Method and primer group for identifying interspecific distant hybrid filial generation of lycoris radiate and hippeastrum rutilum and application of primer group

Abstract

The invention belongs to the field of molecular biology, and discloses a method and a primer group for identifying interspecific distant hybrid filial generation of lycoris radiate and hippeastrum rutilum and application of the method and the primer group. A far-source specific primer group capable of identifying the hybrid offspring of the lycoris radiata and the hippeastrum hippeastrum is screened out, aiming at classification and identification of plants of various types and numbers, accurate identification of the interspecific hybrid offspring of the lycoris radiata and the hippeastrum hippeastrum can be conveniently and quickly realized by adopting the primer group, and both the speed and the effect are better; fluorescence labeling is applied to an SSR molecular labeling system, band information is obtained through the capillary electrophoresis technology, an existing SSR technical system is optimized and improved, and compared with silver staining detection and agarose condensation detection, automatic fluorescence detection has the advantages of being high in throughput and automatic in operation.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a method for identifying distant hybrid progenies of Lycoris radiata and Hippeastrum, a primer set and application thereof. Background Art

[0002] Lycoris and Hippeastrum are both perennial bulbous flowers in the Amaryllis family. Lycoris has both ornamental and medicinal properties, with strong resistance, good adaptability, and few pests and diseases. It holds great potential for industrial production in landscaping, cut flowers, and potted plants. Lycoris bulbs are also rich in medicinal alkaloids. Its extract, galantamine, is a first-line treatment for Alzheimer's disease. Currently included in the United States Pharmacopoeia, the European Pharmacopoeia, and the Chinese Pharmacopoeia, it is listed as a basic medical insurance drug and approved for marketing in major markets worldwide. Alkaloids also possess anticancer, antibacterial, antimalarial, antiviral, and cardiovascular protective properties. The lectins in Lycoris have insect repellent properties, and the bulbs contain various components, such as starch, saccharide gum, dextrin, and polysaccharides, which can be used to produce industrial alcohol, paper, and coatings, offering potential for industrial energy development. Therefore, the development and utilization of Lycoris genus plants meets the needs of the healthcare industry and holds significant social significance and industrial prospects. However, Lycoris radiata bulbs develop slowly, typically taking 5-7 years from seed to flower, and there's room for improvement in flower shape and color diversity. Amaryllis has been a relatively successful flower in recent years, enjoying strong sales in the home gardening market. Its short growth cycle, from sowing to flowering in 2-3 years, produces large bulbs and boasts a rich variety of flower shapes and colors. Interspecific hybridization is one method for creating new germplasm. By hybridizing Lycoris radiata and Amaryllis, can we combine the excellent traits of both parents, aggregate high-quality genes, and create new materials that are both ornamental, adaptable, and functional? Currently, there are no reports on this in hybridization between Lycoris radiata and Amaryllis. Accurately identifying the authenticity of hybrid offspring is another key challenge after creation. Summary of the Invention

[0003] In order to solve the problems in the above background technology, the present invention provides a method for identifying distant hybrid progenies of Lycoris radiata and Hippeastrum, a primer set and application thereof.

[0004] The present invention is achieved through the following technical solutions:

[0005] An EST-SSR molecular marker primer set for identifying interspecific hybridization progeny between Lycoris radiata and Hippeastrum truncatum.

[0006] It includes a forward primer as shown in SEQ ID NO: 1 and a reverse primer as shown in SEQ ID NO: 2:

[0007] Forward primer YYZJ-5-F sequence: CCCCAAAACCCTATCCCTAA (SEQ ID NO: 1)

[0008] and reverse primer YYZJ-5-R sequence: CCCAACCGTATCCCTGATAA (SEQ ID NO: 2).

[0009] The present application also provides the use of the EST-SSR primer set for identifying interspecific distant hybridization progeny of Lycoris radiata and Hippeastrum in preparing a product for identifying interspecific hybridization progeny of Lycoris radiata and Hippeastrum.

[0010] The present application also provides a kit for identifying interspecific distant hybridization progeny of Lycoris radiata and Hippeastrum truncatum, wherein the kit comprises the EST-SSR primer set according to claim 1.

[0011] The present application also provides a chip for identifying interspecific distant hybridization progeny between Lycoris radiata and Hippeastrum, wherein the chip comprises the EST-SSR primer set according to claim 1.

[0012] The present application also provides a method for identifying interspecific distant hybridization progeny between Lycoris radiata and Hippeastrum truncatum, the method comprising amplifying the target gene to be detected using the EST-SSR primer set according to claim 1.

[0013] The method comprises the following steps:

[0014] Extract genomic DNA from parents and offspring to be tested;

[0015] Performing PCR amplification using the EST-SSR primer set to obtain an amplified product;

[0016] The amplified products are detected. If the offspring sample shows complementary bands of both parents, it is a true hybrid offspring; if only the maternal band is shown, it is a false hybrid offspring.

[0017] Preferably, the reaction system of the PCR amplification system mainly includes: 1 μL genomic DNA, 0.5 μL 10 mM dNTP, 0.5 μL each of 3.2 pM forward primer and reverse primer, 2.5 μL 10× PCR Buffer, 2 μL 25 mM MgCl2, 5 U·μl - 1 Add 0.2 μL of Taq enzyme and ddH2O to make up to 25 μL.

[0018] Preferably, the PCR amplification program includes: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing for 30 s, extension at 72°C for 30 s, 10 cycles; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 10 cycles, extension at 72°C for 6 min, and storage at 4°C.

[0019] Preferably, the method for detecting the amplification product comprises capillary electrophoresis.

[0020] Currently, the DNA molecular markers commonly used for resource identification in the Lycoris genus include Random Amplified Polymorphic DNA (RAPD), Simple Sequence Repeat (SSR), and single nucleotide polymorphism (SNP). Traditional marker technologies such as RAPD have limitations in terms of polymorphic information content and technical reproducibility. SSR marker technology has been widely used in biological research and identification. SSR markers fall into two categories: gSSR, which is implemented on the genome; and EST-SSR, which is implemented on the transcriptome. The former requires the creation of a DNA library, which is a complex process and relatively high cost. Transcriptome-based expressed sequence tag (SSR) markers have the advantages of high interspecies compatibility and close linkage to functional genes. Applying fluorescent markers to the SSR molecular marker system and using capillary electrophoresis technology to obtain spectral band information is an optimization and improvement of the existing SSR technology system. Compared with silver staining detection and agarose agglutination detection, automatic fluorescence detection has the characteristics of high throughput and automated operation. It is better in both speed and effect for the classification and identification of a large number of plant species.

[0021] Compared with the prior art, the present invention has the following beneficial technical effects:

[0022] The present invention applies fluorescent markers to the SSR molecular marker system and uses capillary electrophoresis technology to obtain spectral band information, which optimizes and improves the existing SSR technology system. Compared with silver staining detection and agarose agglutination detection, automatic fluorescence detection has the characteristics of high throughput and automated operation. It is more efficient and effective for the classification and identification of a large number of plant species. Currently, there are no reports on this aspect in the distant hybridization of Lycoris radiata and Hippeastrum. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention will be further described below with reference to the accompanying drawings;

[0024] Figure 1 This is the Unigene length distribution diagram of the transcriptome assembly results of the present invention.

[0025] Figure 2 This is the Unigene gene function annotation petal diagram of the present invention.

[0026] Figure 3 It is the NR sequence homology map of the present invention.

[0027] Figure 4 This is the NR species similarity map of the present invention.

[0028] Figure 5 This is the SSR density distribution diagram of the present invention.

[0029] Figure 6 This is a capillary electrophoresis detection diagram of the present invention in the YYZJ-1 primer.

[0030] Figure 7 This is a capillary electrophoresis detection diagram of the YYZJ-2 primer of the present invention.

[0031] Figure 8 This is a capillary electrophoresis detection diagram of the YYZJ-3 primer of the present invention.

[0032] Figure 9 This is a capillary electrophoresis detection diagram of the YYZJ-5 primer of the present invention.

[0033] Figure 10 Capillary electrophoresis detection diagram of YYZJ-5 primers replaced with other parents in the present invention. DETAILED DESCRIPTION

[0034] In order to more clearly understand the above-mentioned objects, features and advantages of the present invention, the present invention is described in detail below with reference to the accompanying drawings and specific embodiments. It should be noted that, in the absence of conflict, the embodiments of the present application and the features therein may be combined with each other.

[0035] Example 1: Distant hybridization affinity analysis

[0036] 1.1 Plant materials

[0037] The tested Lycoris species, Huanjinhua and diploid Lycoris, were planted in the Lycoris resource garden of the Shanghai Academy of Agricultural Sciences. The tested Amaryllis varieties, "Merry Christmas" and "Marshmallow," were purchased from Zhejiang Hong'an Horticulture Co., Ltd.

[0038] 1.2 Planting period

[0039] Preliminary planting experiments have shown that the flowering period of Lycoris radiata is generally from late July to early to mid-August, and the flowering period of diploid Lycoris radiata is generally from early to mid-August. After the imported Amaryllis bulbs have been treated with low temperatures, they can be planted around mid-June to early July to coincide with the flowering period of Seaside Lycoris radiata and diploid Lycoris radiata. If the Amaryllis has not been treated with low temperatures, it needs to be treated with induction flowering in the early stage.

[0040] 1.3 Parental trait determination

[0041] This study investigated the main morphological indicators of the parents of Lycoris radiata, diploid Lycoris radiata, and Hippeastrum cultivars "Merry Christmas" and "Marshmallow".

[0042] 1.4 Distant hybridization

[0043] Conventional pollination methods were used. Field hybridization was conducted using Amaryllis as the male parent and Lycoris radiata and diploid Lycoris radiata as the female parents. Lycoris radiata in the stage of petal coloring and budding were selected and stamens removed. Hybridization pollination was performed between 8:00 and 10:00 AM. When the flowers were fully open, pollen from the male parent was applied to the stigma. After pollination, the stigma of the female parent was promptly covered with tin foil. The growth of the female parent and the development of the ovary were continuously observed. After 20 days of pollination, the ovary expansion was recorded and the ovary expansion rate was calculated. The ovary expansion rate = total number of ovary expansions / total number of pollinations × 100%.

[0044] 2 Results and Analysis

[0045] 2.1 Investigation of traits of distant hybrid parents

[0046] The two species of Lycoris differ in flower color and shape. The variegated lycoris radiata has a multi-toned pink with blue tips, radially symmetrical lily-like flowers, and minimally curled or wrinkled petals. The lycoris radiata has a monochromatic red, bilaterally symmetrical, claw-shaped flower with highly curled or wrinkled petals. Plant height ranges from 42 to 52 cm. The main characteristics of the female and male plants are shown in Tables 1-2.

[0047] Table 1 Characteristics of hybrid female parent Lycoris radiata

[0048]

[0049] The results in Table 1 show that Lycoris radiata and Lycoris radiata both have the advantages of strong stems and well-maintained flower quality, and are highly ornamental. They can be used as female parents for distant hybridization to breed new varieties (lines) with richer flower colors, flower shapes and plant heights.

[0050] Table 2 Characteristics of the male parent Amaryllis

[0051]

[0052] The results in Table 2 show that the two types of amaryllis have different flower colors, large and colorful flowers, good petal texture, and well-maintained flower quality. They can be used as male parents for distant hybridization in order to breed new varieties or strains with diverse ornamental traits and faster growth rates.

[0053] 2.2 Distant hybridization statistics

[0054] When Lycoris radiata and Amaryllis were hybridized, the ovary expansion rate varied with the hybrid combination. The results are shown in Table 3.

[0055] Table 3 Statistics of distant hybridization between Lycoris radiata and Hippeastrum

[0056]

[0057] The results in Table 3 show that ovary enlargement occurs in all four hybrid combinations. The ovary enlargement rate for the hybrid combination of Jinhua (Huanjinhua) and "Merry Christmas" reached 62.22%. The ovary enlargement rates for the hybrid combinations of Jinhua (Huanjinhua) and "Marshmallow" were 38.76%, 10.87%, and 2.32%, respectively. Hybrid combinations with diploid Lycoris as the female parent exhibited particularly poor ovary enlargement. Subsequent observations revealed ovule developmental failure in hybrids of Lycoris and Amaryllis. Even in initially enlarged pods, only a few ovules developed normally, ultimately yielding full seeds. Many ovules were underdeveloped and shrunken. Embryo rescue will be conducted at appropriate times after pollination based on the hybridization results, hoping to obtain more hybrids.

[0058] Example 2: Molecular marker research on Lycoris radiata distant hybrid offspring

[0059] 1 Materials and Methods

[0060] 1.1 Plant materials

[0061] Lycoris and Hippeastrum germplasm resources were obtained from the Flower Germplasm Resource Nursery of the Shanghai Academy of Agricultural Sciences (31.23°N, 121.10°E). Fresh young leaves from each accession were collected, immediately frozen in liquid nitrogen, and stored in a -70°C ultra-low temperature freezer for subsequent molecular marker development and validation. Leaves from Hippeastrum 'Merry Christmas' and Amaryllis 'Croton' were collected from vegetative plants. Three biological replicates were set up. After freezing in liquid nitrogen for half an hour, the samples were stored in a -70°C ultra-low temperature freezer for subsequent transcriptome sequencing studies.

[0062] 1.2 Transcriptome sequencing, assembly, and transcript annotation

[0063] RNA was extracted using an RNA extraction kit (Tiangen Biochemical Technology Beijing Co., Ltd.). The quality of the extracted RNA was detected using a Nanodrop nucleic acid detector (Thermo Scientific) and agarose gel electrophoresis. The RNA was sent for transcriptome sequencing using the Illumina Novaseq Xplus platform. The cDNA library was constructed using TruSeq RNA Sample Preparation Kits v2 (Illumina). The cDNA library was subjected to double-end sequencing. The measured initial data were screened, and then the entire sequence was spliced to obtain the transcript sequence. The Trinity program completed the splicing and de novo assembly, which was the transcriptome sequencing file. Then, based on the comparison of BLAST (version 2.5.0) with the KEGG, NCBI NR, eggNOG and Prot databases, an E-value cutoff value of 10 was used to identify the transcriptome sequence. -5 .

[0064] 1.3 SSR locus prediction and primer design

[0065] Unigene was obtained by splicing, and SSR simple repeat sequences were searched. The MISA program was used to search for SSR sites. For 1-6 nucleotides, the minimum number of repetitions was 10, 6, 5, 5, 5, 5. In terms of the minimum number of repetitions, single nucleotides were 10 times, 2-3 nucleotides were 6 times, and 4-6 nucleotides were 5 times. By combining with Primer 3.0, SSR primers were designed in batches. The length of the amplified fragment was 80-300bp. Three pairs of primers were designed for each SSR site. Ten pairs of SSR primers (Shanghai Sangon Biotech Co., Ltd.) were randomly selected and synthesized for primer versatility and polymorphism screening. Finally, a pair of primers with good amplification effect was selected and used for subsequent hybrid offspring detection.

[0066] 1.4 DNA extraction, PCR amplification procedure and detection

[0067] The genomic DNA was extracted using the German QIAGEN kit, and the concentration and quality of the DNA were detected by 1% agarose electrophoresis and a micro-UV spectrophotometer. The DNA concentration was diluted to 25 ng·μL. -1 , and stored in a -20°C refrigerator. The extracted DNA was subjected to PCR amplification with a fluorescently labeled primer set. The reaction system was 25 μL and the main components included: 1 μL genomic DNA, 0.5 μL 10 mM dNTP, 0.5 μL each of 3.2 pM forward and reverse primers, 2.5 μL 10× PCR Buffer, 2 μL 25 mM MgCl2, 5 U·μl -1 Taq enzyme (0.2 μL) was added to 25 μL with ddH2O. The PCR program was as follows: pre-denaturation at 95°C for 3 min, followed by 10 cycles of denaturation at 95°C for 30 s, annealing for 30 s, and extension at 72°C for 30 s; followed by 10 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, followed by extension at 72°C for 6 min. The product was then stored at 4°C and analyzed by agarose gel electrophoresis.

[0068] 1.5 Cultivation of Lycoris radiata hybrid seedlings

[0069] Conventional pollination methods were used. Field hybridization was performed using Amaryllis as the male parent and Brocade lily as the female parent. Lycoris radiata in the stage of petal color and large buds was selected, and the stamens were removed. Hybridization pollination was performed between 8:00 and 10:00 a.m. When the flowers were fully open, the pollen of the male parent was applied to the stigma. After pollination, the stigma of the female parent was promptly covered with tin foil. After the seeds were set, they were collected and sown immediately after harvesting, and conventional management was followed. Young leaves were immediately placed in liquid nitrogen for half an hour, and then stored in a -70°C freezer for hybrid authenticity verification.

[0070] 2 Results and Analysis

[0071] 2.1 RNA-Seq sequencing and quality assessment

[0072] RNA-Seq analysis of leaves from Amaryllis 'Merry Christmas' and 'Melodicae' yielded 23,248,447 reads, totaling 25.83 gigabases. The base quality (Q30) (base identification accuracy above 99.9%) exceeded 94.47%, indicating good sequencing quality and suitable data for further analysis.

[0073]

[0074] 2.2 Transcriptome assembly and analysis

[0075] The clean reads were analyzed using Trinity software and de novo assembly was performed to obtain 99,965 unigenes. All sequences were arranged in order from longest to short and added in sequence. When the length reached 50% of the total length, the length of the last sequence was the N50. In this study, the N50 length was 749 bp. Statistics showed that the number of unigenes was relatively large in the range of 100 to 800 bp. For details, see Figure 1 shown.

[0076] 2.3 Unigene gene function annotation

[0077] Table 4 lists the proportion of annotation entries in the database. NR accounts for the largest proportion, accounting for 58.48%. Nr is used for comparison, and the comparison threshold is E-value less than 10 -5 , 96.62% of the annotated genes were annotated in this database. 7752 common genes were annotated in different databases (see Figure 2 ). More than 41.72% of the sequences have high homology, less than 1.0e -30 , and 30.08% are at 1.0e -30 ~1.0e -11 (For detailed results, see Figure 3 ). Comparing with the NR database, we can obtain information about the similarity of gene sequences between this species and closely related species, such as Figure 6 As shown, the species with the highest gene sequence similarity is Asparagus cochinchinensis.

[0078] Table 4 Unigene annotation statistics

[0079]

[0080] 2.4 SSR Data Analysis

[0081] The SSR transcriptome data showed a rich variety of repeat types, with various repeat motifs ranging from single nucleotides to six nucleotides. A total of 4284 SSR loci were detected in 99965 Unigenes. The repeat units of SSR were mainly 1 to 3 bases. Figure 5 The most repeated unit is a single base, accounting for 50.39%, followed by three bases and two bases, accounting for 26.56% and 14.54% respectively, while the number of repeating units of four bases and above is relatively small (see Table 5 for details).

[0082] Table 5 SSR analysis results statistics

[0083]

[0084] Note: (1) type: SSR type; p1: single amino repeat SSR, p2: double amino repeat SSR, p3: triamino repeat SSR, p4: tetraamino repeat SSR, p5: pentaamino repeat SSR, p6: hexaamino repeat SSR, c: complex amino repeat SSR, C* indicates complex type SSR with repeats. (2) number: the number of SSR genes of this type identified.

[0085] 2.5SSR primer screening and hybrid progeny identification

[0086] Based on all the sequence information measured by transcriptome sequencing in 2.1, the microsatellite identification tool (MISA) was used to obtain the information of SSR loci and combined with Primer3.0 to achieve batch design of SSR primers.

[0087] Batch primer design and screening follow the principles of specificity, appropriate length, no secondary structure formation of the product, appropriate GC content, similar annealing temperature of upstream and downstream primers, no complementarity of more than 4 bases between the primers themselves or between primers, no modification of the 5' and 3' ends of the primers, and the detection range of capillary electrophoresis is more suitable within the range of 35-500bp.

[0088] according to Figure 5 Analysis found that the richness of SSR motif types is mainly concentrated in single-base and three-base motifs, and the two account for more than 80% of the total number of SSR sites. Among them, the repetition of single bases is very unfavorable for the reading of capillary electrophoresis bands. Sometimes it is not clear whether the difference of 1bp is a degree error or a real difference. Therefore, the abundance of three-base motifs is the highest, and they are selected from three-base repeat sites first.

[0089] Based on the priority selection from the three-base repeat site, after multiple primer screening and result evaluation, suitable primers were found. Among them, the primers with good amplification effect and clear bands were synthesized into fluorescently labeled SSR primers for polymorphism analysis among different species.

[0090] Table 6 Sequence Listing of Primers 1-4

[0091]

[0092] Primers 1-4 were designed (YYZJ-1-F was recorded as SEQ ID NO: 4, YYZJ-1-R was recorded as SEQ ID NO: 5, YYZJ-2-F was recorded as SEQ ID NO: 6, YYZJ-2-R was recorded as SEQ ID NO: 7, YYZJ-3-F was recorded as SEQ ID NO: 8, and YYZJ-3-R was recorded as SEQ ID NO: 9). In real-time fluorescence PCR, the 5' ends of primers 1, 2, 3, and 4 were labeled with 6-FAM fluorescent markers to enable real-time monitoring of changes in fluorescence signals during PCR amplification.

[0093] The above 8 pairs of SSR primers were used to analyze the samples of Amaryllis "Merry Christmas" and Amaryllis radiata parents and hybrid offspring. There were large differences in the number of polymorphic bands among the 8 pairs of primers.

[0094] The result is as follows:

[0095] like Figure 6 As shown in the figure, the maternal, paternal and progeny plots of primer 1 are all mixed peaks with no target bands, and the discrimination effect is found to be poor.

[0096] like Figure 7 As shown, the female parent of primer 2 has two target bands, 176bp and 179bp respectively; the male parent does not have any bands; the offspring has two target bands, 176bp and 179bp respectively, but because the male parent has no bands, it is impossible to confirm whether it is a true hybrid offspring.

[0097] like Figure 8 As shown, the maternal map of primer 3 has a band of 227bp; the paternal map does not have any bands; the hybrid offspring map has a band of 227bp. Since the paternal map has no band, it cannot be determined whether it is a true hybrid offspring.

[0098] like Figure 9 As shown in the figure, the results of primer 4 show very clear band readings, with bands appearing at 253bp, 256bp, 262bp and 265bp, indicating that the genetic information of the hybrid offspring comes from the Amaryllis variety. The intervals between these bands are 3bp or multiples of 3bp. Finally, the primer 4 we screened out did conform to this rule. The screened specific fluorescent primer YYZJ-5 was used for capillary electrophoresis to identify the hybrid offspring and the parents. The bands of the father and mother were significantly different. The pseudo-hybrid plants in the hybrid offspring only had the sites of the mother (such as Figure 9 Progeny 2), all true hybrid offspring showed complementary heterozygous loci of both parents ( Figure 9 Progeny 1), so the developed primers can be used for early identification of hybrid progeny.

[0099] The forward primer YYZJ-5-F sequence of the present application is: CCCCAAAACCCTATCCCTAA (SEQ ID NO: 1); the reverse primer YYZJ-5-R sequence is: CCCAACCGTATCCCTGATAA (SEQ ID NO: 2). The forward primer of primer 4 of the present application is 49-68bp in the entire sequence detected by 2.1 transcriptome sequencing, and the reverse primer is 300-319bp in the entire sequence detected by 2.1 transcriptome sequencing. From the results, the band reading is very clear, and the primers we finally screened do conform to this rule. Bands appear at 253bp, 256bp, 262bp and 265bp, indicating that the genetic information of the hybrid offspring comes from the Amaryllis variety. The intervals between these bands are 3bp or multiples of 3bp.

[0100] Using the screened primer 4, the other parents were replaced: the female parent was changed from Lycoris radiata to Lycoris radiata of the Lycoris genus, and the male parent was changed from Hippeastrum paniculatum to Hippeastrum leucoderma;

[0101] The results are as follows Figure 10 As shown, a band at 203 bp remains stable, indicating that the hybrid progeny's genetic information originates from the Lycoris radiata variety. Bands appear at 265 bp and 268 bp; the hybrid progeny's genetic information originates from the Amaryllis cultivar. True hybrid progeny exhibit bands at 203 bp, 265 bp, and 268 bp. Capillary electrophoresis using the screened specific fluorescent primer YYZJ-5 was used to identify hybrid progeny and their parents. Significant differences in bands between the paternal and maternal parents were observed, indicating that the developed primers can be used for early identification of hybrid progeny.

[0102] The foregoing examples are merely illustrative of the embodiments of the present invention and are not intended to limit the present invention in any manner. The scope of protection of the present invention shall be subject to the claims and is not limited by the foregoing specific embodiments. Any simple modifications or equivalent variations and modifications made to the foregoing embodiments based on the technical essence of the present invention shall fall within the scope of protection of the present invention.

Claims

1. An EST-SSR molecular marker primer set for identifying interspecific hybridization progeny of Lycoris radiata and Hippeastrum truncatum, characterized by: It includes a forward primer as shown in SEQ ID NO: 1 and a reverse primer as shown in SEQ ID NO: 2: Forward primer YYZJ-5-F sequence: CCCCAAAACCCTATCCCTAA (SEQ ID NO: 1) and reverse primer YYZJ-5-R sequence: CCCAACCGTATCCCTGATAA (SEQ ID NO: 2).

2. Use of the EST-SSR primer set for identifying interspecific hybridization progeny of Lycoris radiata and Hippeastrum according to claim 1 in preparing a product for identifying interspecific hybridization progeny of Lycoris radiata and Hippeastrum.

3. A kit for identifying progeny of interspecific hybridization between Lycoris radiata and Hippeastrum truncatum, characterized in that: The kit comprises the EST-SSR primer set according to claim 1.

4. A chip for identifying interspecific hybridization progeny of Lycoris radiata and Hippeastrum truncatum, characterized in that: The chip comprises the EST-SSR primer set according to claim 1.

5. A method for identifying progeny of interspecific hybridization between Lycoris radiata and Hippeastrum truncatum, characterized in that: The method comprises amplifying the target gene to be detected using the EST-SSR primer set according to claim 1.

6. The method for identifying progeny of interspecific distant hybridization between Lycoris radiata and Hippeastrum according to claim 5, wherein: The method comprises the following steps: Extract genomic DNA from parents and offspring to be tested; Performing PCR amplification using the EST-SSR primer set to obtain an amplified product; The amplified products are detected. If the offspring sample shows complementary bands of both parents, it is a true hybrid offspring; if only the maternal band is shown, it is a false hybrid offspring.

7. The method for identifying progeny of interspecific distant hybridization between Lycoris radiata and Hippeastrum according to claim 5, wherein: The detection method of the amplification product includes capillary electrophoresis.

8. The method for identifying progeny of interspecific distant hybridization between Lycoris radiata and Hippeastrum according to claim 7, wherein: Taking the amplified product for electrophoresis, and judging that the gene information of the hybrid progeny is from Lycoris radiata or Amaryllis chinensis variety according to the electrophoresis result; When the electrophoresis result shows a band at 203bp, the genetic information of the hybrid offspring comes from the Lycoris radiata variety; When the electrophoresis results show bands at 253 bp, 256 bp, 262 bp and 265 bp, the genetic information of the hybrid offspring is derived from the Amaryllis variety.

9. The method for identifying progeny of interspecific distant hybridization between Lycoris radiata and Hippeastrum according to claim 5, wherein: The reaction system of the PCR amplification system mainly includes: 1 μL genomic DNA, 0.5 μL 10 mM dNTP, 0.5 μL each of 3.2 pM forward primer and reverse primer, 2.5 μL 10× PCR Buffer, 2 μL 25 mM MgCl2, 5 U·μl -1 Add 0.2 μL of Taq enzyme and ddH2O to make up to 25 μL.

10. The method for identifying progeny of interspecific hybridization between Lycoris radiata and Hippeastrum according to claim 5, wherein: The PCR amplification program includes: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 30 seconds, annealing for 30 seconds, and extension at 72°C for 30 seconds, for 10 cycles; 95°C denaturation for 30 seconds, 58°C annealing for 30 seconds, and extension at 72°C for 30 seconds, for 10 cycles, and extension at 72°C for 6 minutes, and storage at 4°C.

Images