Maize kernel protein major QTL (Quantitative Trait Loci) and primer group, kit and method for identifying corn kernel protein major QTL

Abstract

The invention provides a major QTL (Quantitative Trait Loci) for identifying corn kernel protein as well as a primer group, a kit and a method thereof, and belongs to the field of biology. The primer group comprises a forward primer, a first reverse primer and a second reverse primer, the sequence of the forward primer is shown as SEQ ID NO: 1 in a sequence table, the first reverse primer is shown as SEQ ID NO: 2 in the sequence table, and the second reverse primer is shown as SEQ ID NO: 3 in the sequence table. When the primer group, the kit and the method provided by the embodiment are used for detection, the result is consistent with the grain protein content measured by a near infrared spectrum analyzer, and meanwhile, the method provided by the embodiment is simple and convenient to operate and clear in typing, and can be used for molecular marker-assisted selective breeding of the corn grain protein content.

Description

Technical Field

[0001] The present disclosure relates to the field of molecular biology, and in particular to a method for identifying a major QTL of a maize grain protein and a primer set, a kit, and a method thereof. Background Art

[0002] As one of the world's most important food crops, corn's nutritional value is crucial for both human and animal diets. Protein is an essential substance for maintaining life activities and is crucial for maintaining normal physiological functions of organisms. The protein content of corn directly affects its nutritional value as food and feed. In the feed industry, high-protein corn can improve animal production performance and health. However, due to the current low protein content of corn kernels, soybeans or other high-protein products need to be added to feed to meet the nutritional and growth needs of animals. my country's high dependence on soybean imports and the structural shortage of feed grains have severely constrained the development of animal husbandry. Therefore, identifying high-protein corn genes and cultivating high-yield, high-protein corn varieties are of great strategic significance for ensuring national food security.

[0003] Although a small number of genes regulating kernel protein content have been reported, the functional genes that regulate kernel protein content in maize have been identified to date, and the molecular mechanisms of kernel protein formation in maize are still poorly understood. Therefore, accurate identification of kernel protein traits is crucial for breeding high-protein maize varieties.

[0004] Public content

[0005] To address the problems of the prior art, the present disclosure provides a primer set, kit, and method for identifying a major QTL for maize grain protein. The technical solution is as follows:

[0006] In one aspect, the present disclosure provides a method for identifying a major QTL (Quantitative Trait Loci) for corn grain protein. The major QTL is used to identify corn grain protein, and the genomic position of the major QTL is Chr10:149656061-149857477 of the reference corn B73 V5 version genome.

[0007] On the other hand, the present disclosure provides a primer set for identifying the major effect QTL of corn grain protein, the primer set comprising: a forward primer, a first reverse primer and a second reverse primer, the sequence of the forward primer is shown in SEQ ID NO: 1 in the sequence listing, the first reverse primer is shown in SEQ ID NO: 2 in the sequence listing, and the second reverse primer is shown in SEQ ID NO: 3 in the sequence listing.

[0008] In yet another aspect, the present disclosure provides a kit for identifying major QTLs of maize grain protein, the kit comprising: the above primer set.

[0009] In another aspect, the present disclosure provides a method for identifying a major QTL for maize kernel protein using the above primer set, the method comprising:

[0010] The major effect QTL is used to identify the grain protein content of corn. If the base at position 149656061 of the sample to be tested is C, the sample to be tested is a high-protein sample. If the base at position 149656061 of the sample to be tested is G, the sample to be tested is a low-protein sample.

[0011] Specifically, the method further includes:

[0012] Extracting DNA from the sample to be tested;

[0013] The DNA is amplified using the primer set, the primer set comprising: a forward primer, a first reverse primer, and a second reverse primer, the sequence of the forward primer being as shown in SEQ ID NO: 1 in the sequence listing, the first reverse primer being as shown in SEQ ID NO: 2 in the sequence listing, and the second reverse primer being as shown in SEQ ID NO: 3 in the sequence listing, to obtain an amplified product;

[0014] The amplified product is scanned and analyzed by a microplate reader. If the sample to be tested is a high-protein sample, the sample to be tested displays the color of the labeled fluorescent HEX. If the sample to be tested is a low-protein sample, the sample to be tested displays the color of the labeled fluorescent FAM. The protein content of the high-protein sample is greater than or equal to 12%, and the protein content of the low-protein sample is less than 12%.

[0015] Specifically, per 10 μL of the amplification system includes: 5 μL of 2×PARMS master mix; 0.4 μL of a forward primer with a concentration of 400 nM; 0.15 μL of a first reverse primer with a concentration of 150 nM; 0.15 μL of a second reverse primer with a concentration of 150 nM; 10-100 ng of DNA; and ddH2O added to a volume of 10 μL.

[0016] Specifically, the amplification program includes: pre-denaturation at 94°C for 20 minutes; then 10 cycles, each cycle including: denaturation at 94°C for 20 seconds, annealing at 65°C to 57°C for 1 minute, and the annealing temperature is reduced by 0.8°C each cycle; then 32 cycles, each cycle including: denaturation at 94°C for 20 seconds, annealing at 57°C for 1 minute.

[0017] The beneficial effects of the technical solution provided by the embodiments of the present disclosure are as follows: the embodiments of the present disclosure provide a major QTL for identifying corn grain protein and a primer set, a kit and a method thereof. Based on genome-wide association analysis, this embodiment identified a new major QTL controlling the protein content of corn grains, which is located at the physical position of Chr10:149656061~149857477 in the fifth version of the tenth chromosome reference genome of corn. The primer set, kit and method provided by this embodiment are used for detection, and the results are consistent with the results of measuring the grain protein content by a near-infrared spectrometer. At the same time, the method provided by this embodiment is simple to operate and has clear typing, and can be used for molecular marker-assisted selection breeding of corn grain protein content. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0019] Figure 1 This is the protein content distribution diagram of the grains of the associated population provided in Example 3 of the present disclosure;

[0020] Figure 2 This is a result diagram of KASP marker typing provided in Example 3 of the present disclosure. The scattered points in the figure represent the distribution of protein content in the family grains. Each box represents the median and interquartile range and extends to the maximum and minimum values. The significance of the difference is estimated by one-way analysis of variance. DETAILED DESCRIPTION

[0021] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0022] Example 1

[0023] The present disclosure provides a primer set for identifying a major effect QTL of grain protein, the primer set comprising: a forward primer, a first reverse primer, and a second reverse primer, the sequence of the forward primer being as shown in SEQ ID NO: 1 in the sequence listing, specifically: TTCAATCTCTTCTCCAGATAGCCG, the first reverse primer being as shown in SEQ ID NO: 2 in the sequence listing, specifically: GAAGGTGACCAAGTTCATGCT AGAA ATCACAAGAAGGTTTGTCAG, used to identify haplotype G with low protein content, wherein the underlined portion is the FAM fluorescent linker sequence, and the second reverse primer is shown in SEQ ID NO: 3 in the sequence listing, specifically: G AAGGTCGGAGTCAACGGATTAGAAATCACAAGAAGGTTTG TCAC is used to identify haplotype C with high protein content. The underlined portion is the HEX fluorescent linker sequence. The forward primer is specific for the marker site, and the first and second reverse primers are specific for the SNP allele.

[0024] Example 2

[0025] The present disclosure provides a kit for identifying major effect QTLs of grain proteins, the kit comprising: the above primer set.

[0026] Example 3

[0027] The present disclosure provides a method for identifying a major QTL for grain protein using the above primer set, the method comprising:

[0028] The main QTL is used to identify the grain protein content of the test sample. The genomic location of the main QTL is Chr10:149656061-149857477 in the reference maize B73 V5 genome. If the base at position 149656061 is C, the test sample is a high-protein sample. If the base at position 149656061 is G, the test sample is a low-protein sample. Sequencing, TaqMan probes, AS-PCR, molecular beacons, high-resolution melting curve analysis, CAPS, SNaPshot, KASP, PARMS, gene chips, and mass spectrometry can be used for identification.

[0029] Specifically, the method provided in this embodiment also includes:

[0030] Extract DNA from the sample to be tested; in this example, the CTAB (Cetyltrimethyl Ammonium Bromide) method was used to extract a small amount of DNA from corn (Saghai-Maroof et al 1984).

[0031] Amplifying DNA using a primer set to obtain an amplified product;

[0032] The sequence of the amplified product is scanned. If the base at position 149,656,061 of the amplified product is C, the sample to be tested is a high-protein sample. If the base at position 149,656,061 of the amplified product is G, the sample to be tested is a low-protein sample. The reference genome of maize used in the present invention is Zm-B73-REFERENC E-NAM-5.0.

[0033] Specifically, the amplified product is scanned and analyzed by an enzyme-labeled instrument. If the sample to be tested is a high-protein sample, the sample to be tested will show green fluorescence of the labeled fluorescent marker HEX. If the sample to be tested is a low-protein sample, the sample to be tested will show blue fluorescence of the labeled fluorescent marker FAM.

[0034] Specifically, the amplified product was scanned using a Tecan F200 microplate reader (FAM excitation wavelength: 485 nm, emission wavelength: 520 nm; HEX excitation wavelength: 535 nm, emission wavelength: 556 nm), and the raw data obtained by scanning was analyzed using the SNPWay online tool independently developed by Jingpeptide Bio (http: / / www.snpway.com:8339 / ). Due to different software settings, if the sample to be tested is a high-protein sample and the adapter primer sequence of the amplified product is HEX, then the base at position 149656061 corresponding to the DNA template is C, and the sample to be tested shows green fluorescence labeled with HEX; if the sample to be tested is a low-protein sample and the adapter primer sequence of the amplified product is FAM, then the base at position 149656061 corresponding to the DNA template is G, then the sample to be tested shows blue fluorescence labeled with FAM. The protein content of the high-protein sample is greater than or equal to 12%, and the protein content of the low-protein sample is less than 12%.

[0035] Specifically, each 10 μL amplification system includes: 5 μL of 2×PARMS master mix; 0.4 μL of a forward primer at a concentration of 400 nM; 0.15 μL of a first reverse primer at a concentration of 150 nM; 0.15 μL of a second reverse primer at a concentration of 150 nM; 10-100 ng of DNA; and the volume of the amplification system is brought to 10 μL with ddH2O.

[0036] Specifically, the amplification program includes: pre-denaturation at 94°C for 20 minutes; then 10 cycles, each cycle including: denaturation at 94°C for 20 seconds, annealing at 65°C to 57°C for 1 minute, and the annealing temperature is reduced by 0.8°C each cycle; then 32 cycles, each cycle including: denaturation at 94°C for 20 seconds, annealing at 57°C for 1 minute.

[0037] The samples to be tested selected in this embodiment are shown in Table 1, and all the samples to be tested are from Hubei Academy of Agricultural Sciences.

[0038] Table 1 is the evaluation of corn kernel protein content

[0039]

[0040]

[0041]

[0042] The samples listed in Table 1 were measured for kernel protein content using a near-infrared spectrometer. Each sample was measured twice, and the average value was taken. Comparison revealed that the kernel protein content determined by the near-infrared spectrometer was consistent with the identification results provided in the Examples of the present invention. These results confirm that the developed functional markers can be used for marker-assisted selection for genetic improvement of maize kernel protein traits, providing targets for the development of new high-protein maize germplasm and the breeding of new high-protein varieties.

[0043] Due to space limitations, this example only lists the amplification product sequences of the high-protein material HZ32 (Huayu No. 3 male parent) and the low-protein material WY203200 (Kenfeng No. 15 male parent). The sequence of the amplification product of HZ32 is shown in SEQ ID NO: 4 in the sequence listing, specifically: AGAAATCACAAGAAGGTTTGTCACAGCAGTAGGAACAAGAACAAGCG GCGGCGGCGG CGGCTATCTGGAGAAGAGATTGAA (The underline is the HEX fluorescent linker sequence); the linker primer sequence of the amplified product is HEX, and its base at position 149656061 is C. HZ32 shows green fluorescence of the labeled fluorescence HEX, which is a high-protein sample. The protein content is determined to be greater than or equal to 12%, which is consistent with the actual situation of this variety and the grain protein content determined by the near-infrared spectrometer.

[0044] The sequence of the amplified product of WY203200 is shown in SEQ ID NO: 5 in the sequence listing, specifically: AGAAATCACAAGAAGGTTTGTCAGAGCAGTAGGAACAAGAACAAGCG GCGGCGGCGG CGGCTATCTGGAGAAGAGATTGA A (the underlined sequence is the FAM fluorescent linker sequence). The linker primer sequence of the amplified product is FAM, and its base at position 149656061 is G. WY203200 then displays blue fluorescence labeled with FAM, indicating it is a low-protein sample with a protein content of less than 12%, which is consistent with the actual results of this variety and the grain protein content measured by near-infrared spectrometer.

[0045] The grain protein data of 588 inbred line population-related population materials were tested in seven environments in Shihezi, Xinjiang (XJ), Lingshui, Hainan (HN), Ezhou, Hubei (EZ) and Gucheng, Hubei (GC) over two years (2022 to 2024). The measured results are shown in Table 2.

[0046] Table 2 shows the phenotypic statistical analysis of the association group.

[0047]

[0048] As shown in Table 2, the phenotypic variation of grain protein content was 8.28% to 15.62%. The average value of grain protein content of the related population materials under 7 environments was calculated, and the protein content had an obvious normal distribution. Figure 2 It can be seen that there are 3 inbred lines with protein content greater than 14%, 12 inbred lines with protein content less than 10%, 130 inbred lines with protein content greater than or equal to 10% and less than 11%, 274 inbred lines with protein content greater than or equal to 11% and less than 12%, 144 inbred lines with protein content greater than or equal to 12% and less than 13%, and 25 inbred lines with protein content greater than or equal to 13% and less than 14%. Therefore, the major effect QTL qHP10.2 controlling maize grain protein content is located on chromosome 10 and has been repeatedly identified in two environments: Ezhou, Hubei (23EZ) in 2023 and Gucheng, Hubei (24GC) in 2024. In this example, a new major QTL for maize kernel protein content, qHP10.2, was identified based on genome-wide association analysis. This interval encompasses six tightly linked SNPs (SNPs) spanning a total of 201.4 kb (Chr10: 149656061-149857477), designated qHP10.2. The lead SNP, 149656061 (C / G), was significantly associated with the protein content at P = 4.26E-06 and is located at base 149656061 on chromosome 10 of the maize genome (the maize B73 reference genome, Zm-B73-REFERENCE-NAM-5.0, referred to herein as the maize B73V5 reference genome).

[0049] The leader SNP with the most significant phenotypic differences at the qHP10.2 locus under seven environments was selected, and KASP markers were designed. Genotyping was performed on 41 randomly selected inbred lines from the association population (see Table 3 for details).

[0050] Table 3 shows the genotype identification of maize inbred lines.

[0051]

[0052]

[0053] Comparing the genotype results of resequencing, it was found that the results of typing using KASP markers were consistent with the resequencing results by 97.22%. Figure 2 .exist Figure 2In the figure, the green dots indicate that the linker primer sequence is HEX fluorescence, that is, the qHP10.2R2 type family has a high grain protein content, and the blue dots indicate that the linker primer sequence is FAM fluorescence, that is, the qHP10.2R1 type family has a low grain protein content. This shows that the KASP marker can effectively distinguish the two haplotypes.

[0054] The above description is merely an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the scope of protection of the present disclosure.

Claims

1. A method for identifying a major QTL for a maize kernel protein, characterized in that: The major effect QTL is used to identify corn grain protein, and the genomic position of the major effect QTL is Chr10:149656061-149857477 of the reference corn B73 V5 version genome.

2. A primer set for identifying a major QTL for maize kernel protein, characterized in that: The primer set includes: a forward primer, a first reverse primer and a second reverse primer. The sequence of the forward primer is shown in SEQ ID NO: 1 in the sequence listing, the first reverse primer is shown in SEQ ID NO: 2 in the sequence listing, and the second reverse primer is shown in SEQ ID NO: 3 in the sequence listing.

3. A kit for identifying major QTLs of maize grain protein, characterized in that: The kit comprises: the primer set according to claim 2.

4. A method for identifying a major QTL for maize grain protein using the major QTL provided in claim 1, characterized in that: The method comprises: The grain protein content of the sample to be tested is identified according to the main effect QTL. If the base at position 149656061 of the sample to be tested is C, the sample to be tested is a high-protein sample. If the base at position 149656061 of the sample to be tested is G, the sample to be tested is a low-protein sample. The protein content of the high-protein sample is greater than or equal to 12%, and the protein content of the low-protein sample is less than 12%.

5. The method according to claim 4, characterized in that The method further comprises: Extracting DNA from the sample to be tested; The DNA is amplified using the primer set, the primer set comprising: a forward primer, a first reverse primer, and a second reverse primer, the sequence of the forward primer being as shown in SEQ ID NO: 1 in the sequence listing, the first reverse primer being as shown in SEQ ID NO: 2 in the sequence listing, and the second reverse primer being as shown in SEQ ID NO: 3 in the sequence listing, to obtain an amplified product; The amplified product is scanned and analyzed by an enzyme marker. If the sample to be tested is a high-protein sample, the sample to be tested will display the color of the labeled fluorescence HEX. If the sample to be tested is a low-protein sample, the sample to be tested will display the color of the labeled fluorescence FAM.

6. The method according to claim 5, characterized in that The amplification system per 10 μL includes: 5 μL of 2×PARMS master mix; 0.4 μL of a forward primer with a concentration of 400 nM; 0.15 μL of a first reverse primer with a concentration of 150 nM; 0.15 μL of a second reverse primer with a concentration of 150 nM; 10-100 ng of DNA; and ddH2O added to a volume of 10 μL.

7. The method according to claim 5, characterized in that The amplification program includes: pre-denaturation at 94°C for 20 minutes; then 10 cycles, each cycle including: denaturation at 94°C for 20 seconds, annealing at 65°C to 57°C for 1 minute, with the annealing temperature decreasing by 0.8°C each cycle; then 32 cycles, each cycle including: denaturation at 94°C for 20 seconds, annealing at 57°C for 1 minute.

Images