A method for identifying a major-effect qtl of corn kernel protein and a primer set and a kit thereof

Abstract

The disclosure provides a kind of identification corn kernel protein major QTL and its primer group, kit and method, belong to biological field.The primer group includes: forward primer, first reverse primer and second reverse primer, the sequence of the forward primer is as shown in SEQ ID NO:1 in the sequence listing, the first reverse primer is as shown in SEQ ID NO:2 in the sequence listing, and the second reverse primer is as shown in SEQ ID NO:3 in the sequence listing.The primer group, kit and method provided in the embodiment are used for detection, the result is consistent with the determination grain protein content of near infrared spectroscopy analyzer, meanwhile, the method provided in the embodiment is simple and clear in operation, and can be used for corn kernel protein content molecular marker assisted selection breeding.

Description

Technical Field

[0001] This disclosure relates to the field of molecular biology, and in particular to a primer set, kit, and method for identifying major QTLs of maize kernel proteins. Background Technology

[0002] As one of the world's most important food crops, corn's nutritional value is crucial for both human and animal diets. Protein is a fundamental substance for maintaining life activities and is essential for the normal physiological functions of organisms. The protein content of corn directly affects its nutritional value as food and feed. In the feed industry, high-protein corn can improve animal production performance and health. However, due to the currently low protein content in corn kernels, soybeans or other high-protein products need to be added to feed to meet the nutritional and growth needs of animals. my country's high dependence on soybean imports and the severe structural shortage of feed grains seriously restrict the development of animal husbandry. Therefore, exploring high-protein genes in corn and cultivating high-yield, high-protein corn varieties is of great strategic significance for ensuring national food security.

[0003] Although a small number of genes regulating grain protein content have been reported, the number of functional genes regulating grain protein content identified in maize is still very limited, and the molecular mechanisms of maize grain protein formation are poorly understood. Therefore, accurately identifying high-protein grain traits is of great significance for breeding high-protein maize varieties. Public content

[0004] To address the problems of existing technologies, this disclosure provides an embodiment of a method, primer set, kit, and method for identifying major-effect QTLs of maize kernel proteins, as well as their primer sets. The technical solution is as follows:

[0005] On the one hand, this disclosure provides a major QTL (Quantitative Trait Loci) for identifying maize kernel protein. The major QTL is used to identify maize kernel protein, and the genomic location of the major QTL is reference maize B73 V5 version genome Chr10: 149656061~149857477.

[0006] On the other hand, this disclosure provides a primer set for identifying maize kernel protein, the primer set comprising: a forward primer, a first reverse primer and a second reverse primer, the sequence of the forward primer being shown in SEQ ID NO: 1 in the sequence listing, the first reverse primer being shown in SEQ ID NO: 2 in the sequence listing, and the second reverse primer being shown in SEQ ID NO: 3 in the sequence listing.

[0007] In another aspect, this disclosure provides a kit for identifying maize kernel protein, the kit comprising the aforementioned primer set.

[0008] Furthermore, this disclosure provides a method for identifying maize kernel proteins using the aforementioned primer set, the method comprising:

[0009] The major-effect QTL is used to identify the protein content of corn kernels. If the base at position 149656061 of the sample to be tested is C, then the sample to be tested is a high-protein sample. If the base at position 149656061 of the sample to be tested is G, then the sample to be tested is a low-protein sample.

[0010] Specifically, the method further includes:

[0011] Extract DNA from the sample to be tested;

[0012] The DNA was amplified using the primer set, which includes a forward primer, a first reverse primer, and a second reverse primer. The sequence of the forward primer is shown in SEQ ID NO: 1 in the sequence listing, the first reverse primer is shown in SEQ ID NO: 2 in the sequence listing, and the second reverse primer is shown in SEQ ID NO: 3 in the sequence listing, to obtain the amplification product.

[0013] The amplification products are scanned and analyzed using an ELISA reader. If the sample to be tested is a high-protein sample, the sample to be tested will display the color of the labeled fluorescent HEX. If the sample to be tested is a low-protein sample, the sample to be tested will display the color of the labeled fluorescent FAM. The protein content of the high-protein sample is greater than or equal to 12%, and the protein content of the low-protein sample is less than 12%.

[0014] Specifically, each 10 μL amplification system comprises: 5 μL of 2×PARMS master mix; 0.4 μL of a 400 nM forward primer; 0.15 μL of a 150 nM first reverse primer; 0.15 μL of a 150 nM second reverse primer; 10-100 ng of DNA; and ddH2O added to bring the amplification system volume to 10 μL.

[0015] Specifically, the amplification program includes: pre-denaturation at 94°C for 20 min; followed by 10 cycles, each cycle including: denaturation at 94°C for 20 sec, decreasing from 65°C to 57°C, annealing for 1 min each time, with the annealing temperature decreasing by 0.8°C each cycle; followed by 32 cycles, each cycle including: denaturation at 94°C for 20 sec, annealing at 57°C for 1 min.

[0016] The beneficial effects of the technical solution provided in this disclosure are as follows: This disclosure provides a method for identifying a major QTL for maize kernel protein, its primer set, kit, and method. Based on genome-wide association analysis, this embodiment identifies a new major QTL controlling maize kernel protein content, located at Chr10: 149656061~149857477 in version 5 of the maize tenth chromosome reference genome. The results of detection using the primer set, kit, and method provided in this embodiment are consistent with those obtained by near-infrared spectroscopy. Furthermore, the method provided in this embodiment is simple to operate and provides clear typing, making it suitable for marker-assisted selection breeding of maize kernel protein content. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a distribution diagram of the protein content of related population grains provided in Embodiment 3 of this disclosure;

[0019] Figure 2 This is a result graph of KASP marker typing provided in Embodiment 3 of this disclosure. The scatter points in the graph represent the distribution of protein content in grains of families. Each box represents the median and interquartile range and extends to the maximum and minimum values. The significance of the differences is estimated by one-way ANOVA. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below with reference to the accompanying drawings.

[0021] Example 1

[0022] This disclosure provides a primer set for identifying major QTLs of seed proteins. The primer set includes: a forward primer, a first reverse primer, and a second reverse primer. The sequence of the forward primer is shown in SEQ ID NO: 1 in the sequence listing, specifically: TTCAATCTCTTCTCCAGATAGCCG. The first reverse primer is shown in SEQ ID NO: 2 in the sequence listing, specifically: GAAGGT GACCAAGTTCATGCT AGAAATCACAAGAAGGTTTGTCAG is used to identify haplotype G with low protein content. The underlined part is the FAM fluorescent linker sequence. The second reverse primer is shown as SEQ ID NO: 3 in the sequence listing, specifically: GAAGGTC GGAGTCAACGGATT AGAAATCACAAGAAGGTTTGTCAC is used to identify haplotype C with high protein content. The underlined part is the HEX fluorescent adapter sequence. The forward primer is a marker-specific primer, and both the first and second reverse primers are SNP allele-specific primers.

[0023] Example 2

[0024] This disclosure provides a kit for identifying major QTLs of seed proteins, the kit comprising: the primer set described above.

[0025] Example 3

[0026] This disclosure provides a method for identifying major-effect QTLs of seed proteins using the above-mentioned primer set, the method comprising:

[0027] Major QTLs are used to identify the grain protein content of test samples. The genomic location of the major QTL is Chr10: 149656061~149857477 in the reference maize B73 V5 genome. If the base at position 149656061 is C, the test sample is a high-protein sample; if the base at position 149656061 is G, the test sample is a low-protein sample. In practice, sequencing, TaqMan probe assay, AS-PCR, molecular beacon assay, high-resolution melting curve assay, CAPS assay, SNaPshot assay, KASP assay, PARMS assay, gene chip assay, and mass spectrometry can be used for identification.

[0028] Specifically, the method provided in this embodiment further includes:

[0029] DNA was extracted from the sample to be tested. In this embodiment, the CTAB (Cetyltrimethyl Ammonium Bromide) method was used for small-scale DNA extraction from maize (Saghai-Maroof et al 1984).

[0030] DNA was amplified using a primer set to obtain the amplification product;

[0031] The sequence of the amplified product is scanned. If the base at position 149656061 of the amplified product is C, the sample to be tested is a high-protein sample; if the base at position 149656061 of the amplified product is G, the sample to be tested is a low-protein sample. The maize reference genome used in this invention is Zm-B73-REFERENCE-NAM-5.0.

[0032] Specifically, the amplification products are scanned and analyzed using an ELISA reader. If the sample to be tested is a high-protein sample, the sample will show green fluorescence labeled with HEX; if the sample to be tested is a low-protein sample, the sample will show blue fluorescence labeled with FAM.

[0033] Specifically, the amplification products were scanned using a Tecan F200 microplate reader (FAM excitation wavelength: 485nm, emission wavelength: 520nm; HEX excitation wavelength: 535nm, emission wavelength: 556nm). The raw data obtained from the scan were analyzed using SNPWay online tool (http: / / www.snpway.com:8339 / ) independently developed by Jingtai Biotechnology. Due to different software settings, if the sample to be tested is a high-protein sample and the adapter primer sequence of the amplification product is HEX, then the base at position 149656061 of the corresponding DNA template is C, and the sample to be tested will show green fluorescence labeled with HEX. If the sample to be tested is a low-protein sample and the adapter primer sequence of the amplification product is FAM, then the base at position 149656061 of the corresponding DNA template is G, and the sample to be tested will show blue fluorescence labeled with FAM. The protein content of high-protein samples is greater than or equal to 12%, and the protein content of low-protein samples is less than 12%.

[0034] Specifically, each 10 μL amplification system includes: 5 μL of 2×PARMS master mix; 0.4 μL of 400 nM forward primer; 0.15 μL of 150 nM first reverse primer; 0.15 μL of 150 nM second reverse primer; 10-100 ng of DNA; and the amplification system volume is brought up to 10 μL with ddH2O.

[0035] Specifically, the amplification program includes: pre-denaturation at 94℃ for 20 min; followed by 10 cycles, each cycle consisting of denaturation at 94℃ for 20 sec and annealing at 65℃~57℃ for 1 min, with the annealing temperature decreasing by 0.8℃ each cycle; and then 32 cycles, each cycle consisting of denaturation at 94℃ for 20 sec and annealing at 57℃ for 1 min.

[0036] The samples selected for testing in this embodiment are shown in Table 1, and all samples were obtained from the Hubei Academy of Agricultural Sciences.

[0037] Table 1 shows the evaluation of protein content in corn kernels.

[0038]

[0039]

[0040] The protein content of the samples provided in Table 1 was determined using a near-infrared spectroscopy analyzer. Each sample was measured twice, and the average value was taken. Comparison showed that the protein content measured by the near-infrared spectroscopy analyzer was consistent with the identification results provided in the embodiments of this invention. These results confirm that the developed functional markers can be used for marker-assisted selection in the genetic improvement of maize kernel protein traits, providing selection targets for creating new high-protein maize germplasm and breeding new high-protein varieties.

[0041] Due to space limitations, this embodiment only lists the amplification product sequences of the high-protein material HZ32 (parent of Huayu 3) and the low-protein material WY203200 (parent of Kenfeng 15). The amplification product sequence of HZ32 is shown in SEQ ID NO: 4 in the sequence listing, specifically: AGAAATCACAAGAAGGTTTGTCACAGCAGTAGGAACAAGAACAAGCGGCGGCGGCGG CGGCTATCTGGAGAAGAGATTGAA (The underlined part is the specific primer sequence for the labeling site); the adapter primer sequence of the amplified product is HEX, with C at position 149656061. HZ32 shows green fluorescence of the labeled HEX, indicating that it is a high-protein sample with a protein content greater than or equal to 12%, which is consistent with the actual situation of this variety and the protein content of the grains measured by the near-infrared spectroscopy analyzer.

[0042] The sequence of the amplified product of WY203200 is shown in SEQ ID NO: 5 in the sequence listing, specifically: AGAAATCACAAGAAGGTTTGTCAGAGCAGTAGGAACAAGAACAAGCGGCGGCGGCGG CGGCTATCTGGAGAAGAGATTGAA (The underlined part is the marker site specific sequence). The adapter primer sequence of the amplification product is FAM, and its base at position 149656061 is G. WY203200 shows blue fluorescence of the labeled fluorescent FAM, which indicates that it is a low protein sample with a protein content of less than 12%, which is consistent with the actual situation of this variety and the protein content of the grain determined by the near-infrared spectroscopy analyzer.

[0043] Grain protein data were collected from 588 inbred line populations in seven environments over two years (2022-2024): Shihezi (XJ), Lingshui (HN), Ezhou (EZ), and Gucheng (GC) in Hubei Province. The results are shown in Table 2.

[0044] Table 2 shows the phenotypic statistical analysis of the associated groups.

[0045]

[0046] Table 2 shows that the phenotypic variation in grain protein content ranged from 8.28% to 15.62%. The average grain protein content of the associated population materials under seven environments was calculated, revealing a clear normal distribution. Figure 2 It was found that there were 3 inbred lines with a protein content greater than 14%, 12 inbred lines with a protein content less than 10%, 130 inbred lines with a protein content greater than or equal to 10% and less than 11%, 274 inbred lines with a protein content greater than or equal to 11% and less than 12%, 144 inbred lines with a protein content greater than or equal to 12% and less than 13%, and 25 inbred lines with a protein content greater than or equal to 13% and less than 14%. Therefore, the major QTL controlling the protein content of maize kernels is qHP10.2, which is located on chromosome 10 and was repeatedly identified in two environments: Ezhou, Hubei (23EZ) in 2023 and Gucheng, Hubei (24GC) in 2024. This embodiment identifies a novel major-effect QTL, qHP10.2, controlling protein content in maize kernels based on genome-wide association analysis. This region contains six tightly linked SNPs with a total length of 201.4 kb (Chr10:149656061-149857477), named qHP10.2. The lead SNP 149656061 (C / G) at qHP10.2 locus is significantly associated at P=4.26E-06, located at base 149656061 on chromosome 10 of the maize genome (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to in this invention as the maize B73V5 reference genome).

[0047] The leader SNP with the most significant phenotypic differences at the qHP10.2 locus in 7 environments was selected, and KASP markers were designed. Genotyping was performed on 41 inbred lines randomly selected from the associated population, as detailed in Table 3.

[0048] Table 3 shows the genotype identification of maize inbred lines.

[0049]

[0050]

[0051] Comparing the genotyping results with those obtained from resequencing, it was found that the KASP marker-based genotyping results showed a 97.22% agreement with the resequencing results. (See details...) Figure 2 .exist Figure 2In the diagram, green dots indicate that the adapter primer sequence is HEX fluorescent, meaning that the qHP10.2R2 family has a high grain protein content, while blue dots indicate that the adapter primer sequence is FAM fluorescent, meaning that the qHP10.2R1 family has a low grain protein content. This demonstrates that the KASP marker can effectively distinguish between the two haplotypes.

[0052] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.

Claims

1. A method for identifying protein in corn kernels, characterized in that, The method includes: Extract DNA from the sample to be tested; The DNA was amplified using a primer set comprising: a forward primer, a first reverse primer, and a second reverse primer. The sequence of the forward primer is shown in SEQ ID NO: 1 in the sequence listing. The first reverse primer is shown in SEQ ID NO: 2 in the sequence listing, and is connected to a FAM fluorescent adapter with the sequence: GAAGGTGACCAAGTTCATGCT. The second reverse primer is shown in SEQ ID NO: 3 in the sequence listing, and is connected to a HEX fluorescent adapter with the sequence: GAAGGTCGGAGTCAACGGATT. The amplification product was obtained. The amplification products are scanned and analyzed using an ELISA reader. If the sample to be tested is a high-protein sample, the sample to be tested will display the color of the labeled fluorescent HEX. If the sample to be tested is a low-protein sample, the sample to be tested will display the color of the labeled fluorescent FAM. The protein content of the high-protein sample is greater than or equal to 12%, and the protein content of the low-protein sample is less than 12%.

2. The method according to claim 1, characterized in that, Each 10 μL amplification system comprises: 5 μL of 2×PARMSmaster mix; 0.4 μL of a 400 nM forward primer; 0.15 μL of a 150 nM first reverse primer; 0.15 μL of a 150 nM second reverse primer; 10–100 ng of DNA; and ddH2O added to bring the amplification system volume to 10 μL.

3. The method according to claim 1, characterized in that, The amplification program includes: pre-denaturation at 94°C for 20 min; followed by 10 cycles, each cycle including: denaturation at 94°C for 20 sec, decreasing from 65°C to 57°C, annealing for 1 min each time, with the annealing temperature decreasing by 0.8°C each cycle; followed by 32 cycles, each cycle including: denaturation at 94°C for 20 sec, annealing at 57°C for 1 min.

Images