Engineering bacteria, biosensor and detection method thereof

Abstract

The invention discloses engineering bacteria, a biosensor and a detection method thereof. According to the sensor, modified Acinetobacter bayli ADP1 is taken as a carrier, and exogenous nucleic acid can be autonomously absorbed without external induction by utilizing the natural nucleic acid uptake capability of the carrier; after nucleic acid internalization, hairpin structure limitation of the blocking type gRNA is relieved, a CRISPRa system is activated, dCas9-SoxS protein is driven to be combined with a target promoter in a targeted mode, CymA-MtrCAB gene expression is started, and specific recognition of a nucleic acid sequence is achieved. The system is integrated with a CymA-MtrCAB transmembrane electron conduction module, a biological recognition signal is converted into an electrochemical signal in real time to be output through a membrane protein mediated electron transfer chain, and a nucleic acid recognition-gene activation-electric response detection path is established. The biosensor has the advantages of structural modularization, high response specificity, high detection sensitivity, wide environment adaptability and the like, is suitable for tumor marker detection, wearable health monitoring and other biomolecule recognition scenes, and provides a novel biosensing solution which is high in universality and programmable.

Description

Technical Field

[0001] The present invention belongs to the field of biosensor technology, and in particular relates to an engineered bacterium, a biosensor and a detection method thereof. Background Art

[0002] In recent years, the demand for highly sensitive, real-time, dynamic biosensor technologies has become increasingly urgent in areas such as early cancer diagnosis, infectious disease monitoring, and environmental pollution detection. However, traditional detection technologies (such as PCR and ELISA) have significant limitations: PCR relies on target nucleic acid amplification, which can easily lead to false positives and false negatives due to primer mismatches or amplification bias (e.g., the detection limit is often in the picomolar range, making it difficult to identify low-abundance mutations); antibody-based methods such as ELISA are limited by antibody cross-reactivity and cannot directly detect nucleic acid targets. Traditional technologies require complex sample pretreatment (such as DNA extraction and amplification) and offline analysis, and cannot achieve continuous monitoring in living organisms or complex environments. Existing sensors mostly rely on static molecular recognition (such as antibody-antigen binding) and cannot dynamically adjust signal output with changes in target concentration.

[0003] To break through the above bottlenecks, the cross-integration of synthetic biology and electrochemical technology has become a research hotspot: Synthetic biology sensors: They use engineered bacteria (such as Escherichia coli) to sense environmental signals and output fluorescent or colorimetric signals, but their sensitivity is limited by optical detection methods (such as fluorescence background noise) and are difficult to integrate with portable electrical devices.

[0004] CRISPR-Cas systems (such as Cas12 / 13) have been used for nucleic acid detection, but they rely on the release of reporter molecules after target cleavage (such as hydrolysis of ssDNA fluorescent probes), have low signal amplification efficiency, and cannot be coupled to electronic signal output.

[0005] Electrochemical biosensors based on redox enzymes (such as horseradish peroxidase) or conductive nanomaterials can achieve direct output of electrical signals, but they have problems such as poor stability (enzymes are easily inactivated) and single target adaptability (dependence on fixed probes).

[0006] In recent years, microbial electrochemical systems (such as the CymA-MtrCAB electron transport chain of Shewanella) have emerged as promising candidates in the bioenergy field, converting metabolic activity into electrical current through transmembrane electron transfer. However, these systems have not yet been integrated with gene editing technologies, hindering the specific triggering and signal amplification of target molecules (such as RNA or DNA). Furthermore, while natural DNA-uptake strains (such as Acinetobacter baylyi ADP1) have been used for environmental DNA capture, their conversion mechanisms have not been systematically exploited as sensor vectors, particularly with the lack of integrated design for CRISPR activation (CRISPRa) and the electron transport chain. Existing technologies have yet to address the full chain integration of highly sensitive nucleic acid target recognition, dynamic regulation of gene expression, and real-time electrical signal output. Summary of the Invention

[0007] Based on the deficiency of the existing technology that it is impossible to achieve the full chain integration of highly sensitive recognition of nucleic acid targets - dynamic regulation of gene expression - real-time output of electrical signals, the present invention proposes a biosensor based on engineered bacteria and a detection method.

[0008] This invention, for the first time, realizes an electron transfer system triggered by an exogenous nucleic acid molecule. By integrating a blocking gRNA (BgRNA) with dCas9-SoxS, when the exogenous nucleic acid molecule (such as KRAS G12D mutant RNA) binds to the BgRNA, the hairpin structure unwinds, and the gRNA guides the dCas9-SoxS complex to activate a promoter near a specific site. The CRISPRa-activated promoter drives expression of the CymA-MtrCAB gene module. The encoded multicomponent membrane-localized protein, through the cooperative action of the heme cofactor, transfers electrons across the membrane, ultimately exporting intracellular electrons to an external electrode, generating a measurable electrical signal. This mechanism establishes a direct link between the exogenous nucleic acid molecule and the electron export system, enabling dynamic regulation and signal amplification. The theoretical limit of detection is estimated to be approximately 0.7 nM (calculated at a signal-to-noise ratio of 3), with a response time of no more than 30 minutes. The current drift rate is less than ±10%.

[0009] The technical solution of the present invention is to provide an engineered bacterium, comprising a protein for taking up exogenous nucleic acid molecules; and, dCas9-SoxS fusion protein and blocking gRNA (BgRNA) linked to the dCas9-SoxS fusion protein; Among them, BgRNA releases the hairpin structure blockade by binding to exogenous nucleic acid molecules, guiding the dCas9-SoxS fusion protein to target a specific promoter and initiate the transcription of transmembrane electron conducting proteins; the transmembrane electron conducting proteins include CymA, MtrA, MtrB, and MtrC proteins; the hairpin structure region of the blocking gRNA (BgRNA) contains a sequence that is completely complementary to the exogenous nucleic acid molecule and a sequence complementary to the targeting site. The targeting site is located upstream of the specific promoter, enabling the dCas9-SoxS complex to accurately anchor and enhance the efficiency of RNA polymerase recruitment, thereby achieving specific structural unlocking.

[0010] Furthermore, the proteins for taking up exogenous nucleic acid molecules are comEA (recognizing exogenous DNA), comEC (transmembrane DNA import) and comP (assisting DNA stability).

[0011] Furthermore, the engineered bacteria uses Acinetobacter baylyi ADP1 as a carrier.

[0012] Furthermore, the exogenous nucleic acid molecule is a mutant of the KRAS, NRAS or BRAF gene or circulating tumor DNA (ctDNA).

[0013] After binding to exogenous nucleic acid molecules, the hairpin structure of BgRNA is deconstructed to form an effective gRNA, which guides the dCas9-SoxS fusion protein to specifically bind to the recognition site upstream of the target promoter, thereby activating the transcriptional expression of the CymA-MtrCAB module driven by the promoter.

[0014] The second technical solution of the present invention is to provide a method for preparing the above-mentioned engineered bacteria, which comprises the following steps: (1) constructing a DNA fragment comprising a blocking gRNA expression cassette, a dCas9-SoxS fusion protein expression module, a targeting site, a specific promoter, and a CymA-MtrCAB transmembrane electron conduction protein module (comprising CymA, MtrA, MtrB, and MtrC), and connecting ADP1 homology arms (targeting the neutral site of the ADP1 genome) at both ends thereof; The construct obtained in step 1 was added to the Acinetobacter baylyi ADP1 bacterial solution with an OD600 of ≈ 0.4 and incubated at room temperature for 2 hours to achieve natural transformation and homologous recombination integration.

[0015] The third technical solution of the present invention is to provide a biosensor based on the above-mentioned engineered bacteria, comprising a conductive matrix and engineered bacteria located on the conductive matrix; the electrons generated by the engineered bacteria are output to the outside through the conductive matrix.

[0016] Furthermore, the conductive matrix is a conductive interface material such as carbon nanotubes, graphene or metal electrodes, which provides an electrical signal receiving platform for the electronic output of microorganisms.

[0017] dCas9 is a nuclease-inactive Cas9 protein expressed as a fusion with the transcriptional activator SoxS, forming a complex with transcriptional activation capabilities. The gRNA, acting as the guide element of the CRISPRa system, binds to the target sequence in the target promoter region, guiding dCas9 to precisely localize to a specific site, thereby achieving specific promoter activation. This design allows the expression of the CymA-MtrCAB protein to be fully controlled by the CRISPRa system, effectively avoiding the risk of nonspecific induction associated with traditional induction systems (such as IPTG and L-arabinose).

[0018] In this system, the gRNA targets a specific site in the upstream regulatory region near the promoter, guiding the dCas9-SoxS complex to locate and activate the target promoter, achieving promoter-dependent expression of the CymA-MtrCAB module. This promoter drives the bacterial internal protein expression machinery to transcribe a multicomponent membrane protein with electron transfer function, significantly improving the efficiency of transmembrane electron transfer in bacteria.

[0019] Among them, CymA is located in the inner cell membrane and serves as a key element for electron transfer from the cytoplasm to the peroxozone. After its expression, it cooperates with MtrA, MtrB, and MtrC to form a transmembrane electron transfer pathway, ultimately transferring the electrons generated by cellular metabolism from the inside of the cell to the outer membrane, and contacting the conductive matrix through the outer membrane protein MtrC, thereby realizing direct electron transfer between the engineered bacteria and the external electrode, generating a stable electrochemical output signal.

[0020] A third technical solution of the present invention is to provide a detection method based on the above-mentioned biosensor system, comprising the following steps: (1) A sample containing exogenous nucleic acid molecules is brought into contact with the engineered bacterial module to induce the uptake of the exogenous nucleic acid molecules under room temperature conditions; (2) The exogenous nucleic acid molecule binds to the BgRNA, deconstructs its hairpin structure, and forms an effective gRNA; the gRNA guides the dCas9-SoxS fusion protein to bind to a specific site in the upstream regulatory region of the target promoter, activating the transcription and expression of the downstream CymA-MtrCAB module; (3) After CymA-MtrCAB is expressed, a transmembrane electron transfer pathway is formed inside and outside the cell. Electrons are transferred to the electrode interface through the conductive matrix, and the output signal is collected by the electrochemical device. (4) Quantitatively analyze the concentration level of the target exogenous nucleic acid molecules in the sample based on the output electrical signal.

[0021] Furthermore, the electrochemical device is a voltammeter or an ammeter, which is used to realize real-time collection and intensity analysis of electronic output signals.

[0022] The present invention is beneficial in that: (1) The first CRISPRa-SoxS dynamic regulation mechanism based on blocking gRNA (BgRNA): By constructing a BgRNA containing a hairpin structure, the hairpin blockade can be released after binding to the target exogenous nucleic acid molecule (such as tumor mutant RNA), forming an effective gRNA to guide the dCas9-SoxS complex to the anchor site; this complex activates the transcriptional expression of the downstream CymA-MtrCAB gene module. The expressed protein realizes a highly sensitive dynamic detection pathway from exogenous nucleic acid recognition to electrical signal output through a membrane-localized electron transfer mechanism mediated by the heme cofactor.

[0023] (2) SoxS is used as a transcriptional activator to establish a direct transcriptional control pathway from recognition to output: The CRISPRa system formed by the fusion of dCas9 and SoxS can be targeted to the upstream region of the target promoter through gRNA, and SoxS directly recruits RNA polymerase to initiate transcription of the CymA-MtrCAB module, establishing a direct expression regulation pathway between exogenous signal recognition and electronic output, thereby improving signal response speed and system integration.

[0024] (3) Realizing the programmability and scenario expansion of the target recognition module: The BgRNA structural design has modular characteristics. The sequence of the hairpin region can be customized according to the nucleic acid sequence to be detected, thereby adapting to different target molecules (such as KRAS, NRAS, BRAF mutants or ctDNA, etc.). This mechanism supports the rapid reconstruction and application switching of the sensing system in various detection scenarios, reflecting good target versatility and engineering flexibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a reaction diagram of an embodiment of the present invention. DETAILED DESCRIPTION

[0026] The following examples are used to further illustrate the present invention. Their purpose is to illustrate the present invention and should not be construed as limiting the scope of the present invention. Unless otherwise specified, all references are by weight and weight percentage.

[0027] The plasmid used in this application is an existing product in the field, which is used to carry the inserted gene Unless otherwise specified, the raw materials used in the present invention are conventional commercial products; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0028] The embodiments of the present invention are further described below with reference to a number of embodiments.

[0029] It should be clear that the embodiments described are only part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0030] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The singular forms "a", "an", "the" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms unless the context clearly indicates otherwise.

[0031] Example 1 1. Construction of biosensor bacteria: Acinetobacter baylyi ADP1 strain (ATCC 33305), which has the natural ability to uptake DNA, was selected as the host.

[0032] (1) Culture in LB liquid medium at 30°C and 250 rpm until the logarithmic growth phase (OD600 ≈ 0.4); (2) A DNA fragment containing a blocking gRNA expression frame (including a hairpin structure), a dCas9-SoxS fusion protein expression module, a target site, a specific promoter, and a CymA-MtrCAB transmembrane electron conduction protein module (including CymA, MtrA, MtrB, and MtrC) was constructed, and approximately 1000 bp ADP1 homology arms (targeting the neutral site of the ADP1 genome) were connected at both ends; the construct was added to a bacterial solution with an OD600 of ≈ 0.4 at a final concentration of 100 ng / μL and incubated at room temperature for 2 hours to achieve natural transformation and homologous recombination integration; the hairpin structure region of the blocking gRNA (BgRNA) contained a sequence that was completely complementary to the exogenous nucleic acid molecule (KRASG12D mutant mRNA) and a sequence that was complementary to the target site, and the target site was set upstream of the promoter corresponding to the transmembrane electron conduction protein gene module.

[0033] The blocking gRNA expression cassette, dCas9-SoxS fusion protein expression module, DNA fragments containing the target site, specific promoter and CymA-MtrCAB transmembrane electron conduction protein module (including CymA, MtrA, MtrB, MtrC) were all introduced through plasmids.

[0034] Among them, the sequence of the blocking gRNA expression cassette is shown in SEQ ID NO.1, which is: TTTACGGCTAGCTCAGTCCTAGGTACTATACTAGTGCTGATGGCGTAGGCAAGAGACGACTCAGCATCCGTTCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTTT.

[0035]

[0036] The targeting site and promoter sequence are shown in SEQ ID NO. 3, specifically: AGCATTTGCGATCATTCACGCAGCGCTTATTCAGTTGCTCACTGCGATGTCATAATCATCGCTACGAGCTGTGAAAGATGCATAAAGCTCGTACGACGCGTTCGCTCGTCTCCTCACTTCTCCTACGACTCAGCATCCGTTCTCCGTCGTCTTGAAGTTGCGATTATAGA TTGAC AGCTAGCTCAGTCCTAGGGATTGTGCTAGC.

[0037]

[0038] (3) After incubation for 2 hours, the cells were spread on LB solid plates containing kanamycin (50 μg / mL) and cultured overnight at 30°C. The integration sites of positive clones were identified by PCR, and the transcriptional expression of the modules was verified by RT-qPCR.

[0039] A sensor engineering strain that can stably express the ternary module (denoted as ADP1-KRAS-sensor) was obtained.

[0040] 2. mRNA triggering experiment design: During the target sample detection phase, the constructed ADP1-KRAS-sensor strain was exposed to a simulated body fluid environment, and a specific sequence of KRAS G12D mutant mRNA was added as a trigger factor.

[0041] The experimental system is as follows: project Conditions and composition Detection of bacteria <![CDATA[ADP1-KRAS-sensor,10 7 CFU / mL]]> culture medium <![CDATA[M9 minimal medium + 0.2% glucose + 1 mM MgSO4]]> mRNA input Synthetic KRAS G12D mutant mRNA, final concentration 0–100 nM Cultivation temperature and time Incubate at 37°C for 1 hour control group No mRNA group + wild-type KRAS mRNA group (100 nM) KRAS mutant mRNA binds to and opens the hairpin structure of the blocking gRNA, restoring its guiding ability to dCas9-SoxS and inducing the expression of the downstream CymA-MtrCAB protein transcribed by a specific promoter.

[0042] 3. Electronic output and signal detection system The CymA-MtrCAB module completes the electron transmembrane transfer process within the cell: CymA transfers cellular metabolic electrons to MtrA in the membrane; MtrB assists in the transmission of electrons across the membrane; MtrC outputs electrons to the surface of a standard metal electrode (such as an ITO glass electrode or an Au / Pt thin film electrode); the electrodes are connected to a voltammeter to collect the electrical signal output.

[0043] The experiment used a three-electrode system: the working electrode was an Au thin film electrode; the reference electrode was Ag / AgCl; the auxiliary electrode was a Pt wire; and the electrolyte was PBS buffer (pH 7.4).

[0044] Electrochemical measurement method: Chronoamperometry (constant potential: +0.2 V), collecting current change curves, recording time for 5 minutes.

[0045] 4. Experimental Results and Performance Evaluation Under the specified system conditions (KRAS G12D mutant mRNA concentration range of 0–100 nM, reaction time of 1 hour), the electron output current of the engineered strain ADP1-KRAS-sensor was recorded on a standard metal electrode using electrochemical detection. The experimental results showed: With increasing KRAS mRNA concentration, the current signal gradually increased, and the system showed a good concentration-responsive trend; the current change was approximately linear in the 1–100 nM range, and the peak current variation within the response interval could reach approximately 5-fold; the signals of the blank control group (no mRNA) and the nonspecific control group (wild-type KRAS mRNA) were close to the baseline level, indicating that the system has a specific response ability to mutant sequences; the theoretical estimated detection limit is approximately 0.7 nM (calculated at a signal-to-noise ratio (S / N) of 3), and the response time does not exceed 30 minutes; the system has good stability, and the current drift rate is less than ±10% after repeated detection for more than 3 times.

[0046] Comparative Example 1 Experimental conditions: The host strain was Acinetobacter baylyi ADP1 (ATCC 33305); the culture medium used was LB liquid medium + kanamycin (50 μg / mL); the culture conditions were 30°C, 250 rpm, and the culture was cultured to an OD600 ≈ 0.4. Using a natural transformation method, DNA containing the building block (100 ng / μL) was added to the culture medium, and the culture was incubated at room temperature for 2 hours before plate screening.

[0047] Building blocks: Comparative example: expressing dCas9 and SoxS respectively; The present invention uses dCas9-SoxS fusion protein as a driver, and the gRNA target is located upstream of the cymA promoter.

[0048] mRNA trigger: KRAS G12D synthetic mutant mRNA, concentration 10 nM, incubation for 1 hour.

[0049] Detection platform: three-electrode system, working electrode is gold thin film (Au), PBS buffer (pH 7.4).

[0050] Electrochemical detection method: Chronoamperometry, applying a voltage of +0.2 V (vs Ag / AgCl), and collecting the response current. Construction method cymA mRNA expression (relative) Response current peak (μA) Response time (min) Targeting and consistency SoxS episomal expression 1.0±0.3 0.7±0.3 Unstable Poor (nonspecific) dCas9-SoxS fusion expression 8.2 ± 0.5 5.2 ± 0.2 <30 High (gRNA targeting) The results showed that although the freely expressed SoxS has activation ability, it cannot achieve site-specific activation of the promoter, with a high background expression level and unstable response; the dCas9-SoxS fusion strategy adopted in the present invention, with the help of gRNA targeting, can significantly improve the expression and electronic output signal of the downstream module (cymA-MtrCAB), reflecting good response consistency and regulatory accuracy.

[0051] The above embodiments describe in detail the structure, features and effects of the present invention. The above are only preferred embodiments of the present invention. Any changes made in accordance with the concept of the present invention, or modifications to equivalent embodiments with equivalent changes, which do not exceed the scope covered by the specification, should be within the scope of protection of the present invention.

Claims

1. An engineered bacterium, characterized in that have: proteins that take up foreign nucleic acid molecules; and, dCas9-SoxS fusion protein and blocking gRNA (BgRNA) linked to the dCas9-SoxS fusion protein; Among them, BgRNA releases the hairpin structure blockade by binding to exogenous nucleic acid molecules, guiding the dCas9-SoxS fusion protein to target a specific promoter and initiate the transcription of transmembrane electron conducting proteins; the transmembrane electron conducting proteins include CymA, MtrA, MtrB, and MtrC proteins; the hairpin structure region of the blocking gRNA (BgRNA) contains a sequence that is completely complementary to the exogenous nucleic acid molecule and a sequence complementary to the targeting site, and the targeting site is located upstream of the specific promoter.

2. The engineered bacterium according to claim 1, characterized in that The proteins that take up exogenous nucleic acid molecules are ComEA, ComEC and ComP proteins.

3. The engineered bacterium according to claim 1, characterized in that The engineered bacteria uses Acinetobacterbaylyi ADP1 as a carrier.

4. The engineered bacterium according to claim 1, characterized in that The exogenous nucleic acid molecule is a mutant of the KRAS, NRAS or BRAF gene or circulating tumor DNA (ctDNA).

5. The method for preparing the engineered bacteria according to claim 1, wherein: The method comprises the following steps: (1) constructing a DNA fragment containing a blocking gRNA expression frame, a dCas9-SoxS fusion protein expression module, a targeting site, a specific promoter, and a CymA-MtrCAB transmembrane electron conduction protein module (containing CymA, MtrA, MtrB, and MtrC), and connecting ADP1 homology arms at both ends; (2) Add the gene obtained in step 1 to the Acinetobacter baylyi ADP1 bacterial solution and incubate at room temperature for 2 hours to achieve natural transformation and homologous recombination integration.

6. A biosensor based on the engineered bacteria according to claim 1, characterized in that: The invention comprises a conductive matrix and engineered bacteria located on the conductive matrix; electrons generated by the engineered bacteria are output to the outside through the conductive matrix.

7. The biosensor according to claim 6, wherein The conductive matrix is carbon nanotube, graphene or metal electrode.

8. A detection method based on the biosensor system according to claim 6, characterized in that: The following steps are involved: (1) A sample containing exogenous nucleic acid molecules is brought into contact with the engineered bacterial module to induce the uptake of the exogenous nucleic acid molecules under room temperature conditions; (2) Exogenous nucleic acid molecules bind to BgRNA, activating the dCas9-SoxS complex to drive the transcription and expression of CymA, MtrA, MtrB, and MtrC proteins; (3) After CymA-MtrCAB is expressed, a transmembrane electron transfer pathway is formed inside and outside the cell. Electrons are transferred to the electrode interface through the conductive matrix, and the output signal is collected by the electrochemical device. (4) Quantitatively analyze the concentration level of the target exogenous nucleic acid molecules in the sample based on the output electrical signal.

9. The method according to claim 8, characterized in that The electrochemical device is a voltammeter or an ammeter.

Images