A molecular marker for biomass yield of *Nymphoides gracilis* and its application

Abstract

This invention provides a marker combination and primers for identifying SV variant sites in *Napier grass* (a type of grass) to determine biomass yield. Combined with actual biomass yield data obtained from *Napier grass* testing, genotyping is performed. It is found that if the sequence is SEQ ID No:1 (reference), the tested *Napier grass* is a candidate germplasm with low biomass yield; if it is SEQ ID No:2 (variant), the tested *Napier grass* is a candidate germplasm with high biomass yield. Based on this result, the biomass yield of *Napier grass* germplasm can be identified quickly and easily in advance, improving the accuracy of forage yield prediction to a certain extent. This allows for the rapid screening of *Napier grass* materials or strains with high biomass yield sites for breeding.

Description

Technical Field

[0001] This invention relates to molecular biology and crop genetics and breeding, specifically to a molecular marker for biomass yield (SV) of *Nymphoides gracilis* and its application. Background Technology

[0002] American foxtail grass (Pennisetum glaucum) is an important crop with both forage and food value. Given the increasing scarcity of global arable land resources and the continued growth in livestock demand, improving its yield per unit area is of significant strategic importance. As a high-quality, high-yield forage, its weekly biomass accumulation pattern directly determines the optimal harvesting cycle and improves forage supply efficiency. Studies have shown that the biomass accumulation of this species is synergistically regulated by multiple factors, including tillering dynamics, plant height growth rate, leaf expansion speed, and regeneration capacity. Under ideal cultivation conditions, the weekly biomass increase can reach 20%-30%. However, environmental factors such as temperature, light, and water supply significantly affect yield stability, with high temperature and drought stress significantly inhibiting tillering and reducing the biomass accumulation rate. Notably, biomass characteristics are not only a key indicator of yield composition but also provide important evidence for variety identification. From a genetic perspective, different varieties exhibit significant genetic differences in tillering ability, plant height, leaf development, and regeneration capacity, which directly affect biomass accumulation efficiency. Meanwhile, growth period characteristics (such as early or late maturity) lead to final yield differences by regulating the duration of photosynthesis and assimilate allocation patterns. In the context of intensifying global climate change, breeding drought-resistant, high-yielding varieties and optimizing cultivation techniques are of significant practical value in ensuring stable and high yields of *Pennisetum alopecuroides* under abiotic stress conditions.

[0003] As an important warm-season annual grass, American foxtail grass ranks among the world's six major cereal crops. Its outstanding characteristics lie in its high protein content, high grain yield, and high biomass, and it exhibits extremely strong environmental adaptability, able to grow and develop normally in hot, arid, and infertile soil regions. It is a high-quality forage resource and bioenergy plant with great development potential in the arid northwest regions of my country. According to statistics, the global planting area of ​​American foxtail grass reached 29 million hectares in 2017.

[0004] Current research focuses on tapping the yield potential of forage grasses and accelerating the breeding of high-yielding and high-quality new varieties. Biomass yield and its formation mechanism, as a core indicator for evaluating grass forage varieties, have received widespread attention from the academic community. In-depth analysis of the molecular basis of plant regulation of biomass accumulation will provide theoretical support for the breeding of high-yielding forage grass varieties, thereby promoting the sustainable development of grassland animal husbandry.

[0005] In recent years, with the development of numerous molecular markers and the rapid advancement of bioinformatics, the application of association analysis to discover quantitative trait genes in plants has become one of the hot topics in international plant genomics research. Association analysis is based on linkage disequilibrium (LD), which is the non-random combination of alleles at different gene loci. It is a method that directly analyzes phenotypic and genotypic variations and further locates certain genes. However, this method has certain drawbacks because it mainly analyzes a single reference genome and single nucleotide polymorphisms (SNPs). Plant species exhibit high polymorphism, and a single individual's reference genome cannot encompass all the genetic information of the species. If only a single reference genome is used for studies of genetic domestication variation, much meaningful genetic code information may be lost because many unique sequences are not present in the reference genome.

[0006] Meanwhile, with the continuous development of genome sequencing technology, the application of pan-genomes has become increasingly widespread. A pan-genome is the collective term for all genes of a species, offering significant advantages in studying vastly different subspecies or varieties within the same species. In addition to providing SNPs (single nucleotide polymorphisms), pan-genomes also offer a wealth of SV (structural variation) information. SVs have a greater impact on the genome than SNPs and are better suited for explaining the characteristics of agronomic trait population diversity. Summary of the Invention

[0007] This invention provides a combination of markers for identifying SV variation sites in biomass yield of *Polygonum aviculare*, characterized in that: the markers are located at structural variation sites on chromosome 4, and the reference sequences are shown in SEQ ID No:1 and SEQ ID No:2, respectively.

[0008] This invention provides a method for detecting the genotype of the SV locus in *Napier grass* biomass yield, comprising the following steps: detecting the genotype based on the PGLA1518455 locus in the *Napier grass* genome; if the sequence is SEQ ID No:1 (reference), the *Napier grass* to be tested is a candidate germplasm with low biomass yield; if it is SEQ ID No:2 (variant), the *Napier grass* to be tested is a candidate germplasm with high biomass yield. The biomass yield referred to in this invention refers to fresh weight.

[0009] This invention provides a set of primers for identifying target genotypes of *Pennisetum purpureus*:

[0010] PGLA1518455_4: TGTGATAGGCATTAGAGTCC (SEQ ID No: 3) CCACCGCGGTTAGACTAA (SEQ ID No: 4).

[0011] This invention also provides a method for identifying the biomass yield of *Nymphoides gracilis*, including the step of PCR amplification of corresponding primers:

[0012] (1) Extraction of genomic DNA from *Foxtail grass*;

[0013] (2) Specific primers were designed for the PMA4G01902 site for subsequent PCR amplification;

[0014] (3) Using the extracted genomic DNA as a template, PCR amplification was performed using the designed specific primers to ensure that the amplified fragment contained the PGLA1518455 site. PCR conditions, such as annealing temperature and cycle number, were optimized to ensure amplification efficiency and specificity. The PCR amplification products were then used for genotyping.

[0015] The present invention also provides a product for detecting genotypes in the genome of *Nymphoides gracilis* based on the PGLA1518455 locus.

[0016] The present invention has the following beneficial effects:

[0017] This invention provides a marker combination and primers for identifying SV variant sites in *Napier grass* (a type of grass) to determine biomass yield. Combined with actual biomass yield data obtained from *Napier grass* testing, genotyping is performed. It is found that if the sequence is SEQ ID No:1 (reference), the tested *Napier grass* is a candidate germplasm with low biomass yield; if it is SEQ ID No:2 (variant), the tested *Napier grass* is a candidate germplasm with high biomass yield. Based on this result, the biomass yield of *Napier grass* germplasm can be identified quickly and easily in advance, improving the accuracy of forage yield prediction to a certain extent. This allows for the rapid screening of *Napier grass* materials or strains with high biomass yield sites for breeding. Attached Figure Description

[0018] Figure 1 Biomass yield distribution of SEQ ID NO.1 and SEQ ID NO.2 types.

[0019] Figure 2 PCR detection of PGL1542300_4. Detailed Implementation

[0020] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions.

[0021] Example 1: The PGLA1518455 locus is an SV associated with biomass yield of *Nymphoides gracilis*.

[0022] 1. Basic information on the PGLA1518455 variant site

[0023] The PGLA1518455 variant is located on chromosome 4 of the PI537069 genome, near the gene PMA4G01902.1, and is a large deletion variant. The nucleotide sequences are shown in SEQ ID No:1 and SEQ ID No:2, and their basic information is listed in Table 1.

[0024] Table 1. Basic information on the PGLA1518455 variant site

[0025]

[0026] Example 2: Genotyping of American foxtail grass germplasm based on the PGLA1518455 locus.

[0027] Genotyping of *Pennisetum affine* germplasm based on the PGLA1518455 locus was performed. Randomly selected *Pennisetum affine* varieties were tested (genotype based on PGLA1518455 locus: SEQ ID No:1 or SEQ ID No:2), and multiple primer pairs were used for PCR detection. Primers considering CG content and Tm value were combined, and the primer sequences are as follows:

[0028] Table 2. Primer sequences for detecting the PGLA1518455 variant site

[0029]

[0030] The results are as follows Figure 2 As shown in the results, PCR detection based on the marker combination PGLA1518455_4 successfully identified the target genotype in *Nymphaea repens* samples, demonstrating good specificity and stability. This marker combination can serve as an effective tool for identifying biomass and yield-related traits in *Nymphaea repens*, and has potential applications in high-yield breeding.

[0031] Example 3: Biomass yield and genotyping of American sage germplasm resources

[0032] Biomass yield was measured for the *Pennisetum alopecuroides* germplasm resources shown in Table 3, including fresh weight measurement and genotyping based on the PGLA1518455 locus using the method described in Example 2 above. The results (Table 3) show that the tested *Pennisetum alopecuroides* varieties with genotype SEQ ID No:1 based on the PGLA1518455 locus exhibit low biomass yield, while those with genotype SEQ ID No:2 exhibit high biomass yield. All *Pennisetum alopecuroides* varieties used in this invention can be obtained from the germplasm bank of Sichuan Agricultural University.

[0033] Table 3. Genotyping of American foxtail grass germplasm based on PGLA1518455 locus.

[0034]

[0035]

[0036] The results are shown in Table 3. Figure 1 The results showed that among 131 *Pennisetum humilis* germplasms, 112 varieties had the genotype SEQ ID NO.1 based on the PGLA1518455 locus, with an average biomass yield index of 8217.7; 19 germplasms had the genotype SEQ ID NO.2 based on the PGLA1518455 locus, with an average biomass yield index of 9334.0. The significance test showed P<0.05, indicating a significant difference. All biomass yields refer to fresh weight. The *Pennisetum humilis* genotype SEQ ID NO.2 had a higher average biomass yield. The discovery of the PGLA1518455 locus provides a new approach for identifying or assisting in the identification of biomass yield variations in *Pennisetum humilis* and for screening or assisting in the screening of *Pennisetum humilis* germplasms with different biomass yield characteristics.

Claims

1. A method for determining the biomass yield of *Pennisetum purpureum*, characterized in that: Includes the following steps: (1) Extraction of genomic DNA from *Foxtail grass*; (2) Design specific primers for detecting SV variant site markers of biomass yield of American foxtail grass, wherein the upstream primer of the specific primer is 5'-TGTGATAGGCATTAGAGTCC-3' and the downstream primer of the specific primer is 5'-CCACGGCGGTTAGACTAA-3'. The labeled nucleotide sequences are shown in SEQ ID No:1 and SEQ ID No:2; (3) Using the extracted genomic DNA of American foxtail grass as a template, PCR amplification was performed using the designed specific primers, and the PCR amplification products were used for genotyping. (4) When the genotype of the tested American foxtail grass is SEQ ID No:1, the American foxtail grass has the characteristic of low biomass yield; when the genotype of the tested American foxtail grass is SEQ ID No:2, the American foxtail grass has the characteristic of high biomass yield.

Images