Composition for detecting neuroinvasive pathogen and serotype thereof, kit and application

Abstract

The invention relates to the technical field of biological detection, and discloses a composition for detecting neuroinvasive pathogens and serotypes thereof, a kit and application. The composition disclosed by the invention can be used for rapidly, accurately and highly sensitively detecting and identifying poliomyelitis viruses and herpes simplex viruses of different serotypes through a multiplex PCR technology, and the primers and the probes in the composition can be freely combined according to actual requirements, so that rapid identification of neuroinvasive viruses of different types and serotypes is realized; and a basis is provided for work in multiple fields such as clinic, disease control and scientific research.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a composition, a kit and applications for detecting neuroinvasive pathogens and their serotypes. Background Art

[0002] Neuroinvasive viral infections are a cause of central nervous system diseases (CNS) and, if not detected promptly, can lead to serious consequences such as nerve cell dysfunction, neuronal death, and structural damage to the nervous system. Poliovirus and herpes simplex virus are two common viruses that can cause CNS diseases. Studies have found that these two viruses have further serotypes, and different serotypes harbor and infect different tissues and organs, resulting in different symptoms. Accurate detection of virus species and serotypes is crucial for disease diagnosis and treatment, disease prevention and control, and scientific research.

[0003] Currently, there are many rapid detection methods for different types of viruses. However, further serotype differentiation relies more on time-consuming and costly detection methods such as genome sequencing.

[0004] Therefore, there is an urgent need to develop new detection methods and related products that can quickly and accurately identify the types and serotypes of neuroinvasive viruses. Summary of the Invention

[0005] The purpose of the present invention is to overcome the above-mentioned problems existing in the prior art and to provide a composition, kit and application for detecting neuroinvasive pathogens and their serotypes. The present invention relates to a method for detecting neuroinvasive pathogens and related products. Specifically, the present invention relates to a method for detecting two types of pathogens that cause neurological diseases, namely poliovirus and herpes simplex virus, and related products. The present invention also relates to a method for detecting blood type / genotype typing of neuroinvasive pathogens and related products. Specifically, the present invention provides a method for identifying subtypes of neuroinvasive pathogens (such as poliovirus type I, type II, type III, herpes simplex virus type I, type II) and related products. The detection method and related products provided by the present invention can be applied to multiple detection technologies, thereby simultaneously detecting pathogens and realizing typing identification, meeting the differential diagnosis needs of neurological diseases, and having the characteristics of fast, accurate and high sensitivity.

[0006] In order to achieve the above object, the present invention provides a composition for nucleic acid detection, comprising at least one of the following primers A and B:

[0007] Primer A: a primer selected from at least one of a target sequence for poliovirus type I, a target sequence for poliovirus type II, and a target sequence for poliovirus type III, wherein the target sequence for poliovirus type I is selected from nucleotides 1900-2400 of the genome, the target sequence for poliovirus type II is selected from nucleotides 900-1400 of the genome, and the target sequence for poliovirus type III is selected from nucleotides 2700-3200 of the genome;

[0008] Primer B: A primer selected from a target sequence of herpes simplex virus type I and / or a target sequence of herpes simplex virus type II, wherein the target sequence of herpes simplex virus type I is selected from nucleotides 9400-9600 of the genome, and the target sequence of herpes simplex virus type II is selected from nucleotides 86700-87350 of the genome.

[0009] The second aspect of the present invention provides a kit, which comprises the composition described in the first aspect.

[0010] The third aspect of the present invention provides use of the composition of the first aspect, or the kit of the second aspect, in the detection of neuroinvasive pathogens.

[0011] A fourth aspect of the present invention provides a method for jointly detecting neuroinvasive pathogens in a sample, the method comprising using the composition of the first aspect or the kit of the second aspect to perform in vitro nucleic acid amplification on the sample to be tested.

[0012] Through the above technical solution, the present invention can achieve at least the following beneficial effects:

[0013] (1) The composition provided by the present invention contains detection primers for different serotypes of poliovirus and herpes simplex virus. These primers can be freely combined to detect different neuroinvasive viruses and identify pathogen subtypes (such as poliovirus types I, II, and III, and herpes simplex virus types I and II) as needed.

[0014] (2) The composition of the present invention uses multiplex PCR technology to simultaneously detect and identify multiple serotypes of poliovirus and herpes simplex virus present in a sample. Combined with fluorescence detection and other technologies, it can also achieve quantitative detection, meeting the needs of differential diagnosis of neurological diseases. Compared with conventional detection methods such as genome sequencing and comparison, the use of the composition of the present invention can greatly simplify the detection process, reduce the requirements for detection personnel and equipment, and is suitable for promotion and application in grassroots testing.

[0015] (3) The primer pairs and probes contained in the composition provided by the present invention will not polymerize with each other and will not interfere with each other. They have a good effect on the simultaneous detection of multiple targets in a sample, have good specificity, high detection sensitivity, are easy to operate, and are suitable for large-scale promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a graph showing the results of joint detection of a mixed sample of three serotypes of poliovirus and two serotypes of herpes simplex virus using the kit of Example 1 in Example 2.

[0017] Figure 2 This is a graph showing the results of joint detection of a mixed sample of three serotypes of poliovirus and herpes simplex virus type II using the kit of Example 1 in Example 2.

[0018] Figure 3A-Figure 3E The following figures show the results of using the kit of Example 1 to detect 200 copies / mL diluted solutions of target sequence plasmids of poliovirus type I, poliovirus type II, poliovirus type III, herpes simplex virus type I and herpes simplex virus type II.

[0019] Figure 4 This is a graph showing the specificity test results performed in Example 2 using the kit of Example 1.

[0020] Figure 5 This is a graph showing the results of the combined detection of a mixed sample of three serotypes of poliovirus and two serotypes of herpes simplex virus using the comparative kit in Comparative Example 1. DETAILED DESCRIPTION

[0021] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0022] In their research, the inventors of the present invention cleverly designed a series of PCR primers and probes based on specific target sequences in different serotypes of poliovirus and herpes simplex virus. These primers and probes will not produce non-specific binding or dimers, can exist simultaneously in the reaction system, and have no adverse effects on each other when used together. They can perform efficient PCR amplification on multiple target sequences at the same time. By utilizing multiplex PCR technology and fluorescent labeling, they can easily distinguish and identify different serotypes of poliovirus and herpes simplex virus in samples, thereby achieving simultaneous detection of different serotypes of the above viruses.

[0023] Based on this, the first aspect of the present invention provides a composition for nucleic acid detection, the composition comprising at least one of the following primers A and B:

[0024] Primer A: a primer selected from at least one of a target sequence for poliovirus type 1 (PV-1), a target sequence for poliovirus type II (PV-2), and a target sequence for poliovirus type III (PV-3), wherein the target sequence for poliovirus type 1 is selected from nucleotides 1900-2400 of the genome, the target sequence for poliovirus type II is selected from nucleotides 900-1400 of the genome, and the target sequence for poliovirus type III is selected from nucleotides 2700-3200 of the genome;

[0025] Primer B: A primer selected from a target sequence of herpes simplex virus type 1 (HSV-1) and / or a target sequence of herpes simplex virus type II (HSV-2), wherein the target sequence of herpes simplex virus type 1 is selected from nucleotides 9400-9600 of the genome, and the target sequence of herpes simplex virus type II is selected from nucleotides 86700-87350 of the genome.

[0026] In the composition provided by the present invention, primer A is a primer for detecting poliovirus, which can simultaneously detect up to three different serotypes of poliovirus (type I, type II and type III); primer B is a primer for detecting herpes simplex virus, which can simultaneously detect up to two different serotypes of herpes simplex virus (type I and type II).

[0027] The compositions provided herein can be freely combined according to actual needs. For example, the composition can include both primers A and B, or only one type (i.e., only primer A or only primer B), or a combination of two or more primers from each type. Each type of primer can include primers targeting all of the aforementioned target sequences or a combination of two or more target sequences.

[0028] In the present invention, the target sequences of primer A and primer B are both conserved sequences in the above-mentioned viral genomes, and the specific nucleotide sequences can be obtained through databases commonly used in the art (such as NCBI, etc.) combined with the above-mentioned sites.

[0029] For example, in some embodiments of the present invention, the target sequence targeted by primer A may include at least one of the following:

[0030] Poliovirus type I target sequence: GenBank ID AF538841.1 nucleotides 1900-2400, preferably nucleotides 2081-2210;

[0031] Poliovirus type II target sequence: GenBank ID OP410457.1 nucleotides 900-1400, preferably nucleotides 1060-1230;

[0032] Poliovirus type III target sequence: GenBank ID ON221309.1 nucleotides 2700-3200, preferably nucleotides 2890-3050.

[0033] In some embodiments of the present invention, the target sequence targeted by primer B may include at least one of the following:

[0034] Herpes simplex virus type I target sequence: GenBank ID ON960056.1 nucleotides 9400-9600, preferably nucleotides 9420-9560;

[0035] Herpes simplex virus type II target sequence: GenBank ID PQ065505.1 nucleotides 86700-87350, preferably nucleotides 86960-87170.

[0036] In the present invention, the target sequence of primer A and primer B can be the complete target sequence or a partial fragment of the target sequence.

[0037] According to some preferred embodiments of the present invention, the target sequence of poliovirus type I is shown as SEQ ID NO:16.

[0038] TACTACACACACTGGGCAGGATCCCTGAAGTTCACGTTTTTGTTC TGTGGATCCATGATGGCAACTGGCAAACTGTTGGTGTCATACGCGCCT CCTGGAGCCGACCCACCGAGGAAGCGTAAGGAGGCGA (SEQ ID NO: 16)

[0039] According to some preferred embodiments of the present invention, the target sequence of poliovirus type II is shown as SEQ ID NO: 17.

[0040] CCAACCGAGCCCGATGTAGCCGCGTGCAGGTTCTACACATTAGATACCGTCACTTGGCGCAAGGAGTCCAGAGGGTGGTGGTGGAAACTACCAGACGCTTTAAAAGACATGGGGTTATTTGGTCAAAACATGTTTTATCACTATCTTGGGAGGGCTGGCTACACAGTGCAC (SEQ ID NO: 17)

[0041] According to some preferred embodiments of the present invention, the target sequence of poliovirus type III is shown as SEQ ID NO: 18.

[0042] CAACTTCACCAACGCTAATAATGGGCATGCACTCAACCAGGTGTACCAGATAATGTACATCCCCCCAGGGGCACCCACACCACAGTCATGGGACGACTATACTTGGCAAACATCTTCCAACCCGTCCATATTTTACACCTATGGGGCTGCCCCGGCGCGAA(SEQ ID NO:18)

[0043] According to some preferred embodiments of the present invention, the target sequence of herpes simplex virus type 1 is shown as SEQ ID NO:19.

[0044] GGGGCTTGTGTGGCACGGCGTCGTGGTTGTGTTACTGGGCAAACACTTGGGGCCTGCAGGTTTCTGTGGGTGCCGACCCTAGGCGCTATGGGGATTTTGGGTTGGGTCGGGCTTATTGCCGTTGGGGTTTTGTGTGTGCGG(SEQID NO:19)

[0045] According to some preferred embodiments of the present invention, the target sequence of herpes simplex virus type II is shown as SEQ ID NO: 20.

[0046] GCAGGAAAGTCAGCGGCGTGATGGTGCTTTCCAGCGATCCCCCCGGCCCCGCGGCCTACCGCATTAGCGACAGCAGCTTTGTTCAATGCGGCTCCAACTGCAGTATGATAATCGACGGAGACGTGGCGCGCGGTCATTTGCGTGACCTCGAGGGCGCTACGTCCACCGGCGCCTTCGTCGCGATCTCAAACGTCGCAGCCGGCGGGGATGG (SEQ ID NO: 20)

[0047] According to a preferred embodiment of the present invention, primer A includes at least one pair of primer pairs SEQ ID NO: 1 and SEQ ID NO: 2 (primer pair for poliovirus type I), primer pair SEQ ID NO: 4 and SEQ ID NO: 5 (primer pair for poliovirus type II), and primer pair SEQ ID NO: 7 and SEQ ID NO: 8 (primer pair for poliovirus type III).

[0048] According to a preferred embodiment of the present invention, primer B includes at least one pair of primer pairs SEQ ID NO: 10 and SEQ ID NO: 11 (primer pair for herpes simplex virus type I), and primer pair SEQ ID NO: 13 and SEQ ID NO: 14 (primer pair for herpes simplex virus type II).

[0049] According to a preferred embodiment of the present invention, the composition further comprises the following probe A and / or probe B:

[0050] Probe A: a probe selected from at least one of a target sequence for poliovirus type I, a target sequence for poliovirus type II, and a target sequence for poliovirus type III;

[0051] Probe B: A probe selected from a target sequence of herpes simplex virus type I and / or a target sequence of herpes simplex virus type II.

[0052] According to a preferred embodiment of the present invention, probe A comprises at least one of SEQ ID NO:3, SEQ ID NO:6 and SEQ ID NO:9.

[0053] According to a preferred embodiment of the present invention, probe B comprises at least one of SEQ ID NO:12, SEQ ID NO:15 and SEQ ID NO:23.

[0054] According to a preferred embodiment of the present invention, probe A and probe B may be further modified with a labeling group (in order to distinguish different target sequences in a sample, or to perform quantitative analysis on the target sequence in the sample).

[0055] Any labeling group commonly used in the art for nucleic acid detection, especially labeling groups that can be modified in nucleic acid probes, can be applied to the present invention, such as fluorescent labeling groups, drug labeling groups (such as biotin, etc.), nanoluminescent labeling groups, enzyme labels, etc.

[0056] Preferably, the labeling group is a fluorescent labeling group.

[0057] Since the composition provided by the present invention can be used for simultaneous detection of multiple different target sequences, in order to more clearly distinguish the detection results of different target analytes, preferably, different fluorescent markers are modified on the probes for different target sequences. Preferably, the different fluorescent markers can be detected simultaneously through different channels.

[0058] According to some preferred embodiments of the present invention, the fluorescent labeling group can be selected from at least one of ATTO 425, HEX, FAM, ROX, CY5, Quasar705, and VIC.

[0059] The present invention has no particular limitation on the modification position of the fluorescent labeling group, which can be adjusted according to actual needs, and can generally be modified at the 5' end of the probe.

[0060] Preferably, the probe (3' end) is further modified with a fluorescence quenching group, preferably at least one of BHQ0, BHQ1, and BHQ2.

[0061] According to some preferred embodiments of the present invention, the composition may be any of the following primer and probe combinations:

[0062] (1) A primer and probe combination for simultaneously detecting poliovirus of different serotypes, the primer and probe combination comprising at least two of the primer pair SEQ ID NO: 1 and SEQ ID NO: 2 and the probe SEQ ID NO: 3, the primer pair SEQ ID NO: 4 and SEQ ID NO: 5 and the probe SEQ ID NO: 6, and the primer pair SEQ ID NO: 7 and SEQ ID NO: 8 and the probe SEQ ID NO: 9;

[0063] (2) a primer and probe combination for simultaneously detecting different serotypes of herpes simplex virus, the primer and probe combination comprising a primer pair of SEQ ID NO: 10 and SEQ ID NO: 11 and a probe of SEQ ID NO: 12, and a primer pair of SEQ ID NO: 13 and SEQ ID NO: 14 and a probe of SEQ ID NO: 15;

[0064] (3) A primer and probe combination for simultaneously detecting different serotypes of poliovirus and different serotypes of herpes simplex virus, the primer and probe combination comprising at least one of the primer pair SEQ ID NO: 1 and SEQ ID NO: 2 and the probe SEQ ID NO: 3, the primer pair SEQ ID NO: 4 and SEQ ID NO: 5 and the probe SEQ ID NO: 6, and the primer pair SEQ ID NO: 7 and SEQ ID NO: 8 and the probe SEQ ID NO: 9, and

[0065] At least one of the primer pair SEQ ID NO: 10 and SEQ ID NO: 11 and the probe SEQ ID NO: 12 and the primer pair SEQ ID NO: 13 and SEQ ID NO: 14 and the probe SEQ ID NO: 15.

[0066] According to some preferred embodiments of the present invention, the composition may further include primers and probes targeting an internal standard gene.

[0067] Preferably, the internal standard gene includes at least one of the human housekeeping genes. The present invention has no particular restrictions on the specific human housekeeping genes selected, and can be selected according to actual needs. The present invention has no particular restrictions on the primers and probes for the internal standard genes, and can be selected according to actual needs. For example, finished internal standard gene primers and probes can be directly selected (preferably, in order to avoid nonspecific binding of primers and probes, the finished internal standard gene primers and probes can be used to detect samples separately with the composition of the present invention when used).

[0068] In the composition provided by the present invention, each primer can be packaged independently or mixed. Since non-specific binding does not occur between the primers in the composition provided by the present invention, preferably, in order to save packaging materials and reduce production and use costs, the composition is present in a mixed package.

[0069] The second aspect of the present invention provides a kit, which comprises the composition described in the first aspect.

[0070] According to a preferred embodiment of the present invention, the kit further comprises at least one of a buffer, an enzyme and deoxyribonucleoside triphosphates (dNTPs).

[0071] Preferably, the buffer comprises Tris-HCl buffer.

[0072] Preferably, the enzyme includes at least one of UNG enzyme, DNA polymerase (such as H-Taq enzyme, etc.) and reverse transcriptase.

[0073] The deoxyribonucleoside triphosphates included in the kit of the present invention are raw materials for complementary pairing with the template sequence during in vitro nucleic acid amplification to amplify, and the specific deoxyribonucleoside triphosphate species contained therein can be selected according to actual needs. Preferably, the deoxyribonucleoside triphosphates can include dATP (containing bases are adenine), dGTP (containing bases are guanine), dTTP (containing bases are thymine), dCTP (containing bases are cytosine), dUTP (containing bases are uracil). The present invention is not particularly limited to the specific source of the deoxyribonucleoside triphosphates in the kit, and it can be a related compound prepared by itself or a compound obtained from a commercial route. For example, commercially available dNTPs (U) reagents (containing dATP, dGTP, dTTP, dCTP, dUTP) can be directly used.

[0074] More preferably, the kit may further include a positive control reagent and / or a negative control reagent.

[0075] The present invention does not particularly limit the specific selection of reagents used as positive and negative controls in the kit, and they can be selected according to conventional techniques in the art. For example, reagents that do not contain the target sequence, such as physiological saline or buffer, can be used as negative controls. Internal standard gene pseudoviruses can also be used as negative controls. For another example, mixed plasmids containing the corresponding specific gene target sequence, DNA or RNA of the target gene fragment, pseudoviruses, etc. can be used as positive controls.

[0076] The third aspect of the present invention provides use of the composition of the first aspect, or the kit of the second aspect, in the detection of neuroinvasive pathogens.

[0077] The composition and kit provided by the present invention can simultaneously detect two different pathogens that cause neurological diseases (poliovirus and herpes simplex virus), can also simultaneously detect different serotypes of a pathogen, and can also simultaneously detect two pathogens and at least two different serotypes thereof.

[0078] A fourth aspect of the present invention provides a method for jointly detecting neuroinvasive pathogens in a sample, the method comprising using the composition of the first aspect or the kit of the second aspect to perform in vitro nucleic acid amplification on the sample to be tested.

[0079] In the present invention, nucleic acid amplification and detection can be performed in vitro on the sample to be tested using conventional methods in the art. For example, in some embodiments, the method provided by the present invention may include the following steps:

[0080] (1) Sample nucleic acid extraction and purification;

[0081] (2) Using the composition described in the first aspect of the present invention or the kit described in the second aspect of the present invention, the purified sample nucleic acid is used as a template for in vitro nucleic acid amplification.

[0082] Preferably, the method further comprises analyzing the amplification results. In a preferred embodiment, since the probe is modified with a marker such as a fluorescent marker, the pathogen species and / or serotype can be qualitatively or quantitatively detected and analyzed by fluorescence detection or other methods of detecting the marker. For example, a multiplex PCR method can be used to amplify and detect different target sequences through different detection channels using the fluorescent marker modified on the probe, ultimately determining the pathogen species and / or serotype in the sample.

[0083] It should be noted that the methods and applications provided herein may be diagnostic or non-diagnostic. For example, diagnostic applications may include using the compositions, kits, or methods of the present invention to test patient-derived samples to determine whether the patient is infected with poliovirus and / or herpes simplex virus, and to identify the serotype of the virus with which the patient is infected. For another example, non-diagnostic applications may include using the compositions, kits, or methods of the present invention to test samples of human, animal, or environmental origin to complete related research, testing, disease prevention, and control efforts.

[0084] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention.

[0085] In the following examples, unless otherwise specified, all reagents and materials used were purchased from regular chemical or biological reagent / material suppliers, and all reagents were of analytical grade.

[0086] Example 1

[0087] This example is used to illustrate the preparation of the kit provided by the present invention.

[0088] 1. Prepare primers and probes

[0089] Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize primers and probes according to the sequences in Table 1.

[0090] Table 1

[0091]

[0092] 2. Prepare the unit reaction reagent kit for PCR reaction

[0093] Prepare the corresponding reagents according to the amounts required for the unit reaction reagent set in Table 2 (i.e., a reagent set for detecting one sample in one PCR reaction).

[0094] Table 2

[0095]

[0096] *In Table 1, PCR buffer is PCR buffer (S09) purchased from Hunan Kangde Biotechnology Co., Ltd.; the amount of upstream primer and downstream primer used is the amount used for one sequence respectively.

[0097] 3. Prepare control reagents

[0098] Negative control: sterile saline.

[0099] Positive control: target sequence mixed plasmid, which includes each target sequence plasmid prepared by inserting the target sequence into the pCDH plasmid. The target sequence is shown in Table 3 below.

[0100] Table 3

[0101] name sequence Poliovirus type I target sequence SEQ ID NO:16 Poliovirus type II target sequence SEQ ID NO: 17 Poliovirus type III target sequence SEQ ID NO: 18 Herpes simplex virus type 1 target sequence SEQ ID NO: 19 Herpes simplex virus type II target sequence SEQ ID NO:20

[0102] 4. Prepare the kit

[0103] Combine and package the reagents prepared in steps 1-3 according to the target detection volume of a single kit.

[0104] Example 2

[0105] This example is used to illustrate the combined detection effect of the kit provided by the present invention on different serotypes of poliovirus and herpes simplex virus in a sample.

[0106] (1) PCR testing

[0107] 1. Prepare the sample to be tested

[0108] This example uses the positive control in Example 1 as a simulated sample (a mixed plasmid of five target sequences, also referred to as a "quintuple test sample") for detection.

[0109] Sample preparation: 300 μL of each negative control and five-joint test sample were transferred to 1.5 mL centrifuge tubes. Nucleic acid extraction and purification reagents (Cat. No. S10015-48) from Shengxiang Biotechnology Co., Ltd. were used in sequence according to the instructions for nucleic acid extraction and purification.

[0110] 2. Sample addition and PCR amplification

[0111] Take 10 μL of the purified five-joint test sample and 10 μL of the negative control and add them to the PCR reaction tubes respectively. Add 40 μL of the unit PCR reaction reagent kit to each tube (see Table 2 for specific components). After mixing, place it in the Macrostone fluorescent quantitative PCR analyzer and perform PCR reaction according to the reaction conditions in Table 4.

[0112] Table 4

[0113]

[0114] Test criteria: Refer to Table 5. If the ATTO 425, FAM, HEX, CY5, and ROX channels show a clear S-shaped amplification curve and a Ct value ≤ 38, the test is positive. If the ATTO 425, FAM, HEX, and ROX channels show no amplification curve (No Ct) or a Ct value > 38, the test is negative.

[0115] Table 5

[0116]

[0117] Test results such as Figure 1 Referring to the judgment criteria in Table 5, it was determined that all the tests of the five combined test samples were positive, indicating that the composition and kit of the present invention can perform joint detection of poliovirus and herpes simplex virus of different serotypes.

[0118] The mock sample was replaced with a mixture of target sequence plasmids of poliovirus (type I + type II + type III) and herpes simplex virus type II (called "quadruple test sample") and tested using the above method. The results are as follows: Figure 2 As shown in the figure, it can be seen that the kit also has a good effect on the quadruple detection of poliovirus (type I + type II + type III) and herpes simplex virus type II. It can be seen that the primers and probes in the composition of the present invention can be freely combined to perform joint detection of the corresponding viruses.

[0119] (2) Sensitivity test

[0120] The sensitivity (LOD) test of each target is performed as follows:

[0121] Using the plasmid from Example 1 as a positive control, a gradient dilution solution of each target sequence was prepared. These solutions were then tested using the method described in Experiment 1 to determine the detection limit for each target sequence. Table 6 shows the detection rate for each target at various concentrations (detection rate = number of detected targets / total number of detected targets). Figure 3A-Figure 3E, respectively, show the amplification curves of each target sequence at a concentration of 200 copies / mL. As can be seen from the figure, each target can be detected at 200 copies / mL.

[0122] Table 6

[0123] Target 400 copies / mL 200 copies / mL 100 copies / mL 50 copies / mL Poliovirus type 1 20 / 20 20 / 20 16 / 20 8 / 20 Poliovirus type II 20 / 20 20 / 20 13 / 20 5 / 20 Poliovirus type III 20 / 20 20 / 20 17 / 20 6 / 20 Herpes simplex virus type 1 20 / 20 20 / 20 12 / 20 4 / 20 Herpes simplex virus type 2 20 / 20 20 / 20 16 / 20 6 / 20

[0124] (3) Specificity test

[0125] The method in experiment (1) was used to detect other enteroviruses (coxsackievirus, coxsackievirus, norovirus, rotavirus, enteroadenovirus, astrovirus, and zaprovirus) and other herpes viruses (Epstein-Barr virus, cytomegalovirus, human herpes virus, and varicella-zoster virus). The results were as follows: Figure 4 As shown in the figure, it can be seen that these viruses all showed obvious negative detection results, indicating that the composition and kit provided by the present invention have good specificity.

[0126] (IV) Anti-interference test

[0127] The test samples were tested using the method of experiment (I), except that the interfering substances listed in Table 7 were added thereto. The test results (Ct values of each channel) are shown in Table 7.

[0128] Table 7

[0129] Interference ATTO 425 FAM HEX ROX CY5 Control (sample without interference) 37.26 36.39 36.28 35.63 35.67 Dexamethasone (50 μg / mL) 36.30 36.36 36.10 36.38 36.27 Gentamycin (50 μg / mL) 36.61 36.29 36.59 36.09 35.71 Vancomycin (50 μg / mL) 36.45 36.09 36.66 39.99 35.81 Cefmenoxime hydrochloride (50 μg / mL) 38.24 36.59 35.95 36.19 35.98 Ciprofloxacin (50 μg / mL) 36.08 36.78 36.07 36.01 36.30 Co-trimoxazole (50 μg / mL) 35.60 35.85 35.70 37.31 35.98 Clindamycin (50 μg / mL) 35.85 36.11 35.33 36.44 35.70 Hemoglobin (10 μg / mL) 36.99 36.63 36.21 35.99 36.78 Hemoglobin (10 wt%) 36.17 36.06 36.86 36.52 36.14

[0130] It can be seen from the data in Table 7 that when the kit of the present invention is used for sample detection, it has good tolerance to PCR inhibitors / interferers.

[0131] (5) Stability test

[0132] Using the method of Experiment (1), the freshly prepared kit was used to test the target sample (target sequence plasmid at a concentration of 600 copies / mL), with each sample tested 10 times. After the kit was placed at 37°C (also known as "37°C acceleration") for 72 hours, the target sample (target sequence plasmid at a concentration of 600 copies / mL) was tested again, with each sample tested 10 times.

[0133] The results are shown in Table 8, from which it can be seen that the detection precision of the two test samples is ≤5% and is highly consistent, indicating that the kit of the present invention has good detection stability.

[0134] Table 8

[0135]

[0136] (6) Actual sample testing

[0137] The method of experiment (1) was used to test the simulated actual samples. The simulated actual samples were poliovirus (type I + type II + type III) and herpes simplex virus (type I + type II) purchased from ATCC and simulated plasma samples with a virus concentration of 600 copies / mL prepared by adding human plasma. The test results were the same as Figure 1 Similarly, it is shown that the kit of the present invention has good detection and identification capabilities for different serotypes of poliovirus and herpes simplex virus in actual samples.

[0138] Comparative Example 1

[0139] A kit was prepared in the manner of Example 1, except that the detection primers and probes for herpes simplex virus type I were replaced with the sequences in Table 9 to obtain a comparative kit.

[0140] Table 9

[0141]

[0142] The method in Example 2 was used to test the five combined test samples in Example 2 using the comparative kit of this comparative example. The results are as follows: Figure 5 As shown in the figure, it can be seen that when the comparative kit is used to test the five combined test samples, the detection performance of herpes simplex virus type I is reduced, the Ct value is delayed, and the fluorescence increment decreases. This shows that the comparative kit of this comparative example is not effective for the combined detection of three poliovirus serotypes and two herpes simplex virus serotypes, indicating that the combined detection effect is better when the specific primers and probes are used in the kit of the present invention.

[0143] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.

Claims

1. A composition for nucleic acid detection, characterized in that The composition includes at least one of the following primers A and B: Primer A: a primer selected from at least one of a target sequence for poliovirus type I, a target sequence for poliovirus type II, and a target sequence for poliovirus type III, wherein the target sequence for poliovirus type I is selected from nucleotides 1900-2400 of the genome, the target sequence for poliovirus type II is selected from nucleotides 900-1400 of the genome, and the target sequence for poliovirus type III is selected from nucleotides 2700-3200 of the genome; Primer B: A primer selected from a target sequence of herpes simplex virus type I and / or a target sequence of herpes simplex virus type II, wherein the target sequence of herpes simplex virus type I is selected from nucleotides 9400-9600 of the genome, and the target sequence of herpes simplex virus type II is selected from nucleotides 86700-87350 of the genome.

2. The composition according to claim 1, wherein The target sequence of poliovirus type I is shown in SEQ ID NO: 16; and / or, the target sequence of poliovirus type II is shown in SEQ ID NO: 17; and / or, the target sequence of poliovirus type III is shown in SEQ ID NO: 18; and / or, the target sequence of herpes simplex virus type 1 is shown in SEQ ID NO: 19; And / or, the target sequence of herpes simplex virus type II is shown in SEQ ID NO:

20.

3. The composition according to claim 1, wherein Primer A includes at least one of the primer pair SEQ ID NO: 1 and SEQ ID NO: 2, the primer pair SEQ ID NO: 4 and SEQ ID NO: 5, and the primer pair SEQ ID NO: 7 and SEQ ID NO: 8; And / or, primer B includes at least one of the primer pair of SEQ ID NO: 10 and SEQ ID NO: 11 and the primer pair of SEQ ID NO: 13 and SEQ ID NO:

14.

4. The composition according to any one of claims 1 to 3, wherein The composition further comprises the following probe A and / or probe B: Probe A: a probe selected from at least one of a target sequence for poliovirus type I, a target sequence for poliovirus type II, and a target sequence for poliovirus type III; Probe B: A probe selected from a target sequence of herpes simplex virus type I and / or a target sequence of herpes simplex virus type II.

5. The composition according to claim 4, wherein Probe A includes at least one of SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 9; And / or, probe B includes at least one of SEQ ID NO:12, SEQ ID NO:15 and SEQ ID NO:

23.

6. The composition according to any one of claims 4 or 5, wherein The probe is modified with a labeling group, preferably a fluorescent labeling group; Preferably, probes targeting different target sequences are modified with different fluorescent labeling groups.

7. A kit, characterized in that The kit comprises the composition of any one of claims 1-6.

8. The kit according to claim 7, wherein The kit further comprises at least one of a buffer, an enzyme, and deoxyribonucleoside triphosphates; Preferably, the buffer comprises Tris hydrochloride buffer; Preferably, the enzyme comprises at least one of UNG enzyme, DNA polymerase and reverse transcriptase; More preferably, the kit further comprises a positive control reagent and / or a negative control reagent.

9. Use of the composition according to any one of claims 1 to 6, or the kit according to claim 6 or 7, in the detection of neuroinvasive pathogens.

10. A method for combined detection of neuroinvasive pathogens in a sample, characterized in that: The method comprises using the composition according to any one of claims 1 to 6 or the kit according to claim 7 or 8 to perform in vitro nucleic acid amplification on a sample to be tested.

Images