Application of THADA in hyperlipidemia and cardiovascular metabolic diseases

Abstract

The invention belongs to the technical field of biological medicine, and provides application of THADA in hyperlipidemia and cardiovascular metabolic diseases. THADA as a biomarker or a target can be used for preparing a reagent for predicting, screening or diagnosing diseases and preparing a medicine for preventing or treating the diseases. The traditional Chinese medicine composition has the functions of reducing blood cholesterol, low-density lipoprotein cholesterol (LDL-C) and triglyceride levels in vivo, not influencing the high-density cholesterol level, reducing liver triglyceride deposition and liver fatty degeneration and improving atherosclerosis, the effect is definite and effective, and no adverse reaction exists. The invention provides a new biomarker and a treatment target for hyperlipidemia and cardiovascular metabolic diseases, and has good practical application value and wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a new application of THADA in disease diagnosis, screening, prevention and treatment. Background Art

[0002] The disclosure of this background information is intended to enhance understanding of the general background of the invention and should not necessarily be regarded as an acknowledgment or any form of suggestion that this information constitutes the prior art already known to a person skilled in the art.

[0003] With the shift in lifestyles and nutritious diets in modern society, the prevalence of hyperlipidemia, dyslipidemia, and related cardiovascular metabolic diseases such as fatty liver disease and atherosclerosis has increased significantly, becoming common chronic diseases and a global health concern. Cardiometabolic diseases are the leading chronic non-communicable diseases threatening human life and health worldwide. According to the "Guidelines for Blood Lipid Management in China," cardiovascular diseases, primarily atherosclerotic cardiovascular disease (such as ischemic heart disease and ischemic stroke), are the leading cause of death in both urban and rural my country.

[0004] Blood lipids are a general term for cholesterol, triglycerides, and lipids (such as phospholipids) in the serum. Cholesterol and triglycerides are the most clinically relevant blood lipids. In recent decades, average blood lipid levels in the Chinese population, including total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG), have increased significantly.

[0005] Despite this, the public's awareness, treatment and control rates of dyslipidemia are extremely low. For high-risk and susceptible populations of cardiovascular metabolic diseases, the first priority is to lower blood cholesterol and triglyceride levels, and the focus of prevention and treatment is to increase the treatment rate of lipid-lowering drugs and the rate of blood lipid compliance. However, the types of lipid-lowering drugs currently used in clinical practice are limited, and a single drug is difficult to control the compliance of multiple blood lipid indicators, or there are side effects such as patient intolerance, such as abnormal high-density lipoprotein cholesterol indicators. Therefore, one of the urgent needs now is to urgently discover new lipid-lowering targets at the genetic level for the development of new and effective lipid-lowering drugs to simultaneously control multiple blood lipid indicators such as LDL-C and triglycerides, with low side effects, for the prevention and treatment of hyperlipidemia and cardiovascular metabolic diseases.

[0006] THADA is a protein encoded by a thyroid adenoma-related gene, which was first discovered and named in benign thyroid adenoma. Previous genome-wide association studies (GWAS) have found that THADAA single nucleotide polymorphism (SNP) site of the gene, rs7578597, is significantly associated with type 2 diabetes. A study published in the Journal of Diabetes Research has replicated the association with type 2 diabetes in Asian populations for the first time. Among the four lipid-related traits tested, only rs7578326 ( IRS1 ) site is significantly associated with triglyceride levels; the other multiple SNPs associated with type 2 diabetes tested have not been shown to be associated with lipids before, according to the GWAS catalog published by the National Human Genome Research Institute of the United States (http: / / www.genome.gov / gwastudies / ). THADA Gene SNP (rs7578597) was not associated with any of the four lipid-related traits.

[0007] A study published in Human Heredity (Association of Common Genetic Variants with Diabetes and Metabolic Syndrome Related Traits in the Arizona Insulin Resistance Registry: A Focus on Mexican American Families in the Southwest, 2014) reported THADA Another study published in Human Reproduction (Genotype-phenotype correlationsof PCOS susceptibility SNPs identified by GWAS in a large cohort of HanChinese women, 2013) reported that PCOS patients THADA A SNP site rs12478601 in the gene is associated with LDL abnormalities, but not with total cholesterol or triglycerides.

[0008] A study published in Developmental Cell (THADA Regulates the Organismal Balance between Energy Storage and Heat Production, 2017) reported THADA The triglyceride levels of the knockout fruit flies were significantly higher than those of the control fruit flies, which the authors believe THADA Knockout has the pathogenic effect of causing hypertriglyceridemia in Drosophila. In addition, a study published in PLOS ONE (Association Study between Polycystic Ovarian Syndrome and the Susceptibility Genes Polymorphisms in HuiChinese Women, 2015) reported on the THADA As for the SNP site rs13429458, there was no statistical difference in triglyceride and low-density lipoprotein levels between patients with polycystic ovary syndrome and the control group.

[0009] It is well known to those skilled in the art that GWAS only reveals the correlation between the frequency difference of single nucleotide variations in the genome and the phenotype, but cannot clearly determine the pathogenicity. The SNPs discovered by GWAS cannot be directly located to the gene in the region where the site is located, but may exert their effects by affecting other distant or adjacent genes (Macarthur et al. Guidelines for investigating causality of sequence variants in human disease. Nature, 2014, 508(7497):469-76.). Therefore, based on the above research, it is impossible to infer the effect of SNPs on the region where the site is located. THADA Whether the expression or function of the gene itself is affected. THADA Negative or negative correlation studies of different SNPs in genes show that the impact of genetic variation at the genomic level on gene expression and function is not clear. Therefore, it is impossible to infer based on SNP research data. THADA The expression or function of the gene itself cannot be inferred based on the above genetic association studies whether the gene where the SNP is located is pathogenic. THADA Genetic associations were found in people with diabetes or polycystic ovary syndrome, but not in hyperlipidemia, fatty liver disease, and cardiovascular disease. THADA Gene association reports.

[0010] In summary, in the prior art, no THADA The independent functional studies on hyperlipidemia and cardiovascular metabolic diseases are still unclear. THADA What is the relationship between it and hyperlipidemia and cardiovascular metabolic diseases? THADA So far, there has been no report on its function and pathogenic role in hepatic lipid metabolism and atherosclerotic cardiovascular disease. Summary of the Invention

[0011] To address the lack of diagnostic, screening, preventive and therapeutic reagents for cardiovascular metabolic diseases such as hyperlipidemia, fatty liver disease, and atherosclerotic cardiovascular disease, the present invention provides an application of the THADA molecule in the diagnosis and treatment of the above-mentioned diseases. Inhibiting or disrupting the expression of THADA has the potential to significantly lower blood cholesterol, low-density lipoprotein cholesterol (LDL-C) and triglyceride levels in vivo, without affecting high-density cholesterol levels, reduce hepatic triglyceride deposition and hepatic fatty degeneration, and improve atherosclerosis. The effects are clear and effective without adverse reactions.

[0012] To achieve the above objectives, the present invention adopts the following technical solutions.

[0013] Use of THADA in the preparation of reagents for predicting, screening or diagnosing diseases, including: Hyperlipidemia, such as hypercholesterolemia, hypertriglyceridemia, and combined hyperlipidemia; Dyslipidemia; Fatty liver disease, such as metabolic dysfunction-associated fatty liver disease (also known as metabolic-related fatty liver disease, non-alcoholic fatty liver disease), advanced metabolic dysfunction-associated steatohepatitis (also known as metabolic-related steatohepatitis, non-alcoholic steatohepatitis); and, atherosclerotic cardiovascular disease.

[0014] The application includes using at least one of the following as a biomarker for preparing a reagent for disease prediction, screening or diagnosis: THADA gene; mRNA expressed by the THADA gene; and, Protein expressed by the THADA gene.

[0015] High expression of the THADA gene can cause disease. The above test detects at least one of the following: THADA gene expression level; mRNA expression level of THADA gene expression; and, The expression level, localization or activity of THADA protein.

[0016] The present invention also provides a detection reagent for detecting the content of a biomarker to evaluate whether a subject suffers from hyperlipidemia, dyslipidemia, hypercholesterolemia, hypertriglyceridemia, fatty liver disease, or atherosclerotic cardiovascular disease or is at risk of the disease, wherein the biomarker is at least one of: the THADA gene; mRNA expressed by the THADA gene; and a protein expressed by the THADA gene.

[0017] The subject is a mammal or a mammalian cell, wherein the mammal is a human, a monkey or a mouse.

[0018] The reagent uses gene sequencing, PCR, FISH, immunohistochemistry, ELISA, Western blot or flow cytometry as detection methods.

[0019] The present invention also provides the use of THADA as a target in the preparation of a drug for preventing or treating a disease, wherein the disease is: Hyperlipidemia, such as hypercholesterolemia, hypertriglyceridemia, and combined hyperlipidemia; Dyslipidemia, including primary dyslipidemia and secondary dyslipidemia; Fatty liver disease, such as metabolic dysfunction-associated fatty liver disease (also known as metabolic-related fatty liver disease, non-alcoholic fatty liver disease), advanced metabolic dysfunction-associated steatohepatitis (also known as metabolic-related steatohepatitis, non-alcoholic steatohepatitis); and, atherosclerotic cardiovascular disease.

[0020] The drug inhibits or disrupts at least one of the following: THADA gene expression level; mRNA expressed by the THADA gene; The expression level, function, localization or activity of THADA protein.

[0021] The application is to use THADA as a drug target, construct an in vitro cell model or animal model with overexpression of the THADA gene, and use the in vitro cell model or animal model to screen THADA inhibitors.

[0022] A drug that inhibits or disrupts at least one of the following: THADA gene expression level; mRNA expressed by the THADA gene; and, the expression level, function, localization or activity of THADA protein; The disease treated by the drug is hyperlipidemia, such as hypercholesterolemia, hypertriglyceridemia, and mixed hyperlipidemia; Dyslipidemia; Fatty liver disease, such as metabolic dysfunction-associated fatty liver disease (also known as metabolic-related fatty liver disease, non-alcoholic fatty liver disease), advanced metabolic dysfunction-associated steatohepatitis (also known as metabolic-related steatohepatitis, non-alcoholic steatohepatitis); and, atherosclerotic cardiovascular disease.

[0023] The active ingredients of the drug include at least one of the following options: nucleic acid, polypeptide, protein, enzyme, natural extract, synthetic compound, vector for RNA interference or knockout of THADA gene, and degradation of THADA protein.

[0024] Preferably, the drug contains a nucleic acid and / or vector for knocking out the THADA gene or RNA interference with the THADA gene. More preferably, the nucleic acid is selected from at least one of the following: antisense oligonucleotides, double-stranded RNA, ribozymes, small interfering RNA (siRNA), short hairpin RNA (shRNA), guide RNA (gRNA), and a complex formed by a guide RNA and Cas9 protein; and the vector comprises at least one of the following: liposomes, lentiviruses, adenoviruses, adeno-associated viruses, and plasmids for constructing viruses, GalNac-conjugated modifications, lipid delivery systems, nanomaterial delivery systems, polymer delivery systems, and exosomes.

[0025] The present invention has the following advantages: The present invention demonstrates, through mammalian biological experiments, that inhibiting or disrupting THADA expression in vivo lowers blood cholesterol, low-density lipoprotein cholesterol (LDL-C), and triglyceride levels, while leaving high-density lipoprotein cholesterol levels unaffected, reduces hepatic triglyceride deposition and hepatic steatosis, and improves atherosclerosis. The effects are clear and effective, with no adverse reactions. This protein or gene can be used to prepare reagents for predicting, screening, or diagnosing cardiovascular metabolic diseases, such as hyperlipidemia, fatty liver disease, and atherosclerotic cardiovascular disease, as well as for the preparation of preventive and therapeutic drugs for these cardiovascular metabolic diseases. This invention provides new biomarkers and drug targets for hyperlipidemia and cardiovascular metabolic diseases, possessing promising practical applications and broad potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 for Thada Strategy for constructing liver knockout mice; Figure 2 For control and Thada Serum total cholesterol levels in liver knockout mice on normal and high-cholesterol diets; Figure 3 For control and Thada Serum low-density lipoprotein cholesterol (LDL-C) levels in liver knockout mice on a normal diet and a high-cholesterol diet; Figure 4 For control and Thada Serum high-density lipoprotein cholesterol (HDL-C) levels in liver knockout mice on a normal diet and a high-cholesterol diet; Figure 5 For control and ThadaSerum triglyceride levels in liver knockout mice on normal and high cholesterol diets; Figure 6 For control and Thada Oil red staining of liver histology (A) and triglyceride levels in liver of liver knockout mice (B); Figure 7 Atherosclerosis model mice Thada - Serum total cholesterol level after LNP nucleic acid knockdown; Figure 8 Atherosclerosis model mice Thada - Serum low-density lipoprotein cholesterol (LDL-C) levels after LNP nucleic acid knockdown; Figure 9 Atherosclerosis model mice Thada - Serum triglyceride levels after LNP nucleic acid knockdown; Figure 10 Atherosclerosis model mice Thada - Serum high-density lipoprotein cholesterol levels after LNP nucleic acid knockdown; Figure 11 Atherosclerosis model mice Thada - Liver morphology staining after LNP nucleic acid knockdown; Figure 12 Atherosclerosis model mice Thada -Oil red staining of aortic plaques (A) and plaque area (B) after LNP nucleic acid knockdown; Figure 13 For control and Thada Serum total cholesterol levels in overexpressing mice; Figure 14 For control and Thada Serum low-density lipoprotein cholesterol (LDL-C) levels in overexpressing mice; Figure 15 For control and Thada Serum triglyceride levels in overexpressing mice; Figure 16 For control and Thada Oil red staining of liver histology of overexpressing mice. DETAILED DESCRIPTION

[0027] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.

[0028] Example 1 THADA deficiency significantly improves hyperlipidemia in mice 1. Liver-specific Thada Construction of knockout mice Through CRISPR / Cas9 technology, targeted Thada The targeting sequence was designed in the exon 8 region of the gene, and two loxP sites were designed and constructed at both ends of the exon 8 region of the gene. The gRNA, the donor vector containing the loxP sites and Cas9 were co-injected into mouse fertilized eggs to produce offspring with conditional knockout of the targeted gene. The mouse genotype was determined by polymerase chain reaction and sequence analysis. Thada -flox mice.

[0029] The gRNA target sequences are as follows: gRNA-A1 (matching reverse strand of gene), SEQ ID NO:1: TCCTACTCACTATCTACATTTGG; gRNA-A2 (matching forward strand of gene), SEQ ID NO:2: ACACGGATAGATCTTCTGGCCGG.

[0030] Further the above Thada -flox mice with a hepatocyte-specific promoter Albumin Cre-driven mice ( Alb -Cre) mating and obtained through generation-by-generation breeding Thada -flox homozygous, carrying Alb -Cre mice, that is, Thada Hepatocyte-specific knockout (LKO) mice are derived from littermates that do not carry Alb -Cre mice were used as controls. Figure 1 As shown, this construction strategy can achieve mouse hepatocyte-specific THADA deletion and functional inactivation.

[0031] 2. Induction of hyperlipidemia above Thada Liver knockout (LKO) and littermate control (WT) mice were fed a high-fat, high-cholesterol diet (containing 40 kcal% fat and 1.25% cholesterol, Research Diet) starting at 8 weeks of age and continued for four weeks. This high-cholesterol diet can cause significant metabolic damage phenotypes such as increased blood lipid levels, hepatic lipid accumulation, and hepatic steatosis in mice, making it a commonly used mouse model for hyperlipidemia. Figure 2 As shown in the figure, compared with mice fed a normal diet, the serum total cholesterol level of mice induced by a high cholesterol diet was significantly increased, confirming that the hyperlipidemia model was successfully induced.

[0032] 3. Collection, Processing, and Testing of Mouse Blood Samples The mice were divided into the following four groups: control (WT) mice fed a normal diet; Thada Liver knockout (LKO) mice were fed a normal diet, and control (WT) mice were fed a high-fat, high-cholesterol diet. Thada Liver knockout (LKO) mice were fed a high-fat, high-cholesterol diet. After the induction of the diet model, blood was collected from each group of mice after a 6-hour fast. Serum was collected by centrifugation at 3000 rpm for 15 minutes at 4°C.

[0033] (1) Determination of total cholesterol level in mouse serum The total cholesterol levels of the serum of the four groups of mice were determined according to the instructions of the liquid sample total cholesterol enzymatic assay kit.

[0034] Take 190 µL of the working solution. Add 10 µL of each working solution, including the blank solution, the standard, and the mouse serum sample to be tested, for a total reaction volume of 200 µL. Incubate at 37°C for 20 min. After the reaction reaches equilibrium, the color should stabilize within 60 min. Measure the OD value of each sample using a microplate reader. Draw a standard curve and calculate the total cholesterol content in serum by comparing the standard curve.

[0035] The results are as follows Figure 2 As shown, under normal diet, Thada The serum total cholesterol level of liver knockout (LKO) mice was significantly lower than that of the control group. Furthermore, after induction of a high-fat, high-cholesterol diet, THADA deficiency further reduced the serum total cholesterol level of hyperlipidemic mice.

[0036] (2) Determination of serum low-density lipoprotein cholesterol (LDL-C) levels in mice The serum of the above four groups of mice was used to determine LDL-C according to the instructions of the blood low-density lipoprotein cholesterol enzymatic assay kit.

[0037] LDL cholesterol separation: Add an equal volume of 50 μL of LDL capture reagent to 50 μL of serum, vortex to mix, and incubate at room temperature for 10 minutes. Centrifuge at 2000 g for 20 minutes to precipitate LDL cholesterol. Carefully aspirate the supernatant, centrifuge again at 2000 g for 10 minutes, and discard the supernatant. Add 100 μL of PBS and vortex to resuspend the pellet.

[0038] LDL cholesterol assay: Prepare the assay working solution and aliquot 190 µL of the working solution into a microplate well. Add 10 µL of the supernatant prepared after the LDL cholesterol separation step above and 10 µL of the standard sample tube to a total reaction volume of 200 µL. Incubate at 37°C for 20 min. Measure the OD value of each tube using a microplate reader. Construct a standard curve and calculate the LDL-C concentration of each sample.

[0039] The results are as follows Figure 3 As shown, under normal diet, Thada Serum LDL-C levels in liver knockout (LKO) mice were significantly lower than those in the control group. Furthermore, after a high-fat, high-cholesterol diet induced elevated LDL-C levels in mice, THADA deficiency further significantly reduced serum LDL-C levels in hyperlipidemic mice.

[0040] (3) Determination of serum high-density lipoprotein cholesterol (HDL-C) levels in mice The serum of the four groups of mice was used to determine HDL-C according to the instructions of the high-density lipoprotein cholesterol enzymatic assay kit.

[0041] HDL cholesterol separation: Take 50 μL of serum and add an equal volume of 50 μL of HDL capture reagent. Vortex to mix and incubate at room temperature for 10 minutes. Centrifuge at 2000 g for 20 minutes. The supernatant contains HDL cholesterol.

[0042] HDL cholesterol assay: Prepare the assay working solution and aliquot 190 µL of the working solution into the microplate wells. Add 10 µL of the supernatant prepared after the HDL cholesterol separation step above and 10 µL of the standard sample tube to a total reaction volume of 200 µL. Incubate at 37°C for 20 min. Measure the OD value of each tube using a microplate reader. Construct a standard curve and calculate the LDL-C concentration of each sample.

[0043] The results are as follows Figure 4 As shown, whether under normal diet or high cholesterol diet, Thada There was no significant change in serum HDL-C between liver knockout (LKO) mice and control mice, indicating that THADA deficiency did not affect blood HDL-C levels.

[0044] (4) Determination of serum triglyceride levels in mice: The triglyceride levels of the serum of the four groups of mice were determined according to the instructions of the liquid sample triglyceride content enzymatic assay kit.

[0045] Dilute the standard sample to prepare a working solution. Add 10 μL of the standard sample or mouse serum sample to a microplate, along with 190 μL of the prepared working solution. Incubate at 37°C for 15 min. Measure the OD value of each tube using a microplate reader. Draw a standard curve and calculate the triglyceride concentration of each sample.

[0046] The results are as follows Figure 5 As shown, under normal diet, ThadaSerum triglyceride levels in liver knockout (LKO) mice were significantly lower than those in the control group. Furthermore, after a high-fat, high-cholesterol diet induced a significant increase in serum triglyceride levels in mice, THADA deficiency was able to further significantly reduce serum triglyceride levels in hyperlipidemic mice.

[0047] The above experimental results show that, whether in a normal diet or after hyperlipidemia induced by a high-fat, high-cholesterol diet, specific inactivation of liver THADA function can significantly reduce total cholesterol, low-density lipoprotein cholesterol, and triglyceride levels in mouse serum, without affecting high-density lipoprotein cholesterol levels, demonstrating a significant beneficial effect on the lipid profile. These results suggest that THADA can be used as a new drug target for the prevention and treatment of lipid disorders such as hyperlipidemia and hypercholesterolemia, without significant adverse effects.

[0048] Example 2 THADA deficiency improves fatty liver disease in mice The control (WT) mice constructed in Example 1 and Thada Liver knockout (LKO) mice were fed a high-fat, high-cholesterol diet (40 kcal% fat, 1.25% cholesterol, Research Diet) starting at 8 weeks of age. The high-fat, high-cholesterol diet, which contains 40% fat, induces fatty liver disease in mice. Therefore, this study was used to further evaluate the effects of liver-specific THADA inactivation on metabolic dysfunction-related fatty liver disease in mice.

[0049] (1) Liver histology Oil red O staining Oil Red O (ORO) staining: Equal amounts of liver tissue were collected from each group of mice after diet induction, embedded in OCT, and frozen sections were prepared. After rewarming, sections were fixed in 4% paraformaldehyde for 20 minutes. Following a wash with distilled water, sections were stained with 60% isopropanol for 2 minutes. The sections were then directly stained in Oil Red O staining solution for 20 minutes in the dark. Following a wash with distilled water, sections were stained with hematoxylin for 2 minutes and mounted with glycerol gelatin. Images were captured using a microscope and analyzed.

[0050] (2) Liver triglyceride detection After the diet induction, mice were fasted for 6 hours and then sampled. Equal amounts of liver tissue were quickly frozen in liquid nitrogen. Frozen liver tissue samples were added to lysis buffer and disrupted. The samples were then centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant was aspirated and assayed for triglyceride content according to the instructions of the tissue cell triglyceride assay kit. The absorbance was measured colorimetrically using a microplate reader, and the absolute triglyceride value was calculated using a standard curve. Protein content in the lysate supernatant was assayed using a BCA protein quantification kit (purchased from Thermo Fisher Scientific). Triglyceride content in each sample was corrected for protein content.

[0051] The above experimental data are as follows Figure 6 As shown, in diet-induced fatty liver disease control mice, Oil Red O staining of liver tissue revealed significant lipid accumulation, increased lipid droplets, and vacuolar changes, demonstrating successful fatty liver disease model induction. However, after THADA function loss in LKO mice, lipid staining area in hepatocytes was significantly reduced, lipid droplet vacuoles were significantly decreased, and no adverse inflammatory changes were observed histologically. Furthermore, triglyceride content measurement revealed a significant decrease in triglyceride content and lipid accumulation in the livers of LKO mice.

[0052] The experimental data of the above examples show that THADA inactivation can effectively improve liver lipid levels, reverse and treat liver steatosis in animal models of fatty liver disease, and provide sufficient in vivo biological evidence for the application of THADA in fatty liver disease.

[0053] Example 3 THADA small interfering nucleic acid drug significantly alleviates atherosclerotic cardiovascular disease in mice (1) Construction of animal model of atherosclerotic cardiovascular disease Feeding mice a high-cholesterol diet can establish an atherosclerosis model. To investigate the therapeutic effects of THADA in atherosclerosis, mice were fed a high-cholesterol diet (40 kcal% fat, 1.25% cholesterol, Research Diet) starting at 8 weeks of age and continued for 12 weeks to induce hyperlipidemia, atherosclerotic pathology, and plaque formation.

[0054] (2) THADA knockdown therapy in atherosclerotic mice using LNP-siRNA Targeted Thada Design small interfering nucleic acid sequences and perform chemical modifications to improve stability. The siRNA target sequences are as follows: siRNA- Thada -1 (sense strand), SEQ ID NO: 3: GAGCAAGUGUGGUUAAUCUTT; siRNA- Thada -2 (antisense strand), SEQ ID NO: 4: AGAUUAACCACACUUGCUCTT.

[0055] The above-mentioned THADA-targeted siRNA and lipid nanoparticle (LNP) complex was prepared by microfluidic mixing technology. The LNP component contained ionizable lipids, auxiliary lipids and a buffer system. The siRNA was further encapsulated and purified by ultrafiltration concentration. The encapsulation efficiency was confirmed for quality control. The LNP suspension was diluted with physiological saline to obtain LNP-siRNA- Thada Nucleic acid drugs.

[0056] Mice with successful induction of atherosclerosis in (1) were randomly divided into experimental group (LNP-si Thada ) The mice were injected with 200 μL of LNP-siRNA-Thada nucleic acid drug through the tail vein, and the control group (Saline) mice were injected with an equal amount of saline solvent. The injections were repeated twice a week for four weeks to detect the therapeutic effect.

[0057] (3) Blood lipid detection in atherosclerotic mice After fasting for 6 hours, blood was collected from the mice. Serum was collected by centrifugation at 3000 rpm for 15 minutes at 4°C. The serum was diluted with normal saline and assayed for total cholesterol, low-density lipoprotein cholesterol, and triglyceride levels according to the assay kit instructions.

[0058] Analysis of the above experimental data showed that the blood cholesterol levels of the atherosclerotic mice in the control group were significantly elevated, showing obvious hypercholesterolemia. Compared with the control model mice, knocking down THADA with small interfering nucleic acids significantly reduced serum total cholesterol levels ( Figure 7 Compared with the control mice with hyperlipidemia and atherosclerosis, the serum LDL-C levels of mice were also significantly reduced after THADA small interfering nucleic acid knockdown treatment ( Figure 8 ), accompanied by a significant decrease in serum triglyceride levels ( Figure 9 ), without affecting high-density lipoprotein cholesterol levels ( Figure 10 These data indicate that siRNA targeting THADA can significantly improve the lipid profile of atherosclerotic mice.

[0059] (4) Liver tissue morphology staining HE staining: Liver tissues from mice in the control and treatment groups were fixed in 4% paraformaldehyde for at least 24 hours. After dehydration and embedding, 5 μm tissue sections were cut. Sections were routinely deparaffinized in distilled water and stained with hematoxylin for 2 minutes. The sections were then rinsed with tap water to blue, washed with distilled water, and stained with eosin for 1 minute. The sections were dehydrated with graded alcohols and mounted with neutral gum. Images were acquired using a microscope.

[0060] Oil Red O (ORO) staining: Equal amounts of liver tissue were collected from each group of mice after dietary induction, embedded in OCT, and frozen sections were prepared. After rewarming, sections were fixed in 4% paraformaldehyde for 20 minutes. Following a wash with distilled water, sections were stained with 60% isopropanol for 2 minutes. The sections were then directly stained in Oil Red O staining solution for 20 minutes in the dark. Following a wash with distilled water, sections were stained with hematoxylin for 2 minutes and mounted with glycerol gelatin. Images were captured using a microscope and analyzed.

[0061] Depend on Figure 11As can be seen, liver histological HE staining results showed that LNP-siRNA knockdown of THADA significantly reduced lipid droplet vacuoles in hepatocytes, without other adverse effects on hepatocyte morphology. In addition, liver Oil Red O staining showed that lipid levels in hepatocytes were significantly reduced after LNP small interfering nucleic acid treatment, indicating that THADA small interfering nucleic acid treatment can effectively reverse fatty liver lesions.

[0062] (5) Isolation and collection of aorta from atherosclerotic mice The mice were anesthetized and fixed, and then perfused with pre-chilled saline after cardiac incision. After blood was removed, the aortic arch and abdominal aorta were isolated, and surrounding fat was removed. The entire aorta was fixed in 4% paraformaldehyde.

[0063] (6) Assessment of plaques in the aorta of mice with atherosclerosis by Oil Red O staining After sufficient fixation, the entire aorta was removed from the fixative and washed with PBS to remove any residual fixative. Furthermore, under a stereomicroscope, fine forceps were used to remove the adventitial adipose tissue. The entire aorta was then longitudinally dissected distally along the greater curvature of the aortic arch. The dissected aorta was unfolded with the intima facing upward and fixed to a black plastic dish with a small needle. The prepared Oil Red O stain was added and incubated for staining. After discarding the Oil Red stain, the aorta was differentiated with ethanol and washed, and images were captured under a microscope. Plaque area and total intima area were measured using ImageJ software. The relative percentage of plaque was calculated by dividing the total plaque area by the total intima area. This method was used to assess the severity of atherosclerotic plaques.

[0064] like Figure 12 As shown, Oil Red O staining of the aortas of control atherosclerosis model mice revealed multiple lipid plaques, indicating successful atherosclerosis modeling. Compared with the control model group, the aortas of mice treated with THADA small interfering nucleic acid showed significantly less lipids and a marked alleviation of plaques. Quantitative analysis of plaque area also revealed that the total aortic plaque area of ​​mice treated with THADA small interfering nucleic acid was significantly lower than that of the control group.

[0065] The experimental data from the above examples demonstrate that THADA-targeted siRNA knockdown therapy effectively reduces total cholesterol, low-density lipoprotein cholesterol, and triglyceride levels in atherosclerotic mice, improves hyperlipidemia and hepatic steatosis, and effectively alleviates the severity of atherosclerotic plaque lesions. These results provide sufficient in vivo biological evidence for the application of THADA in atherosclerotic cardiovascular diseases and further confirm that THADA-targeted drugs can be used for the prevention and treatment of cardiovascular metabolic diseases such as hyperlipidemia and fatty liver disease.

[0066] These studies, through the construction of multiple animal models targeting THADA to simulate the pathological processes of human hyperlipidemia, fatty liver disease, and atherosclerotic cardiovascular diseases, revealed that THADA functional inactivation is effective in treating cardiovascular metabolic diseases such as atherosclerosis by significantly improving lipid metabolism, reducing hyperlipidemia, improving fatty liver disease, and treating atherosclerosis without significant side effects. This suggests that drugs targeting THADA inactivation or functional inhibition could serve as novel preventive and therapeutic agents for these cardiovascular metabolic diseases, including hyperlipidemia and atherosclerosis.

[0067] Example 4 THADA overexpression induces hyperlipidemia and fatty liver disease in mice 1. Thada Construction of liver-specific overexpression mice Constructed by adenovirus Thada The full-length gene overexpression vector was injected into the tail vein to construct a mouse model of THADA overexpression. Wild-type 8-week-old mice of the same weight were randomly divided into an experimental group and a control group. The mice in the experimental group were injected with a solution of saline into the tail vein. Thada Gene overexpression adenovirus can effectively induce liver gene overexpression by utilizing the hepatotropism of adenovirus. The control group mice were given the same dose of normal saline by tail vein injection.

[0068] 2. Sample Collection and Metabolic Index Testing of Model Mice Following tail vein injection, the THADA-overexpressing and control mice were fed a normal diet for two weeks before sampling. Serum was collected and assayed for total cholesterol, LDL cholesterol, and triglyceride levels using the methods described in Example 1. Liver samples were fixed and stained with Oil Red O to assess triglyceride accumulation using the methods described in Example 2.

[0069] Experimental data showed that the serum total cholesterol and LDL cholesterol levels in THADA-overexpressing mice were significantly increased compared with those in control mice ( Figure 13 、 14 ), while serum triglyceride levels increased significantly ( Figure 15 ), indicating that high expression of THADA can induce high cholesterol and hyperlipidemia. Compared with the control group, the liver cells of mice in the THADA overexpression group showed obvious oil red O lipid droplets ( Figure 16 ), indicating lipid accumulation in hepatocytes and manifestations of fatty liver disease. These results collectively demonstrate that overexpression of THADA can lead to hyperlipidemia and fatty liver disease, indicating that THADA can be used as a molecular marker for the prediction, screening, or diagnosis of these diseases.

[0070] The foregoing is merely an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application should all be included within the scope of the claims of the present application.

Claims

1. Use of THADA in the preparation of reagents for disease prediction, screening or diagnosis and in the preparation of drugs for preventing or treating diseases, characterized in that: The diseases include: hyperlipidemia, dyslipidemia, fatty liver disease, and atherosclerotic cardiovascular disease; High expression of the THADA gene can lead to disease, and the application includes using at least one of the following as a biomarker for preparing a reagent for disease prediction, screening or diagnosis: THADA gene; mRNA expressed by the THADA gene; and, Protein expressed by the THADA gene; The application is to use THADA as a drug target, and the drug inhibits or destroys at least one of the following: THADA gene expression level; mRNA expressed by the THADA gene; the expression level, function, localization, modification or activity of THADA protein; The detection object of the reagent and the treatment object of the drug are mammals or mammalian cells.

2. The use according to claim 1, characterized in that The reagent detects at least one of the following: THADA gene expression level; mRNA expression level of THADA gene expression; and, The expression level, localization, modification or activity of THADA protein.

3. The use according to claim 1, characterized in that The reagent uses gene sequencing, PCR, FISH, immunohistochemistry, ELISA, Western blot or flow cytometry as detection methods.

4. The use according to claim 1, characterized in that The application is to construct an in vitro cell, organoid or animal model targeting the THADA gene, and use the model to screen THADA inhibitors.

5. The use according to claim 1, characterized in that The active ingredients of the drug include: nucleic acid, polypeptide, protein, enzyme, natural extract, synthetic compound, at least one of a vector for RNA interference or knocking out THADA gene, and degrading THADA protein.

6. The use according to claim 1, characterized in that The active ingredient of the drug comprises nucleic acid and / or vector for knocking out or knocking down the THADA gene or RNA interference of the THADA gene.

7. The use according to claim 5 or 6, characterized in that The carrier is selected from at least one of liposomes, lentiviruses, adenoviruses, adeno-associated viruses, and plasmids for constructing viruses, GalNac coupling modifications, lipid delivery systems, nanomaterial delivery systems, polymer delivery systems, and exosomes; The nucleic acid is selected from at least one of double-stranded RNA, siRNA, shRNA, guide RNA, a complex formed by guide RNA and Cas9 protein, antisense oligonucleotide and ribozyme.

Images