiency of hsa_piR_019301 in patients with sepsis cardiomyopathy; hsa_piR_019301 has good diagnostic sensitivity and specificity, indicating that hsa_piR_019301 has good diagnostic efficiency. Figure 3

[0104] cTnI is a myocardial-specific protein mainly present in myocardial cells and is currently recognized as the most sensitive and specific biomarker for myocardial injury. In sepsis patients, due to the combined effects of various factors such as inflammatory factors, oxidative stress, and microcirculation disorders, myocardial cell damage can occur, leading to elevated cTnI levels. Studies have shown that elevated cTnI in sepsis patients is closely related to prognosis. The higher the cTnI level, the higher the mortality rate of patients, and it can be used as an independent risk factor for evaluating the prognosis of sepsis cardiomyopathy. The mortality rate of sepsis patients with elevated cTnI is 2-3 times that of normal patients. In addition, cTnI also has early warning value, which can increase at an early stage of myocardial injury, helping to early detect sepsis cardiomyopathy and timely intervention treatment. Therefore, cTnI can not only be used for the diagnosis of sepsis cardiomyopathy, but more importantly, it can be used as an important indicator for predicting patient prognosis.

[0105] As shown in FIG. 7, the external validation cohort verified the diagnostic efficiency of hsa_piR_019301, and ROC curve analysis showed that the new biomarker hsa_piR_019301 and the traditional marker cTnI both showed good predictive value, with areas under the ROC curve (AUC) of 0.8804 and 0.8468, respectively. Compared with cTnI, hsa_piR_019301 has higher predictive accuracy, suggesting that it may become a potential new marker for predicting the 28-day mortality rate of sepsis cardiomyopathy patients. Figure 4

[0106] Example 2 Relationship between CK-MB and IL-6 and expression amount of hsa_piR_019301

[0107] 1. Background:

[0108] ​​CK-MB is an important myocardial enzyme index. It has a high content in myocardial cells, especially in the myocardium, which mainly contains CK-MB, generally accounting for 14% to 42% of total CK, and is the main diagnostic indicator of acute myocardial infarction. The increase of CK-MB can reflect the degree of myocardial cell damage, and its change is earlier than the total activity change of creatine kinase, so it plays an important role in the early diagnosis of acute myocardial infarction. The increase of CK-MB can be used as one of the diagnostic criteria for acute myocardial infarction, and generally the increase of creatine kinase isoenzyme CK-MB more than 3 times has clinical significance. In the process of acute myocardial infarction, CK-MB generally begins to rise 3 to 6 hours after the onset, reaches a peak 12 to 24 hours, and returns to normal 2 to 3 days. In addition, the increase of CK-MB can also be seen in myocarditis, heart surgery, pericarditis, muscle dystrophy, polymyositis, muscle atrophy, crush injury, etc., and even intramuscular injection may also cause its increase. The normal value range of CK-MB detected by immunosuppression method is 0 to 25 U / L, and the increase indicates the presence of myocardial damage. Therefore, the detection of CK-MB has important significance for the diagnosis and treatment of myocardial related diseases.

[0109] IL-6, as an inflammatory factor, is rapidly produced in the process of acute inflammatory reaction in surgical operation, stress reaction, brain death, tumor occurrence and other conditions. As an infection marker, IL-6 has a wide application in auxiliary diagnosis, efficacy observation and prognosis. The increase of IL-6 is positively correlated with the severity of the disease, and the increase amplitude reflects the severity of the disease, especially when the whole body is infected, the increase is more obvious, which indicates that the patient has a high risk of developing sepsis. Under normal circumstances, the IL-6 level of normal people should be less than 7 pg / mL.

[0110] 2. Experimental method:

[0111] CK-MB and IL-6 assays: Plasma or cell supernatant were measured using the ZC-34224 and ZC-32446 creatine kinase isoenzyme (CK-MB) EILSA assay kits from ZC Biotech. First, add 100 μL of standard or test sample to each well. Equilibrate the kits to room temperature for 30 min. Then, remove the required strips from the foil pouch, and seal the remaining strips in a resealable bag and return them to 4°C. Add 50 μL of different concentrations of standard to each standard well. Add 50 μL of the test sample to each sample well; do not add any to the blank wells. Except for the blank wells, add 100 μL of horseradish peroxidase (HPP)-labeled detection antibody to each standard and sample well. Seal the reaction wells with sealing film and incubate at 37°C in a water bath or incubator for 60 min. Discard the liquid, blot dry on absorbent paper, add 350 μL of washing buffer to each well, let stand for 1 minute, shake off the washing buffer, blot dry on absorbent paper, and repeat this washing process 5 times (or a plate washer can be used). Add 50 μL each of substrate A and B to each well, and incubate at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well, and within 15 minutes, measure the OD value of each well at a wavelength of 450 nm.

[0112] 3. Experimental Results:

[0113] like Figure 5A As shown, this illustrates the relationship between plasma CK-MB and hsa_piR_019301 expression levels in patients with septic cardiomyopathy; Figure 5B The figure shows the relationship between plasma IL-6 and hsa_piR_019301 expression levels in patients with septic cardiomyopathy. The figure reveals a positive correlation between CK-MB, IL-6, and hsa_piR_019301 expression. CK-MB and IL-6 are marker proteins of heart failure, and hsa_piR_019301 levels are positively correlated with CK-MB and IL-6 levels. Having ruled out other causes, the patient's myocardial inflammation and damage are considered to be related to sepsis. These results confirm that plasma hsa_piR_019301 levels can reflect the severity of the disease.

[0114] Example 3 In vitro experimental cell level verification of relationship between expression amount of hsa_piR_019301 and sepsis cardiomyopathy Figure 6

[0115] 1. Cell culture:

[0116] Human cardiomyocyte line (AC16) was purchased from Wuhan Pronosai Co., Ltd. Cells were cultured in RPMI-1640 medium with 10% fetal bovine serum in a 5% carbon dioxide incubator at 37°C.

[0117] siRNA knockdown method: siRNA was ordered from Thermo Fisher Scientific. According to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was measured by qRT-PCR after 24 hours of induction.

[0118] 2. Preparation of sepsis cardiomyopathy cell model:

[0119] The cultured AC16 myocardial cells were exposed to 10 mM LPS for cell induction treatment. LPS is a component of the outer wall of the cell wall of Gram-negative bacteria, which is a substance composed of lipids and polysaccharides (glycolipids). After 24 hours of LPS induction of myocardial cells, similar injury pathological changes to sepsis myocardial cells can occur in physiological and biochemical changes. This method is internationally recognized as a sepsis myocardial cell model. The levels of piRNA in the cells and CK-MB and IL-6 in the cell supernatant were compared with those in the control group of myocardial cells.

[0120] 3. qRT-PCR method same as Example 1.

[0121] 4. Plasma CK-MB and IL-6 same as Example 2.

[0122] 5. Cell death rate determination

[0123] The cell death rate was determined using the Cell-Live / Dead Staining Kit (PF00007) of Protein Science. 2 μM Calcein AM and 4.5 μM PI staining working solution were taken out and allowed to recover to room temperature. 30 μL Calcein AM and 4.5 μL PI staining working solution were mixed with 10 ml PBS or other serum-free buffer or culture medium, and vortexed to mix well. The cells were washed with PBS buffer for 2-3 times to remove the residual esterase activity. The PBS solution was aspirated and a sufficient amount of Calcein AM / PI staining working solution was added. Incubate at room temperature for 15-20 minutes in the dark. Observe the positive cells under a fluorescence microscope.

[0124] 6. Experimental results:

[0125] As shown in Figure 7A , the expression level of hsa_piR_019301 in LPS-induced AC16 myocardial cells has a good correlation with the cell death rate, indicating that hsa_piR_019301 has good diagnostic efficiency.

[0126] Figure 7B After transfecting AC16 myocardial cells with siRNA of hsa_piR_019301, the expression of hsa_piR_019301 was reduced, Figure 8A showed that the total amount of mRNA was unchanged after hsa_piR_019301 knockdown; indicating successful transfection, and the subsequent experiments were completed on this basis.

[0127] Figure 8BAfter the AC16 myocardial cells are transfected with the siRNA of hsa_piR_019301, the expression of the sepsis cardiomyopathy related cell damage marker CK-MB (reflecting myocardial cell damage) in the myocardial cells is detected; Figure 9 After the AC16 myocardial cells are transfected with the siRNA of hsa_piR_019301, the expression of the sepsis cardiomyopathy related cell damage marker IL-6 (reflecting myocardial cell inflammation) in the myocardial cells is detected; it can be seen that the expression of CK-MB and IL-6 is reduced after hsa_piR_019301 is knocked down, indicating that knocking down hsa_piR_019301 can reduce the damage of sepsis myocardial cells, and hsa_piR_019301 can be used as a therapeutic target of sepsis cardiomyopathy.

[0128] Example 4 Sequences, primers and kit compositions involved in the present application The relationship between the expression amount of hsa_piR_019301 and the proportion of myocardial cell death of the AC16 myocardial cells after hsa_piR_019301 is knocked down and the control group is treated by LPS, and the results show that LPS induction can cause the expression of hsa_piR_019301 to increase and the cell death to increase, and the proportion of myocardial cell death is reduced after hsa_piR_019301 is knocked down. This is the basis for hsa_piR_019301 as a therapeutic molecular target of sepsis cardiomyopathy.

[0129] The above implementation results show that hsa_piR_019301 has a significant correlation with sepsis cardiomyopathy, and is a new biological marker of sepsis cardiomyopathy; the ROC curve shows that hsa_piR_019301 has good ability to diagnose sepsis cardiomyopathy patients; hsa_piR_019301 is up-regulated in myocardial cells treated by the induction reagent LPS; it is indicated that hsa_piR_019301 can be involved in the damage of myocardial cells by LPS. In summary, hsa_piR_019301 is expected to become a new diagnostic biomarker and therapeutic target of sepsis cardiomyopathy.

[0130] ​

[0131] The nucleotide sequence of the sepsis cardiomyopathy marker hsa_piR_019301 provided by the application is shown in SEQ ID No. 1, which is derived from the piRbase database, and the number is piR-hsa-019301.

[0132] SEQ ID No. 1: TGGGCAGTTGGTTTGGATGACTTGGCTGCCA

[0133] The application provides a primer pair for specifically recognizing hsa_piR_019301, wherein the upstream primer is shown as SEQ ID No. 2, and the downstream primer is shown as SEQ ID No. 3.

[0134] SEQ ID No. 2: TGGGCAGTTGGTTTGGATG

[0135] SEQ ID No. 3:

[0136] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGCAGC

[0137] The kit provided by the application comprises the following components:

[0138] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primer, RNase-free water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primer (F+R) (10 μM), ROX reference dye (50x).

Claims

1. Use of a reagent for detecting a piRNA marker, characterized in that One or more of the following applications: A1) use in the preparation of a product for diagnosing sepsis cardiomyopathy; A2) use in the preparation of a product for screening sepsis cardiomyopathy; A3) use in the preparation of a product for assessing the condition of sepsis cardiomyopathy; The piRNA marker is hsa_piR_019301, and the nucleotide sequence is shown as SEQ ID No.

1.

2. The use of claim 1, wherein: The product is a product for diagnosing sepsis cardiomyopathy by detecting the expression level of hsa_piR_019301 through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use of claim 1, wherein: The reagent is a reagent for detecting the expression amount of hsa_piR_019301, or a reagent for detecting the content of hsa_piR_019301.

4. The use according to claim 1, characterized in that The reagent is specifically a) or b) as follows: a) primers for detecting hsa_piR_019301; b) a reagent containing a).

5. The use of claim 4, wherein: The primers are the upstream primer shown as SEQ ID No. 2 and the downstream primer shown as SEQ ID No. 3.

Images