Fluorescent quantitative PCR (Polymerase Chain Reaction) primer probe and kit for detecting abalone muscular dystrophy virus

Abstract

The invention discloses a fluorescent quantitative PCR (Polymerase Chain Reaction) primer probe and a kit for detecting abalone muscular dystrophy virus. The probe and the primer are designed for a highly conserved region of an AbSV genome, a real-time fluorescent PCR system is established, and the probe and the primer can be used for detection of abalone muscular dystrophy virus and quantitative analysis of virus load; the detection sensitivity is high, and 10 copies / mu L of viruses can be detected; the method is simple to operate, low in detection cost and wide in application range; the detection specificity is high, the detection speed is high, and the detection process can be completed in only 80 minutes.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically a method for detecting abalone muscular dystrophy virus (AbSV) based on quantitative real-time PCR technology, which is applicable to aquaculture disease monitoring, virus quantitative analysis, and epidemiological research. Background Art

[0002] 1. Overview of Abercrombie & Fever Virus Abalone is a traditional and prized ingredient in Chinese cuisine, prized for its delicious meat and rich nutritional value. It is a widely farmed marine shellfish worldwide. However, between 2010 and 2025, abalone muscular dystrophy (ASM) outbreaks have occurred in abalone farming areas in Fujian, Guangdong, and Hainan provinces of my country, causing devastating damage to the abalone farming industry in southern my country. The primary pathogen causing ASM has been identified as Abalone Shriveling Syndrome Associated Virus (AbSV).

[0003] 2. Limitations of existing detection technologies Accurate diagnosis of abalone muscular dystrophy virus using reliable detection techniques is a prerequisite for developing targeted prevention and control measures and is of great significance for the effective control of abalone muscular dystrophy. Currently, commonly used techniques for detecting abalone muscular dystrophy virus mainly include polymerase chain reaction (PCR) and immunological detection techniques. However, these techniques have certain limitations in practical applications: • Conventional PCR technology: low sensitivity, relies on electrophoresis analysis, prone to cross-contamination; cumbersome operation, unable to quantify.

[0004] • Immunological detection technology: Although it is fast, simple and inexpensive, it requires the use of high-quality and highly stable monoclonal antibodies; otherwise, the accuracy is insufficient. At present, it can only be used as an auxiliary detection method.

[0005] • Isothermal LAMP technology: Although isothermal amplification does not require complex instruments, primer design is complex (requiring 6 target regions), which is prone to non-specific amplification; the false positive rate is high, and the quantitative ability is insufficient.

[0006] 3. Advantages of Real-Time PCR Probe Method Quantitative real-time PCR (qPCR) probe method is a highly sensitive and specific nucleic acid detection method that combines PCR amplification with fluorescent probe technology. It achieves accurate quantification of target nucleic acids by introducing specific fluorescent probes and monitoring changes in fluorescence signals in real time during PCR amplification. Compared to traditional PCR technology, qPCR probe method has the following advantages: • High sensitivity: It can detect extremely low concentrations of target nucleic acids, making it suitable for the diagnosis of early viral infections.

[0007] • High specificity: Through the design of specific fluorescent probes, it is possible to accurately distinguish between target nucleic acids and non-target nucleic acids, reducing false positive results.

[0008] • Real-time: Fluorescence signals are monitored in real time during PCR amplification, eliminating the need for subsequent electrophoresis analysis and improving detection efficiency.

[0009] • Accurate quantification: By establishing a standard curve, accurate quantification of the target nucleic acid can be achieved.

[0010] 4. Development needs for real-time PCR primers, probes, and kits Given the severe impact of abalone muscular dystrophy virus (SMDV) on abalone farming and the limitations of existing detection technologies, it is particularly important to develop a primer and probe kit for detecting SMDV based on quantitative real-time PCR. This kit should have the following characteristics: • High sensitivity: capable of detecting extremely low concentrations of abalone muscular dystrophy virus nucleic acid.

[0011] • High specificity: The accuracy of detection results is ensured through the design of specific primers and probes.

[0012] • Low cost: While ensuring detection performance, the production cost of the reagent kit is reduced, making it easier to promote and apply.

[0013] In conclusion, the development of a primer and probe assay kit for detecting abalone muscular dystrophy virus based on real-time PCR is of great significance for timely and accurate diagnosis of abalone muscular dystrophy virus and for ensuring the healthy development of abalone farming. Summary of the Invention

[0014] One of the technical problems to be solved by the present invention is to provide a probe for detecting abalone muscular dystrophy virus.

[0015] The second technical problem to be solved by the present invention is to provide primers for detecting abalone muscular dystrophy virus.

[0016] The third technical problem to be solved by this invention is to provide a kit for detecting abalone muscular dystrophy virus.

[0017] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: In one aspect of the invention, a probe for detecting abalone muscular dystrophy virus is provided. This probe is designed to target a highly conserved region of the AbSV genome, and its sequence is as follows: Probe P2: CTGGCTGTATTAGACTTTGCTGGCCTTG (5' end labeled with FAM fluorescent group, 3' end labeled with BHQ1 quencher group); In another aspect of the invention, a primer for detecting abalone muscular dystrophy virus is provided. This primer is designed for a highly conserved region of the AbSV genome, and its sequence is as follows: Forward primer F2: CATTGATGGACCACGCAGTTC Reverse primer R2: GCACGAGATGTCTGTTATTAGCG; The present invention relates to a method for designing a method for detecting aberrant muscular dystrophy virus, specifically: designing forward and reverse PCR primers and corresponding fluorescent probes in highly homologous and conserved gene regions.

[0018] In another aspect of the invention, a PCR amplification kit for detecting abalone muscular dystrophy virus is provided, comprising dNTPs and Mg. 2+ The specific primers are the F and R primer pairs as described above, and the specific probes are the P probes as described above.

[0019] The principle of TaqMan probe detection in this invention is described in [link to relevant documentation]. Figure 1 Forward and reverse PCR primers and corresponding probes were designed in highly homologous and conserved regions of the gene. The probes could completely hybridize with the Bauer's muscular dystrophy virus template (i.e., Figure 1 The amplification on the left side of the image shows a detectable fluorescent signal, while in the absence of a Bauer's muscular dystrophy virus template, complete hybridization is not possible (i.e., Figure 1 (The right side of the spectrum does not hybridize), and no fluorescence signal was detected.

[0020] In another aspect of the invention, the use of the above-described probe in a baumann's muscular dystrophy virus detection kit is provided.

[0021] In another aspect of the invention, the use of the above primers in a kit for detecting abalone muscular dystrophy virus is provided.

[0022] The beneficial effects of the present invention are: 1. Sensitivity and specificity: The detection limit is as low as 10¹ copies / μL, which is superior to the LAMP method and 100 times higher than the traditional electrophoresis method; the probe method avoids non-specific amplification and has no cross-reaction with common pathogens such as Vibrio and iridovirus.

[0023] 2. Highly efficient quantification: Qualitative and quantitative analysis can be completed simultaneously in a single reaction, making it suitable for assessing the degree of infection.

[0024] 3. Compatibility: Compatible with mainstream real-time PCR instruments (such as ABI QuantStudio 5, Bio-Rad CFX96), supports high-throughput detection, and is compatible with portable real-time PCR instruments, suitable for on-site testing in farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a schematic diagram illustrating the technical principle of TaqMan in this invention. Figure 2 This is a schematic diagram of the amplification curve in Embodiment 1 of the present invention. Figure 3 This is a schematic diagram of the amplification curve in Embodiment 2 of the present invention. Figure 4 This is a schematic diagram of the amplification curve in Embodiment 3 of the present invention. DETAILED DESCRIPTION

[0026] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0027] Example 1 Specificity Verification 1. Three sets of primers and probes were designed based on conserved regions of the AbSV genome (such as the DNA polymerase gene). Group 1: F1 TAGCACCACTTGATTAGTCACAGC, R1 AATTTGGGGCTAACTGGAATG, P1 CACTTGGTTATGTCCTTGATCAATATGCTG Group 2: F2 CATTGATGGACCACGCAGTTC, R2 GCACGAGATGTCTGTTATTAGCG, P2 CTGGCTGTATTAGACTTTGCTGGCCTTG Group 3: F3 ACAGATGTGGGTGGTATTGACG, R3 CTGTCGCCCAACCATTCC, P3 TAGTAGAACTGAAAGTTGATGCACACCTG The aforementioned primers and probes were synthesized by Shanghai Flash Crystal Molecular Biotechnology Co., Ltd.

[0028] 2. Sample source: ddH2O was used as a negative control, and abalone muscular dystrophy virus DNA was used as a positive control. The DNA of common aquatic pathogens (Vibrio, iridovirus, white spot syndrome virus of shrimp, nerve necrosis virus of red-spotted grouper, largemouth bass virus, reovirus of mud crab, and bicistronic virus of mud crab) were amplified using the above three sets of primers and probes to verify the specificity of the three sets of primers and probes.

[0029] Use 2×GoldenStarTaqMasterMix (containing 0.05 U / μl Taq enzyme, 0.5 mM dNTP, PCR buffer (containing Mg) 2+ Prepare a 50 μl PCR reaction system using 10% glycerol and the above primers and probes; Reaction system: Components Volume (ul) Final concentration 2×GoldenStarTaqMasterMix 25 1 X F (25 pmol / ul) 1 0.5uM R (25 pmol / ul) 1 0.5uM P (25 pmol / ul) 0.5 0.25uM DNA template 2 4copies / ul <![CDATA[ddH2O (ul)]]> 20.5 - Total Volume (ul) 50 - The reaction was performed using an Ftc3000 real-time PCR instrument. The specific reaction program settings are as follows: 94℃, 5min; (94℃, 20s; 60℃, 30s) x40; Fam fluorescence signal detection was set at 72 degrees.

[0030] Analysis of test results: The results are as follows: Figure 2 As shown: all three sets of primers and probes have good specificity. Only the aberrant muscular dystrophy virus DNA produced an S-shaped amplification curve, while no fluorescence amplification curve was observed for the other viral DNAs. No fluorescence amplification curve was observed in the negative control.

[0031] Example 2 Sensitivity Verification 1. Three sets of primers and probes were designed based on conserved regions of the AbSV genome (such as the DNA polymerase gene). Group 1: F1 TAGCACCACTTGATTAGTCACAGC, R1 AATTTGGGGCTAACTGGAATG, P1 CACTTGGTTATGTCCTTGATCAATATGCTG Group 2: F2 CATTGATGGACCACGCAGTTC, R2 GCACGAGATGTCTGTTATTAGCG, P2 CTGGCTGTATTAGACTTTGCTGGCCTTG Group 3: F3 ACAGATGTGGGTGGTATTGACG, R3 CTGTCGCCCAACCATTCC, P3 TAGTAGAACTGAAAGTTGATGCACACCTG The aforementioned primers and probes were synthesized by Shanghai Flash Crystal Molecular Biotechnology Co., Ltd.

[0032] 2. The sensitivity of this invention was tested using recombinant plasmids constructed through genetic engineering. The plasmids were used as the detection targets: plasmid L1 was a standard plasmid with the first set of primers and probes; plasmid L2 was a standard plasmid with the first set of primers and probes; and plasmid L3 was a standard plasmid with the first set of primers and probes. These plasmids were dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH=8.0), and their mass and concentration were determined using a UV spectrophotometer. The plasmid copy number was calculated, and the plasmids were diluted with TE buffer to obtain 10–10⁻¹⁰ copies of the three plasmids. 7 A 1 / μL solution was used as a template for PCR reaction to verify sensitivity. Use 2×GoldenStarTaqMasterMix (containing 0.05 U / μl Taq enzyme, 0.5 mM dNTP, PCR buffer (containing Mg) 2+ Prepare a 50 μl PCR reaction system with the above primers and probes (10% glycerol and 10% glycerol), and make 3 replicates for each reaction.

[0033] Reaction system: Components Volume (ul) Final concentration 2×GoldenStarTaqMasterMix 25 1 X F (25 pmol / ul) 1 0.5uM R (25 pmol / ul) 1 0.5uM P (25 pmol / ul) 0.5 0.25uM template 5 <![CDATA[ddH2O (ul)]]> 17.5 - Total Volume (ul) 50 - The reaction was performed using an Ftc3000 real-time PCR instrument. The specific reaction program settings are as follows: 94℃, 5min; (94℃, 20s; 60℃, 30s) x45; Fam fluorescence signal detection was set at 72 degrees.

[0034] Analysis of test results: The results are as follows: Figure 3 As shown: neither the first nor the third group of primers and probes produced an S-shaped amplification curve at 10 copies / µL, while the second group of primers and probes produced an S-shaped amplification curve at 10 copies / µL, indicating that the second group of primers and probes has higher sensitivity and is more suitable for the detection of abalone muscular dystrophy virus.

[0035] Example 3 Stability Verification Primers and probes designed based on conserved regions of the AbSV genome (such as the DNA polymerase gene). F2 CATTGATGGACCACGCAGTTC, R2 GCACGAGATGTCTGTTATTAGCG, P2 CTGGCTGTATTAGACTTTGCTGGCCTTG 2. Using the sarcoma muscular dystrophy virus DNA from Example 1 and the 1000 copies / ul solution of L2 plasmid from Example 2 as templates, 2ul of each was used for the reaction. Each reaction was performed in 10 replicates to test the reproducibility of this kit. The reaction system was as described in Example 1.

[0036] The reaction was performed using an Ftc3000 real-time PCR instrument. The specific reaction program settings are as follows: 94℃, 5min; (94℃, 20s; 60℃, 30s) x40; Fam fluorescence signal detection was performed at 72 degrees. Analysis of test results: The results are as follows: Figure 4 As shown: The embodiments described in this invention are for illustrative purposes only and do not constitute any limitation on the scope of protection. Any technical solution based on the scope of the claims of this invention, regardless of whether it refers to the above embodiments, is subject to the protection of this patent. Those skilled in the art can make non-inventive adjustments or substitutions to the embodiments without departing from the limitations of the claims.

Claims

1. A probe for detecting abalone muscular dystrophy virus, characterized in that: The probe is designed for a highly conserved region of the AbSV genome, and its sequence is: Probe P2: CTGGCTGTATTAGACTTTGCTGGCCTTG (5' end labeled with a FAM fluorescent group, 3' end labeled with a BHQ1 quenching group); the probe is used to detect abalone muscular dystrophy virus. By analyzing the amplification curve and recording the Ct value of each reaction, it is determined whether the sample carries abalone muscular dystrophy virus and the viral load.

2. A primer for detecting abalone muscular dystrophy virus, characterized in that: The probe is designed for a highly conserved region of the AbSV genome, and its sequence is: forward primer F2: CATTGATGGACCACGCAGTTC, reverse primer R2: GCACGAGATGTCTGTTATTAGCG; the primers are used to detect abalone muscular dystrophy virus. By analyzing the amplification curve and recording the Ct value of each reaction, it is determined whether the sample carries abalone muscular dystrophy virus and the viral load.

3. A PCR amplification kit for detecting abalone muscular dystrophy virus, comprising dNTP, Mg 2+ , TaqDNA polymerase, Tris-HCl system, specific primers, specific probes, characterized in that: The specific probe is the probe as described in claim 1; the specific primer is the primer as described in claim 2; the kit is used to detect abalone muscular dystrophy virus, and by analyzing the amplification curve and recording the Ct value of each reaction, it is determined whether the sample carries abalone muscular dystrophy virus and the viral load.

4. Use of the probe as claimed in claim 1 in a detection kit for abalone muscular dystrophy virus.

5. Use of the primer as claimed in claim 2 in a detection kit for abalone muscular dystrophy virus.

Images