Detection primer for SNP site rs7851696 related to abdominal aortic aneurysm and application of detection primer
The detection of SNP sites related to abdominal aortic aneurysm by ARMS-PCR technology combined with specific primers has solved the problem of insufficient sensitivity of existing ultrasound screening methods, and achieved efficient, convenient, sensitive and specific early abdominal aortic aneurysm screening, reducing screening costs and improving detection accuracy.
Patent Information
- Application Number
- CN202510964363.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-14
- Publication Date
- 2025-08-15
AI Technical Summary
The existing ultrasound screening methods are insufficient in detecting abdominal aortic aneurysms less than 3 cm or early arterial wall changes, resulting in high screening costs and a high economic burden on the public health system, and lack of efficient, convenient, sensitive and specific early detection methods.
ARMS-PCR technology was used to combine specific primers to detect SNP sites related to abdominal aortic aneurysm, and 2 nonspecific lateral primers and 2 specific medial primers were designed. Through the ARMS-PCR reaction system and condition optimization, efficient amplification and detection of SNP sites were achieved.
It provides an efficient, convenient, sensitive and specific early screening method for abdominal aortic aneurysms, which reduces screening costs, improves the accuracy and efficiency of detection, and has potential clinical significance and market value.
Smart Images

Figure CN120485374A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of gene detection, and more specifically, to a detection primer for the abdominal aortic aneurysm-related SNP site rs7851696 and its application. Background Art
[0002] Abdominal aortic aneurysm (AAA) refers to localized dilation of the abdominal aorta exceeding 3.0 cm, or an increase of more than 1.5 times its original diameter. AAAs present insidiously, and once ruptured, they carry a high mortality rate. Currently, early diagnosis of AAAs is limited to imaging screening.
[0003] Although current ultrasound screening methods can detect most abdominal aortic aneurysms, their sensitivity is still limited for aneurysms smaller than 3 cm or early arterial wall changes. The cost-effectiveness of ultrasound, a relatively inexpensive screening method, for large-scale population screening has also been questioned. Screening places a significant financial burden on public health systems, especially in resource-limited settings.
[0004] Therefore, it is very necessary to develop an efficient, convenient, sensitive and specific detection method for early screening of abdominal aortic aneurysm. Summary of the Invention
[0005] The purpose of the present invention is to provide a primer for detecting the abdominal aortic aneurysm-related SNP site rs7851696 using the ARMS-PCR method and its application, so as to provide an efficient, convenient, sensitive and specific detection method for the early screening of abdominal aortic aneurysm.
[0006] Single nucleotide polymorphisms (SNPs) are genetic markers formed by variations in a single nucleotide in the genome, including transitions, transversions, deletions, and insertions. SNPs are known, heritable, and detectable, making them useful for mapping, cloning, and identifying disease-associated mutations. The rs7851696 locus is located in human chr9:134887245 (GRCh38.p14), encoding the FCN2 gene. Taqman PCR in a small sample of blood samples from patients with aortic aneurysms and controls initially confirmed that the 6424G>T mutation, or FCN2 A258S, is elevated in patients with aortic aneurysms. The FCN2 gene encodes the human Ficolin-2 (L-ficolin) protein. L-ficolin is present in plasma and binds to GlcNAc on the surface of pathogenic microorganisms, activating the complement system through the mannose lectin pathway. Previous studies have suggested that the alternative complement system plays a crucial role in the progression of AAA.
[0007] ARMS (Amplification Refractory Mutation System, ARMS) combines ARMS technology with genomic PCR. Its basic principle is that primer extension can proceed normally when the 3′-terminal base of the primer is perfectly complementary to the template. If the 3′-terminal base of the primer is not complementary to the template base, i.e., a mismatch exists, primer extension is inhibited or even terminated completely. This method is often used to detect variability in single nucleotide polymorphisms (SNPs).
[0008] It can be seen that the design of a primer for detecting the abdominal aortic aneurysm-related SNP site rs7851696 using the ARMS-PCR method and its application have potential clinical significance and can provide huge market value.
[0009] In order to achieve the above-mentioned invention objectives, this application adopts the following technical solutions: In a first aspect, the present application provides a detection primer for the abdominal aortic aneurysm-related SNP site rs7851696, wherein the detection primer comprises two non-specific outer primers and two inner primers that specifically detect the SNP mutation site; The outer primers have the sequences shown in SEQ ID NO: 1 (forward primer) and SEQ ID NO: 2 (reverse primer) or their complementary sequences; The inner primers have the sequences shown in SEQ ID NO: 3 (forward primer) and SEQ ID NO: 4 (reverse primer) or their complementary sequences; Two inner primers specifically detecting SNP mutation sites corresponded to the polymorphism of SNP site rs7851696 (G / T).
[0010] SEQ ID NO. 1 is as follows: CACTGGAGTCATGGATTGCA (forward primer); SEQ ID NO. 2 is as follows: TCGCACCTTCATCTCTGACA (reverse primer); SEQ ID NO. 3 is as follows: TCTTAACACCGGAAATTGTG (forward primer); SEQ ID NO. 4 is as follows: GCTCCCTGAAACATCACAGA (reverse primer).
[0011] In a second aspect, the present application provides the use of the above-mentioned detection primers for the abdominal aortic aneurysm-related SNP site rs7851696 in the preparation of a reagent or kit for detecting abdominal aortic aneurysm or a mutation in the abdominal aortic aneurysm-related SNP site rs7851696.
[0012] Furthermore, the abdominal aortic aneurysm-related SNP site rs7851696 mutation refers to the 6424G>T mutation.
[0013] Furthermore, the detection of abdominal aortic aneurysm refers to detecting whether the genotype of the SNP site rs7851696 in the subject's DNA has a 6424G>T mutation.
[0014] Furthermore, the reagents include RNase-free water, 2×SYBR Green Master Mix, the detection primers described in the first aspect, a positive quality control, and a negative quality control.
[0015] Furthermore, the kit is a detection kit comprising the reagent.
[0016] In a third aspect, the present application provides a kit for detecting abdominal aortic aneurysm or abdominal aortic aneurysm-related SNP site rs7851696 mutation, the kit comprising: RNase-free water; 2×SYBR Green Master Mix; and the detection primer; Positive quality control, including wild-type positive plasmid and mutant positive plasmid; Negative quality control, nucleic acid-free water.
[0017] In a fourth aspect, the present application provides a method for using the above-mentioned kit, comprising the following steps: Step 1: Extraction of sample DNA; Step 2: Prepare the reaction system and perform ARMS-PCR to detect the genotype of SNP site rs7851696 in the sample DNA; Step 3: Analysis of test results and their effectiveness.
[0018] Furthermore, in step 2, the reaction conditions of ARMS-PCR are: maintaining 50°C for 2 min, 95°C for 2 min; 40 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 60 s.
[0019] Furthermore, in step 3, if the two positive quality controls produce a nonspecific band and a specific band respectively, and the negative quality control produces no band, it indicates that the experimental results are valid.
[0020] In summary, this application has the following beneficial effects: The present invention provides a detection primer for the abdominal aortic aneurysm-related SNP site rs7851696 and its application. DNA is extracted using a QIAGEN kit, specific primers are designed, and the reaction system and reaction conditions are improved to successfully complete the amplification and detection of the target gene. The method has potential clinical significance and can provide huge market value. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 : Schematic diagram of the FCN2 A258S mutation.
[0022] Figure 2 : Schematic diagram of the primer construction principle of the present invention.
[0023] Figure 3 : Schematic diagram of a sample construction according to an embodiment of the present invention. DETAILED DESCRIPTION
[0024] The technical solutions and effects of the present application are further described in detail below with reference to the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the invention, rather than to limit the invention.
[0025] This application obtained a small sample of blood samples from patients with aortic aneurysms and controls, and preliminarily verified through Sanger sequencing that the frequency of 6424G>T, i.e., FCN2 A258S, was increased in patients with aortic aneurysms. The specific steps are as follows: Collect 5 mL of whole blood from a control group of patients with abdominal aortic aneurysm using an EDTA-anticoagulant tube. 500 μL of whole blood was added to 3 volumes of red blood cell lysis buffer (0.15 M NH₄Cl + 10 mM KHCO₃), gently mixed, and incubated on ice for 10 minutes. Centrifuge (2,000 g, 10 minutes), discard the red supernatant, and retain the white blood cell pellet. Add lysis buffer (containing proteinase K and SDS) to the pellet and incubate in a 55°C water bath overnight or at 56°C for 2 hours until the solution is clear. The lysate was transferred to a spin column, treated with a high-salt buffer, and centrifuged (12,000 g, 1 minute) to allow DNA to adsorb to the silica gel membrane. Wash with ethanol to remove proteins and salts, centrifuge, and discard the waste liquid. Add 50–100 μL of TE buffer (10 mM Tris-HCl + 1 mM EDTA, pH 8.0) or sterile water, incubate at room temperature for 5 minutes, and then centrifuge to elute. Concentration was determined by UV spectrophotometry. Integrity was checked by 1% agarose gel electrophoresis: genomic DNA showed a single bright band (no degradation smear). Specific primers were designed for the target region. After PCR amplification, 5 μL of the PCR product was subjected to agarose gel electrophoresis (2% gel) to confirm that the band was single and of the expected size.
[0026] Sequencing reaction (dideoxy termination method): Reaction system (10 μL): 1–3 μL of purified PCR product (diluted to 10–30 ng / μL), 1 μL of sequencing primer (1 μM), 0.5–1 μL of BigDye Terminator v3.1, 2 μL of 5× sequencing buffer, and ddH₂O to make up to 10 μL. Cycling: Initial denaturation: 96°C, 1 minute, 25–30 cycles of: 96°C, 10 seconds, 50°C, 5 seconds, and 60°C, 4 minutes. To remove free fluorescent dye, add 2.5 μL of 125 mM EDTA (Mg²⁺ chelate) and 30 μL of anhydrous ethanol, mix thoroughly by vortexing, and incubate at room temperature for 15 minutes. Centrifuge (12,000 × g, 30 minutes), discard the supernatant, and wash the pellet twice with 60 μL of 70% ethanol. After drying the precipitate, it was dissolved in 10 μL of Hi-Di formamide, denatured at 95°C for 4 minutes, and chilled on ice. The sequence was analyzed using an ABI 3130XL sequencer.
[0027] The results are as follows Figure 1 As shown, it was preliminarily verified that 6424G>T, that is, FCN2 A258S, was increased in patients with aortic aneurysm.
[0028] Example This embodiment provides a detection primer for the abdominal aortic aneurysm-related SNP site rs7851696 and its application.
[0029] The detection primers for the abdominal aortic aneurysm-related SNP site rs7851696 implemented in the present invention include two non-specific outer primers and two inner primers for specifically detecting the SNP mutation site; The outer primers have the sequences shown in SEQ ID NO: 1 (forward primer) and SEQ ID NO: 2 (reverse primer) or their complementary sequences; The inner primers have the sequences shown in SEQ ID NO: 3 (forward primer) and SEQ ID NO: 4 (reverse primer) or their complementary sequences; SEQ ID NO. 1 is as follows: CACTGGAGTCATGGATTGCA (forward primer); SEQ ID NO. 2 is as follows: TCGCACCTTCATCTCTGACA (reverse primer); SEQ ID NO. 3 is as follows: TCTTAACACCGGAAATTGTG (forward primer); SEQ ID NO. 4 is as follows: GCTCCCTGAAACATCACAGA (reverse primer).
[0030] Two inner primers specifically detecting SNP mutation sites corresponded to the polymorphism of SNP site rs7851696 (G / T).
[0031] Testing of homozygous wild-type or mutant samples will generate a non-specific DNA product and a specific DNA primer of different lengths, while testing of heterozygous mutant samples will generate a non-specific DNA product and two specific DNA primers of different lengths. Figure 2 shown.
[0032] The application method of the detection primer comprises the following steps: 1. Extraction of sample DNA.
[0033] In this example, a QIAGEN commercial kit was used to extract sample DNA. The specific extraction steps were as follows: Take 1.6 mL of saliva sample and place it in a 2 mL centrifuge tube. Incubate in a 50°C water bath for 15 min and centrifuge at 12000 g for 5 min. Remove the supernatant and add 180 μL PBS to wash the precipitate. Then add 20 μL proteinase K and 200 μL buffer AL, vortex mix, incubate at 56°C for 60 min, then add 200 μL anhydrous ethanol, vortex mix, centrifuge, transfer to a QIAamp Mini spin column, centrifuge at 6000 g for 1 min, and replace with a new collection tube; add 500 μL buffer AW1, centrifuge at 6000 g for 1 min, and replace with a new collection tube; add 500 μL buffer AW2, centrifuge at 20000 g for 3 min, replace with a new collection tube, centrifuge at full speed, and finally add 60 μL buffer AE to elute the sample.
[0034] 2. PCR amplification.
[0035] The primers for the PCR reaction are: SEQ ID NO.1 is as follows: CACTGGAGTCATGGATTGCA (forward primer) SEQ ID NO. 2 is as follows: TCGCACCTTCATCTCTGACA (reverse primer) SEQ ID NO.3 is as follows: TCTTAACACCGGAAATTGTG (forward primer) SEQ ID NO. 4 is as follows: GCTCCCTGAAACATCACAGA (reverse primer).
[0036] Prepare eight PCR tubes and add the following reaction mixture: 3.6 μM RNase-free water, 5 μM 2× SYBR Green Master Mix, and 0.4 μM Primer Mix. Add 1 μM sample DNA, wild-type positive plasmid, mutant positive plasmid, and nuclease-free water to each of the eight tubes. Each reaction is performed in duplicate.
[0037] The reaction conditions of the ARMS-PCR were as follows: maintaining at 50° C. for 2 min, 95° C. for 2 min, and 40 cycles of 95° C. for 15 s, 56° C. for 15 s, and 72° C. for 60 s.
[0038] Among them, the positive quality control includes 500 copies of the positive plasmid pUC57-3040 of the wild-type and mutant SNP sites rs7851696; Negative quality control, nucleic acid-free water.
[0039] 3. Analysis of test results and their effectiveness.
[0040] 1. Weigh an appropriate amount of agarose powder to prepare a 1.5% agarose solution. Place the solution in a conical flask and add an appropriate amount of 0.5× TBE electrophoresis buffer. Heat in a microwave oven until completely dissolved and the solution becomes transparent. Shake briefly to obtain a gel solution. Cool to approximately 60°C and add an appropriate amount of ethidium bromide to a concentration of 0.5 μg / ml.
[0041] 2. Take the organic glass rubber plate slot, seal it tightly with transparent tape around the slot, and add a small amount of glue to seal the gap between the tape and the slot.
[0042] 3. Place the glue tank horizontally, insert a comb at one end, and slowly pour glue liquid that has cooled to about 60°C into the tank to form a uniform and level glue surface.
[0043] 4. After the gel solidifies, carefully pull out the comb, tear off the transparent tape, and place the sample well end with the cathode segment into the electrophoresis tank.
[0044] 5. Add 0.5×TBE electrophoresis buffer to the tank until the liquid level covers the gel surface. 6. Carefully mix the sample to be tested on a clean glass slide according to the following amounts and pipette it into the sample wells of the gel: 1 μl of loading buffer (6×) + 5 μl of the DNA sample to be tested.
[0045] 7. Connect the electrophoresis apparatus and electrophoresis tank, and then turn on the power supply. Adjust the voltage regulator output to a maximum of 5 V / cm and begin electrophoresis. Place the sample application end on the cathode end. Adjust the voltage based on experience to ensure clear banding.
[0046] 8. Observe the movement of the bromophenol blue band (blue). Stop electrophoresis when it moves to about 1 cm from the front edge of the gel plate.
[0047] 9. Staining: Take out the glue tank, slide out the glue block carefully, place it horizontally on a piece of plastic wrap or other support, put it into EB solution for staining, and soak it completely for about 30 minutes.
[0048] 10. Place a new sheet of plastic wrap on the sample stage of the UV analyzer, remove any bubbles, and lay it flat. Then place the stained gel on top. Close the sample chamber door, turn on the UV lamp (360nm or 254nm), and observe through the observation port.
[0049] If the two positive quality controls produce one nonspecific band and one specific band respectively and the negative quality control produces no band, the experimental results are valid.
[0050] By comparing the sample DNA with the specific bands of the two positive quality controls, the genotype and homozygosity of the sample DNA SNP site rs7851696 can be analyzed. Figure 3 As shown in the figure, samples 1 and 2 are abdominal aortic aneurysm samples (taken from diseased tissues of patients with abdominal aortic aneurysm) and mutant samples, respectively, and samples 3 and 4 are normal abdominal aorta samples (normal abdominal aorta samples obtained through liver transplantation surgery) and wild-type samples, respectively.
[0051] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.
Claims
1. A detection primer for the abdominal aortic aneurysm-related SNP site rs7851696, characterized in that: The detection primers include two non-specific outer primers and two inner primers for specifically detecting SNP mutation sites; The outer primers include a forward primer as shown in SEQ ID NO: 1 and a reverse primer as shown in SEQ ID NO: 2; The inner primers include a forward primer as shown in SEQ ID NO: 3 and a reverse primer as shown in SEQ ID NO: 4; Two of the inner primers that specifically detect SNP mutation sites correspond to the polymorphism of SNP site rs7851696.
2. Use of the detection primers for the abdominal aortic aneurysm-associated SNP site rs7851696 according to claim 1 in the preparation of a reagent or kit for detecting abdominal aortic aneurysm or a mutation in the abdominal aortic aneurysm-associated SNP site rs7851696.
3. The use according to claim 2, characterized in that The abdominal aortic aneurysm-related SNP site rs7851696 mutation refers to the 6424G>T mutation.
4. The use according to claim 2, characterized in that The detection of abdominal aortic aneurysm refers to detecting whether the SNP site rs7851696 genotype of the subject's DNA has a 6424G>T mutation.
5. The use according to claim 2, characterized in that The reagents include RNase-free water, 2×SYBR Green Master Mix, the detection primers according to claim 1, a positive quality control, and a negative quality control.
6. The use according to claim 2, characterized in that The kit is a detection kit comprising the reagent according to claim 5.
7. A kit for detecting abdominal aortic aneurysm or abdominal aortic aneurysm-related SNP site rs7851696 mutation, characterized in that: The kit comprises: RNase-free water; 2×SYBR Green Master Mix; And the detection primer according to claim 1; Positive quality control, including wild-type positive plasmid and mutant positive plasmid; Negative quality control, nucleic acid-free water.
8. The method for using the kit according to claim 7, characterized in that: The steps include: Step 1: Extraction of sample DNA; Step 2: Prepare the reaction system and perform ARMS-PCR to detect the genotype of SNP site rs7851696 in the sample DNA; Step 3: Analysis of test results and their effectiveness.
9. The method of use according to claim 8, characterized in that: In step 2, the reaction conditions of ARMS-PCR are: maintaining 50° C. for 2 min, 95° C. for 2 min; and 40 cycles of 95° C. for 15 s, 56° C. for 15 s, and 72° C. for 60 s.
10. The method of use according to claim 8, characterized in that: In step 3, if the two positive quality controls produce a nonspecific band and a specific band respectively, and the negative quality control produces no band, it indicates that the experimental results are valid.
Citation Information
Patent Citations
Methods and systems for detecting tissue conditions
CN109790643A
Detection primer for SNP sites related to abdominal aortic aneurysm and application of detection primer
CN118813792A
Detection primer for SNP site rs116309149 related to abdominal aortic aneurysm and application of detection primer
CN119824092A
Detection of nucleic acid
JP1991091500A
Methods for treating aortic aneurysm disease
US20210318336A1