Recombinant strain and application thereof in biosynthesis of inositol
By constructing a recombinant strain of the inositol-3-phosphate synthase gene mBbino1 and the E. coli inositol-1-monophosphatase gene suhB, the fermentation conditions were optimized, and the low yield and long cycle of yeast biosynthesis inositol were solved, and efficient inositol production was achieved.
Patent Information
- Application Number
- CN202510611939.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-19
AI Technical Summary
The existing yeast biosynthesis of inositol is subject to strict and complex regulation by the body, and there are problems of long fermentation cycle and low yield.
By constructing the recombinant strain, the modified Brussels cerevisiae inositol-3-phosphate synthase gene mBbino1 and E. coli inositol-1-monophosphatase gene suhB were co-expressed, and the fermentation conditions were optimized to improve inositol production.
Under optimized conditions, the inositol production reached 106.43 mg/L, achieving efficient inositol biosynthesis, laying the foundation for industrial production.
Smart Images

Figure CN120505262A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of synthetic biology, and in particular relates to the new technical field of a biosynthetic method of inositol. Background Art
[0002] Inositol (Myo-inositol), also known as cyclohexane hexol, is a cyclic polyhydroxy alcohol with a relative molecular mass of 180.16 and a molecular formula of C6H 12 O6. At room temperature, inositol is a white crystalline powder with a slightly sweet taste, is easily hygroscopic, and is stable in air. It is slightly soluble in ethanol and insoluble in ether, and is widely present in eukaryotic cells, animals, plants, and microorganisms. Inositol has a wide range of applications. In the pharmaceutical field, it is used to produce drugs such as inositol tablets, inositol nicotinate, and fluoroinositol, and is used as an auxiliary treatment for vitamin deficiency, neurological disorders (such as panic disorder, depression, and autism), and vascular sclerosis. It also has certain anti-cancer activity. In the feed industry, inositol acts as a growth promoter, promoting the growth and development of young animals. For aquatic animals, inositol is an essential nutrient; a deficiency can lead to diseases such as reduced feed conversion rate, decreased growth rate, fin erosion, darkening of the skin, and fatty liver. In the food industry, inositol has a protective effect on the liver and is a nutrient necessary for liver cell growth. It has positive effects on lipid metabolism, bone formation, and skeletal muscle metabolism.
[0003] At present, the production methods of inositol mainly include chemical hydrolysis, enzymatic hydrolysis, chemical synthesis and microbial fermentation with broad application prospects. The chemical hydrolysis process is mature and the raw materials are easily available, but there are problems of high cost and low yield, and the acid and alkali reagents used can pollute the environment. The enzymatic hydrolysis method has a higher production titer and yield, but the enzyme has poor stability and the separation process is more complicated. Although the chemical synthesis method can obtain highly purified inositol, the separation steps of the end product are cumbersome and the yield is low, making it difficult to achieve industrial large-scale production. In contrast, the microbial fermentation method has the characteristics of green and sustainable production, and is highly safe, easy to operate, and economical. It is currently the most promising production method that conforms to market trends.
[0004] In recent years, because yeast has its own endogenous pathway for synthesizing inositol, inositol-3-phosphate synthase (MIPS) plays a key role in yeast inositol synthesis. MIPS can catalyze the conversion of glucose-6-phosphate into inositol-1-phosphate, which then produces inositol under the catalysis of inositol monophosphatase. Huang Zhenjie cloned the inositol-3-phosphate synthase gene ino1 into Saccharomyces cerevisiae through genetic engineering, and knocked out the transcriptional repressor gene and resistance gene in inositol synthesis, achieving an inositol production of 1.021g / L in shake flask fermentation. However, the biosynthesis of inositol by yeast is subject to strict and complex regulation by the body, and there are problems such as long fermentation cycle and low yield. Summary of the Invention
[0005] The existing method of synthesizing inositol using yeast is subject to strict and complex regulation by the body, resulting in long fermentation cycles and low yields. The technical problem to be solved by the present invention is to construct an efficient inositol biosynthesis pathway by prokaryotic co-expression of the modified Brussels yeast inositol phosphate synthase gene mBbino1 and the Escherichia coli inositol-1-monophosphatase gene suhB, and optimize fermentation conditions to increase inositol production. The technical solution provided by this application provides new ideas and technical routes for the research of different types of inositol-3-phosphate synthase (ION1), and lays the foundation for the industrial production of inositol.
[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:
[0007] The present application provides a recombinant strain, which is a recombinant Escherichia coli containing a modified inositol-3-phosphate synthase gene and an inositol-1-monophosphatase gene;
[0008] The modified inositol-3-phosphate synthase gene is derived from Brettanomyces brusselsii, and the inositol-1-monophosphatase gene is derived from Escherichia coli;
[0009] The gene sequence of the modified Brettanomyces brusselsii mBbino1 is shown in SEQ ID NO: 1;
[0010] The recombinant Escherichia coli is recombinant Escherichia coli BL21 (DE3).
[0011] Preferably, the amino acid sequence of the modified Brettanomyces bruxellensis mBbinol in the recombinant strain is shown as SEQ ID NO: 2.
[0012] The Escherichia coli suhB gene in the recombinant strain is selected from Escherichia coli K-12 MG1655 strain (Escherichia coli str. K-12 substr. MG1655), gene ID: 947285, and the gene sequence is shown in SEQ ID NO: 3;
[0013] Furthermore, the present application also provides a method for preparing a recombinant strain, comprising the steps of: constructing a recombinant plasmid pETDute-1-mBbino1-suhB containing the modified Brussels yeast mBbino1 gene and the Escherichia coli suhB gene, and transferring the plasmid into Escherichia coli to obtain the recombinant strain; the recombinant Escherichia coli is recombinant Escherichia coli BL21 (DE3).
[0014] The modified Brettanomyces bruxellensis mBbino1 gene was subcloned into the multiple cloning site downstream of the 6×His tag of the pETDuet-1 plasmid through the BamHI and HindIII double restriction sites, i.e., the first MCS (“MCS” refers to “Multiple Cloning Site”);
[0015] The Escherichia coli suhB gene was subcloned into the multiple cloning site upstream of the S-tag tag of the pETDuet-1 plasmid, i.e., the second MCS, through the double restriction sites of NdeI and XhoI;
[0016] The upstream primer sequence for amplifying the modified Brettanomyces brusselsii mBbino1 gene is shown in SEQ ID NO: 4, and the downstream primer sequence for amplifying the modified Brettanomyces brusselsii mBbino1 gene is shown in SEQ ID NO: 5;
[0017] The upstream primer sequence for amplifying the E. coli suhB gene is shown in SEQ ID NO: 6, and the downstream primer sequence for amplifying the E. coli suhB gene is shown in SEQ ID NO: 7;
[0018] The present application also provides the use of the recombinant strain or the recombinant strain prepared by the preparation method of the recombinant strain in the preparation of inositol.
[0019] Furthermore, the present application also provides a method for preparing inositol, comprising the steps of: fermenting the above-mentioned recombinant strain or the recombinant strain prepared by the above-mentioned method for preparing the recombinant strain to obtain the inositol.
[0020] Furthermore, the present application provides a method for preparing inositol, which specifically includes the steps of: inoculating the recombinant strain into an LB solid culture medium containing ampicillin, and obtaining a bacterial liquid after culturing; adding the bacterial liquid to an M9Y culture medium with glucose as the sole carbon source for culturing, adding IPTG, and inducing the culture to obtain the inositol.
[0021] The formula of the M9Y culture medium with glucose as the sole carbon source is:
[0022] Glucose concentration is 5g / L-40g / L. Accurately weigh 6g Na2HPO4, 0.5g NaCl, 3g KH2PO4, 1g NH4Cl, and 5g yeast extract, dissolve them in deionized water, and adjust the volume to 1L. Add sodium hydroxide to adjust the pH to 7.2, and sterilize with high-temperature steam at 121°C.
[0023] 1M MgSO4: Dissolve 12 g of anhydrous MgSO4 in 100 mL of deionized water and sterilize by high-temperature steam sterilization at 121°C. Add to M9Y medium at a ratio of 1:2000 before use.
[0024] 0.1M calcium chloride: Dissolve 1.11 g of calcium chloride in 100 mL of deionized water, sterilize with steam at 121°C, and add to M9Y medium at a 1:1000 ratio before use.
[0025] Preferably, the method for preparing inositol specifically comprises the steps of: inoculating the recombinant strain into LB solid medium containing 100 mg / L ampicillin and culturing at 37°C overnight; picking positive clones, inoculating them into LB liquid medium containing 100 mg / L ampicillin, and culturing them at 37°C and 180 rpm for 5 hours to obtain a bacterial solution; setting the glucose concentration to 5 g / L-40 g / L and the pH value to 5.0-9.0, inoculating the seed solution at an inoculum size of 1%-10% (V / V) into a 250 mL shake flask containing 50 mL fermentation medium, and culturing the fermentation solution at 37°C and 180 rpm until the OD value of the fermentation solution reaches 0.001. 600 When the pH value is between 0.4 and 0.6, IPTG with a final concentration of 0.05-1.5 mM is added for induction, and the culture is continued at 24° C. and 180 rpm for 48 h, followed by centrifugation to obtain the inositol.
[0026] More preferably, the glucose concentration is 9 g / L; the IPTG concentration is 0.1 mM; the seed solution inoculation amount is 7%; and the initial pH value is 8.3.
[0027] Furthermore, the present application also provides the application of the inositol preparation method in the prepared inositol.
[0028] Through the above technical solutions, this application achieves the following technical effects:
[0029] (1) The technical solution provided in this application selects a modified inositol-3-phosphate synthase gene mBbino1 fragment of Brettanomyces bruxellensis and an inositol-1-monophosphatase gene suhB fragment of Escherichia coli. The modified mBbino1 and suhB genes are co-expressed in recombinant Escherichia coli BL21 (DE3) to construct the pETDuet-1-mBbino1-suhB / BL21 (DE3) recombinant strain. This provides theoretical guidance and basis for the construction of efficient inositol biosynthesis biological elements for inositol-3-phosphate synthase (ION1) from different sources.
[0030] (2) The technical solution provided in this application explored the constructed recombinant Escherichia coli prokaryotic expression protein and the optimization of inositol fermentation conditions. Under 24°C conditions, both mBbino1 and SuhB proteins were expressed in a soluble form, successfully achieving heterologous expression and being used for inositol production. The results of single-factor fermentation condition optimization showed that the inositol production reached the highest level when the glucose concentration was 10 g / L, the IPTG concentration was 0.1 mM, the inoculum size was 8%, and the initial pH was 8.0. Through response surface analysis, the optimal fermentation conditions were obtained as follows: glucose concentration 9 g / L, IPTG final concentration 0.1 mM, inoculum size 7%, and initial pH 8.3, at which time the inositol fermentation yield was 106.43 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 Shown are the expression results of recombinant pETduet-1-mBbino1-suhB / BL21(DE3) at 28°C and 24°C.
[0032] Panel A shows the expression at 28°C; Panel B shows the expression at 24°C. M is a protein molecular weight standard; 1 and 5 are bacterial lysates before IPTG induction; 2 and 6 are bacterial lysates after IPTG induction; 3 and 7 are supernatants after ultrasonic disruption; 4 and 8 are precipitates after ultrasonic disruption.
[0033] Figure 2 Shown is a graph of the inositol standard curve.
[0034] Figure 3 Shown is the ultra-high performance liquid chromatography-mass spectra of inositol standards.
[0035] Figure 4 Shown is a graph showing the effect of IPTG on inositol production.
[0036] Figure 5 Shown is a graph showing the effect of glucose concentration on inositol production.
[0037] Figure 6 Shown is a graph showing the effect of inoculum size on inositol production.
[0038] Figure 7 Shown is a graph showing the effect of initial pH on inositol production.
[0039] Figure 8 Shown is a graph showing the effect of time on inositol production.
[0040] Figure 9 Shown is a response surface plot.
[0041] Figure A shows the surface and contour curves of the interactive effect of IPTG and glucose; Figure B shows the surface and contour curves of the interactive effect of inoculum size and glucose; Figure C shows the surface and contour curves of the interactive effect of pH and glucose; Figure D shows the surface and contour curves of the interactive effect of inoculum size and IPTG; Figure E shows the surface and contour curves of the interactive effect of pH and IPTG; Figure F shows the surface and contour curves of the interactive effect of pH and inoculum size on the production of inositol by strain pETduet-1-mBbino1-suhB / BL21(DE3). DETAILED DESCRIPTION
[0042] The technical solutions of the present invention are described clearly and completely below with reference to the embodiments. It is obvious that the embodiments described are only a portion of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.
[0043] The reagents used in the present invention are: sodium chloride, sodium hydroxide, calcium chloride, magnesium sulfate, acetone and glacial acetic acid, all purchased from Chongqing Chuandong Chemical Co., Ltd.; tryptone, yeast extract, glucose, agar powder, agarose, GelRed nucleic acid dye, ampicillin sodium, isopropyl β-D-thiogalactoside, tris(hydroxymethyl)aminomethane, sodium dodecylsulfonate, acrylamide, methylene acrylamide, ammonium persulfate, ethylenediaminetetraacetic acid, glycerol, glycine, and a plasmid extraction kit, all purchased from Shanghai Shenggong Bioengineering Co., Ltd.
[0044] The instruments and equipment used in this application are: intelligent electric constant temperature incubator (DHP-9160B) purchased from Shanghai Yiheng Scientific Instrument Co., Ltd.; ultrapure water manufacturing system (UPH-Ⅱ-20T) purchased from Sichuan Youpu Ultrapure Technology Co., Ltd.; constant temperature incubation shaker (HZ150L) purchased from Shanghai Jingsheng Scientific Instrument Co., Ltd.; electrophoresis system (Trans-blot SD Cell, SDS-PAGE) purchased from Bio-Rad; ultrasonic experimental equipment (JY92-IIDN) purchased from Ningbo Xinzhi Biotechnology Co., Ltd.; medical refrigerated centrifuge (TGL-16) purchased from Sichuan Shuke Instrument Co., Ltd.; desktop centrifuge (TGL-16M) purchased from Shanghai Lu Xiangyi; full wavelength microplate reader (ReadMax1200) purchased from Shanghai Shanpu Biotechnology Co., Ltd.; ACQUIY UPLC liquid chromatograph purchased from Waters Corporation; liquid chromatograph mass spectrometer QTRAP 4500 purchased from AB SCIEX.
[0045] The Escherichia coli BL21 (DE3) used in this application is a conventional strain, which can be purchased by the general public from any biological company.
[0046] Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.
[0047] Example 1: A recombinant strain
[0048] The present application provides a recombinant strain, which is a recombinant Escherichia coli containing a modified inositol-3-phosphate synthase gene and an inositol-1-monophosphatase gene;
[0049] The modified inositol-3-phosphate synthase gene is derived from Brettanomyces brusselsii, and the inositol-1-monophosphatase gene is derived from Escherichia coli;
[0050] The gene sequence of the modified Brettanomyces brusselsii mBbino1 is shown in SEQ ID NO: 1;
[0051] The recombinant Escherichia coli is recombinant Escherichia coli BL21 (DE3).
[0052] Preferably, the amino acid sequence of the modified Brettanomyces bruxellensis mBbinol in the recombinant strain is shown as SEQ ID NO: 2.
[0053] The Escherichia coli suhB gene in the recombinant strain is selected from Escherichia coli K-12 MG1655 strain (Escherichia coli str. K-12 substr. MG1655), gene ID: 947285, and the gene sequence is shown in SEQ ID NO: 3;
[0054] Example 2: A method for preparing a recombinant strain
[0055] The present application provides a method for preparing a recombinant strain, comprising the steps of: constructing a recombinant plasmid pETDute-1-mBbino1-suhB containing a modified Brussels yeast mBbino1 gene and an Escherichia coli suhB gene, and transferring the plasmid into Escherichia coli to obtain the recombinant strain; the recombinant Escherichia coli is a recombinant Escherichia coli BL21 (DE3).
[0056] The modified B. brusselsii mBbino1 gene was subcloned into the multiple cloning site downstream of the 6×His tag of the pETDuet-1 plasmid, i.e., the first MCS, through the BamHI and HindIII double restriction sites;
[0057] The Escherichia coli suhB gene was subcloned into the multiple cloning site upstream of the S-tag tag of the pETDuet-1 plasmid, i.e., the second MCS, through the double restriction sites of NdeI and XhoI;
[0058] The upstream primer sequence for amplifying the modified Brettanomyces brusselsii mBbino1 gene is shown in SEQ ID NO: 4, and the downstream primer sequence for amplifying the modified Brettanomyces brusselsii mBbino1 gene is shown in SEQ ID NO: 5;
[0059] The upstream primer sequence for amplifying the E. coli suhB gene is shown in SEQ ID NO: 6, and the downstream primer sequence for amplifying the E. coli suhB gene is shown in SEQ ID NO: 7;
[0060] The present application also provides the use of the recombinant strain or the recombinant strain prepared by the preparation method of the recombinant strain in the preparation of inositol.
[0061] Example 3: A method for preparing inositol
[0062] The present application also provides a method for preparing inositol, comprising the steps of: fermenting the above-mentioned recombinant strain or the recombinant strain prepared by the above-mentioned method for preparing the recombinant strain to obtain the inositol.
[0063] Furthermore, the present application provides a method for preparing inositol, which specifically includes the steps of: inoculating the recombinant strain into an LB solid culture medium containing ampicillin, and obtaining a bacterial liquid after culturing; adding the bacterial liquid to an M9Y culture medium with glucose as the sole carbon source for culturing, adding IPTG, and inducing the culture to obtain the inositol.
[0064] The formula of the M9Y culture medium with glucose as the sole carbon source is:
[0065] Glucose concentration is 5g / L-40g / L. Accurately weigh 6g Na2HPO4, 0.5g NaCl, 3g KH2PO4, 1g NH4Cl, and 5g yeast extract, dissolve them in deionized water, and adjust the volume to 1L. Add sodium hydroxide to adjust the pH to 7.2, and sterilize with high-temperature steam at 121°C.
[0066] 1M MgSO4: Dissolve 12 g of anhydrous MgSO4 in 100 mL of deionized water and sterilize by high-temperature steam sterilization at 121°C. Add to M9Y medium at a ratio of 1:2000 before use.
[0067] 0.1M calcium chloride: Dissolve 1.11 g of calcium chloride in 100 mL of deionized water, sterilize with steam at 121°C, and add to M9Y medium at a 1:1000 ratio before use.
[0068] Preferably, the method for preparing inositol specifically comprises the steps of: inoculating the recombinant strain into LB solid medium containing 100 mg / L ampicillin and culturing at 37°C overnight; picking positive clones, inoculating them into LB liquid medium containing 100 mg / L ampicillin, and culturing them at 37°C and 180 rpm for 5 hours to obtain a bacterial solution; setting the glucose concentration to 5 g / L-40 g / L and the pH value to 5.0-9.0, inoculating the seed solution at an inoculum size of 1%-10% (V / V) into a 250 mL shake flask containing 50 mL fermentation medium, and culturing the fermentation solution at 37°C and 180 rpm until the OD value of the fermentation solution reaches 0.001. 600 When the pH value is between 0.4 and 0.6, IPTG with a final concentration of 0.05-1.5 mM is added for induction, and the culture is continued at 24° C. and 180 rpm for 48 h, followed by centrifugation to obtain the inositol.
[0069] More preferably, the glucose concentration is 9 g / L; the IPTG concentration is 0.1 mM; the seed solution inoculation amount is 7%; and the initial pH value is 8.3.
[0070] Furthermore, the present application also provides the application of the inositol preparation method in the prepared inositol.
[0071] Example 4: Construction of a prokaryotic co-expression vector of mBbino1 and suhB genes
[0072] This application designed a cloning strategy with restriction enzyme cutting sites based on the pETDuet-1 plasmid and target gene sequence.
[0073] (1) Plasmid construction
[0074] The modified Brettanomyces bruxellensis mBbino1 gene was subcloned into the multiple cloning site (first MCS) downstream of the 6×His tag in the pETDuet-1 plasmid using the BamHI and HindIII restriction sites. Simultaneously, the Escherichia coli suhB gene was subcloned into the multiple cloning site (second MCS) upstream of the S-tag tag in the pETDuet-1 plasmid using the NdeI and XhoI restriction sites to construct the recombinant expression vector pETDuet-1-mBbino1-suhB. The recombinant plasmids were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; the specific sequences are shown in Table 1.
[0075] Table 1: pETDute-1-mBbino1-suhB plasmid cloning sites
[0076] Sequence number name Sequence (5'-3') Restriction site SEQ ID NO: 4 mBbino1 upstream <![CDATA[ GGATCC GATGACTACTAATTACGTTCCCAA]]> BamHI SEQ ID NO: 5 Downstream of mBbino1 <![CDATA[AGGTTTGAGGAGAGACTAAACTAA AAGCTT ]]> HindIII SEQ ID NO: 6 suhB upstream <![CDATA[ CATATG ATGCATCCGATGCTGAACATCGCC]]> NdI SEQ ID NO: 7 downstream of suhB <![CDATA[GAGTTAAGCGACGCTCTGAAGCGT CTCGAG ]]> XOt
[0077] Note: The underline indicates the restriction site
[0078] (2) Prokaryotic expression
[0079] The constructed recombinant expression vector pETDuet-1-mBbino1-suhB was transformed into Escherichia coli BL21 (DE3) competent cells, and the transformed bacterial solution was inoculated on LB solid medium containing 100 mg / L ampicillin and cultured at 37°C overnight. Positive clones were picked and inoculated into LB liquid medium containing 100 mg / L ampicillin, and cultured at 37°C and 180 rpm for 5 h. 600 When the p-value reached 0.6-0.8, IPTG was added to a final concentration of 50 μmol / L and expression was induced at 24°C and 30°C. A positive bacterial solution without IPTG was used as a pre-induction control. The cells were harvested, resuspended and washed twice with PBS buffer (pH 7.4), and centrifuged at 8000 rpm and 4°C for 15 minutes. Cells were disrupted using ultrasonication at 200 W for 5 seconds with 7 seconds intervals for a total of 90 times. The supernatant and precipitate were collected, and protein expression was analyzed by SDS-PAGE.
[0080] (3) Result determination
[0081] Protein electrophoresis results are shown in the attached Figure 1 As shown in the figure, the target protein size was predicted by Snapgene software. The mBbino1 protein of B. bruxellensis was about 59.0 kDa, and the suhB protein of E. coli was about 29.2 kDa. After IPTG induction, the protein had two obvious protein bands at about 60 kDa and 30 kDa ( Figure 1 Middle panel A, lane 2), where at 24°C ( Figure 1 Middle panel B) and 28℃( Figure 1 The expression was induced at 24°C and the result was soluble protein ( Figure 1 Middle panel B, lane 7), the induction expression temperature was 28°C, the protein was insoluble ( Figure 1 Middle panel A, lane 4). The electrophoresis diagram shows that the molecular weights of the proteins expressed by the mBbino1 gene and the suhB gene are basically consistent with the theoretical sizes.
[0082] Example 5: UPLC-MS detection of inositol standard curve
[0083] (1) Measurement method
[0084] The detection method of inositol is slightly modified according to the national standard "SN / T 5147-2019"; the UPLC-MS method is chromatographic column: C 18Reverse-phase column, 50 mm × 2.1 mm (inner diameter), 1.7 μm; mobile phase: acetonitrile: ammonia water = 80%:20% (v:v); flow rate: 0.2 mL / min; column temperature: 40°C; injection volume: 1 μL; ion source: electrospray ionization (ESI); scan mode: negative ion scan; detection mode: multiple reaction selected ion monitoring (MRM); electrospray voltage (IS): -4500 V; ion source temperature (TEM): 500°C; Curtain gas N2 (CUR): 25; Nebulizer gas N2 (GAS1): 50; Heating assist gas N2 (GAS2): 50; Collision gas N2 (CAD): medium; Inositol parent ion: 179.1 m / z; Product ion: 161.0 m / z; Declustering voltage (DP) / (V): -60; Entrance voltage (DP) / (V): -10; Collision energy (CE) / (V): -20; Exit voltage (CXP) / (V): -15.
[0085] Preparation of standard inositol solution: Accurately weigh 50 mg of inositol standard material into a 100 mL volumetric flask, dilute to the mark, and prepare a 500 mg / L inositol solution. Store in dark. Measure 1 mL of the prepared 500 mg / L inositol solution into a 50 mL volumetric flask and dilute to the mark to prepare a 10 mg / L inositol standard intermediate solution. Add 0.1 mL, 0.2 mL, 0.5 mL, 1.00 mL, and 2.00 mL of the inositol standard intermediate solution to a 10 mL brown volumetric flask, dilute to the mark, and mix thoroughly. The concentrations of this standard series of working solutions are 0.1 mg / L, 0.2 mg / L, 0.5 mg / L, 1.0 mg / L, and 2.0 mg / L, respectively. Filter through a 0.22 μm filter membrane and analyze the inositol peak area using UPLC-MS. A standard curve of inositol concentration versus peak area is generated.
[0086] (2) Measurement results
[0087] See attached Figure 2 It can be seen that the linear regression equation of the inositol standard curve is y=721129.35323x+10861.69154, and the correlation coefficient R 2 =0.99899. According to the correlation coefficient of the standard curve, it can be seen that the linear fit is good and can be used for sample detection and analysis. Figure 3 It can be seen that the retention time of the standard inositol is 0.741 min, and UPLC-MS can well detect inositol.
[0088] Example 6: Fermentation process optimization
[0089] (1) Single-factor experiment
[0090] Based on M9Y medium (M9 medium with yeast extract added) with glucose as the sole carbon source, four conditions, namely, final IPTG concentration, glucose concentration, inoculation amount and initial pH value, were optimized through single-factor experiments. The effect of time on fermentation was determined based on the optimized conditions.
[0091] The final IPTG concentration gradient was set to 0mM, 0.05mM, 0.1mM, 0.5mM, 1.0mM, and 1.5mM, with an inoculum size of 1% (V / V), a glucose concentration of 20g / L, an initial pH of 7.0, a fermentation temperature of 24°C, and a fermentation time of 24h in a 50mL / 250mL shake flask system. The optimal IPTG concentration was determined by measuring inositol production at different final IPTG concentrations.
[0092] Initial glucose concentrations were set at 5 g / L, 10 g / L, 20 g / L, 30 g / L, and 40 g / L, with an inoculum size of 1% (v / v), a final IPTG concentration of 0.1 mM, an initial pH of 7.0, a fermentation temperature of 24°C, and a fermentation time of 24 h in a 50 mL / 250 mL shake flask system. Inositol production was measured at these different initial glucose concentrations to determine the initial glucose concentration.
[0093] The inoculum size was set at 1%, 2%, 5%, 8%, and 10%, with an initial glucose concentration of 10 g / L, a final IPTG concentration of 0.1 mM, an initial pH of 7.0, a fermentation temperature of 24°C, and a fermentation time of 24 hours in a 50 mL / 250 mL shake flask system. Inositol yields were measured at different inoculum sizes to determine the optimal inoculum size.
[0094] Initial pH values were set at 5.0, 6.0, 7.0, 8.0, and 9.0, with an initial glucose concentration of 10 g / L, a final IPTG concentration of 0.1 mM, an inoculum size of 8%, a fermentation temperature of 24°C, and a fermentation time of 24 hours in a 50 mL / 250 mL shake flask system. Inositol yields were measured at different initial pH values to determine the optimal initial pH.
[0095] Based on the previous optimization, the initial glucose concentration was set to 10 g / L, the initial pH value was 8.0, and the seed solution was inoculated with 8% of the inoculum into a 250 mL shake flask containing 50 mL of fermentation medium. The culture was carried out at 37 ° C and 180 rpm until the fermentation liquid OD 600 When the pH value was between 0.4 and 0.6, IPTG was added to induce the culture at a final concentration of 0.1 mM and the culture was continued at 24°C and 180 rpm. Samples were taken every six hours for the determination of inositol production for a total of 48 hours.
[0096] (2) Optimization of the optimal fermentation conditions of the recombinant strain pETduet-1-mBbino1-suhB / BL21(DE3) by response surface methodology
[0097] Based on the results of the single-factor experiment, a response surface experiment with four factors and three levels was conducted using the Box-Behnken design in Design-Expert 13 software.
[0098] (3) Data statistics and analysis
[0099] In this application, Origin 2021 was used for plotting, the response surface methodology was performed using Design-Experts 13.0 software, and UPLC-MS data processing was performed using Analyst software.
[0100] (4) Single-factor experimental analysis results
[0101] See attached Figure 4 As shown in Figure 1, when the final IPTG concentration is about 0.1mM, the inositol fermentation yield reaches the highest value (47.8mg / L). As the final IPTG concentration increases, the inositol production shows a downward trend. There is a significant difference in inositol production between the control group without IPTG addition and the induction group with IPTG addition. Therefore, 0.1mM IPTG was selected as the optimal induction concentration.
[0102] Using glucose as the sole carbon source and glucose-6-phosphate as the substrate for inositol synthesis, inositol biosynthesis is achieved. Figure 5 As shown, inositol production initially increases and then decreases with increasing glucose concentration. At a glucose concentration of 10 g / L, inositol production reaches a maximum of 68.5 mg / L. Excessively high glucose concentrations may inhibit bacterial growth, leading to a decrease in inositol production.
[0103] The size of the inoculation volume directly affects the growth rate of E. coli and the fermentation cycle, which in turn affects the synthesis of inositol. Figure 6 As shown, inositol production initially increases and then decreases with increasing inoculum size. At an inoculum size of 8%, inositol production reaches its peak, reaching 101.3 mg / L. When the inoculum size increases from 8% to 10%, inositol production begins to decline. This may be due to excessive inoculum size leading to rapid bacterial growth, high fermentation broth viscosity, and insufficient dissolved oxygen, which affects metabolic levels. Furthermore, rapid substrate consumption may also inhibit inositol synthesis. Therefore, 8% was selected as the optimal inoculum size for recombinant E. coli fermentation to produce inositol.
[0104] See attached Figure 7 As can be seen, as the initial pH continues to increase, inositol production continues to increase. At pH 8.0, inositol production reaches a maximum of 91.1 mg / L, and then begins to decline. This is because E. coli's glucose metabolism produces a large amount of acetic acid as fermentation continues, which in turn affects bacterial growth and the synthesis of metabolites.
[0105] See attached Figure 8 As shown in the figure, inositol production increased with fermentation time. At around 32 hours, inositol production reached 95.8 mg / L. Thereafter, as fermentation time continued to increase, inositol production remained relatively stable, possibly indicating that the fermentation process had reached saturation.
[0106] (5) Response surface design optimization results
[0107] The four factors were glucose concentration, IPTG concentration, inoculum size, and initial pH. The central values were glucose concentration of 10 g / L, IPTG concentration of 0.1 mM, inoculum size of 8%, and initial pH of 8.0. To assess experimental error, four replicates were designed for the central point, resulting in a total of 29 experiments, each replicated three times. The experimental design is detailed in Table 2.
[0108] Table 2: Box-behnken Design factors and levels
[0109] factor unit Level Lowlevel Highlevel Glucose concentration g / L 10 5 20 IPTG mM 0.1 0.05 0.5 Inoculation amount % 8 5 10 Initial pH - 8 7 9
[0110] In order to explore the optimal conditions for the fermentation of inositol by the recombinant strain, the response surface methodology was used for optimization in this study. Based on the center points of the four factors designed in Table 2, a four-level central composite design was designed using the Design Export software, with a total of 29 groups, and each experiment was repeated 3 times. The yield of inositol was taken as the response value, as shown in Table 3. The experimental results in the table were brought into the Design-Expert13 software for multiple regression fitting and variance analysis. The fitting obtained a regression equation: Y = -909.40 + 15.636*A - 160.484*B + 23.575*C + 206.747*D - 1.317*AB + 0.0184*AC + 0.327*AD - 1.559*BC + 13.733*BD + 0.477*CD - 0.676*A 2 +91.532*B 2 -1.881*C 2 -13.468*D 2
[0111] Correlation coefficient R 2 =0.9361, A, B, C, and D represent glucose concentration, final IPTG concentration, inoculum size, and initial pH value, respectively.
[0112] Table 3: Box-Behnken response surface design and results
[0113]
[0114]
[0115] The response surface curves among glucose concentration, IPTG, inoculum size, and initial pH value are shown in Figure 2. Figure 9 As shown in Figure 2, the response surface diagram between the four factors of glucose concentration, IPTG, inoculation amount, and initial pH value opens downward, indicating that there is a maximum inositol production. Figure 9 (B), the contour lines are ellipses, indicating that the interaction trend is obvious, indicating that when the inoculum size is constant, the inositol production increases with the increase of glucose concentration, and then decreases after reaching a certain value. When the glucose concentration is constant, the inositol production first increases and then decreases with the inoculum size. Similarly, the response surface diagram of the interaction between pH and glucose on the fermentation of inositol is attached. Figure 9 (C) The interactive effect trend is obvious. The interactive effect trend between IPTG and glucose (A), inoculum size and IPTG (D), pH and IPTG (E), and pH and inoculum size (F) is not obvious.
[0116] Table 4: Box-Behnken response surface analysis of variance
[0117]
[0118]
[0119] The results of the response surface analysis are shown in Table 4. The model's P value was < 0.0001, and the lack-of-fit term, P = 0.1157, was > 0.05, indicating that the model was significant, while the lack-of-fit term was not significant, indicating that the model was acceptable. The linear terms for glucose concentration and IPTG were significant, while the inoculum size and initial pH were not. The variance of the quadratic terms for glucose concentration, inoculum size, and initial pH was significant, while IPTG was not. However, the interactions among the four factors were significant, indicating that the relationships between the factors were not simple linear. The optimal fermentation conditions for inositol fermentation were determined by response surface design to be: glucose concentration 9 g / L, IPTG 0.1 mM, inoculum size 7%, and initial pH 8.3. The fermentation yield at these conditions was 106.43 mg / L, an increase of 28.46% compared to the 82.85 mg / L predicted by the response surface design experiment.
[0120] The above embodiments are only for illustrating the technical concept and features of the present invention in a specific scenario. Its purpose is to enable people who need this technology to understand the content of the present invention and implement it. It does not limit the scope of protection of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the scope of protection of the present invention.
Claims
1. A recombinant strain, characterized in that The recombinant strain is a recombinant Escherichia coli containing a modified inositol-3-phosphate synthase gene and an inositol-1-monophosphatase gene; the modified inositol-3-phosphate synthase gene is derived from Brettanomyces brusselsii, and the inositol-1-monophosphatase gene is derived from Escherichia coli; the gene sequence of the modified Brettanomyces brusselsii mBbino1 is shown in SEQ ID NO: 1; and the recombinant Escherichia coli is recombinant Escherichia coli BL21 (DE3).
2. The recombinant strain according to claim 1, characterized in that The amino acid sequence of the modified Brettanomyces bruxellensis mBbinol in the recombinant strain is shown in SEQ ID NO:
2.
3. A method for preparing a recombinant strain, characterized in that: The method comprises the following steps: constructing a recombinant plasmid pETDute-1-mBbino1-suhB containing a modified Brussels yeast mBbino1 gene and an Escherichia coli suhB gene, and transferring the recombinant plasmid into Escherichia coli to obtain the recombinant strain; the recombinant Escherichia coli is recombinant Escherichia coli BL21 (DE3).
4. The method for preparing a recombinant strain according to claim 3, wherein: The modified B. brusselsii mBbino1 gene was subcloned into the multiple cloning site downstream of the 6×His tag of the pETDuet-1 plasmid, i.e., the first MCS, through the BamHI and HindIII double restriction sites; The Escherichia coli suhB gene was subcloned into the multiple cloning site upstream of the S-tag tag of the pETDuet-1 plasmid, i.e., the second MCS, through the double restriction sites of NdeI and XhoI; The upstream primer sequence for amplifying the modified Brettanomyces brusselsii mBbino1 gene is shown in SEQ ID NO: 4, and the downstream primer sequence for amplifying the modified Brettanomyces brusselsii mBbino1 gene is shown in SEQ ID NO: 5; The upstream primer sequence for amplifying the E. coli suhB gene is shown in SEQ ID NO: 6, and the downstream primer sequence for amplifying the E. coli suhB gene is shown in SEQ ID NO: 7; 5. Use of the recombinant strain according to any one of claims 1 to 2 or the recombinant strain prepared by the preparation method according to any one of claims 3 to 4 in the preparation of inositol.
6. A method for preparing inositol, characterized in that: The method comprises the steps of: fermenting the recombinant strain according to any one of claims 1 to 2 or the recombinant strain prepared by the preparation method according to any one of claims 3 to 4 to obtain the inositol.
7. The method for preparing inositol as claimed in claim 6, wherein The inositol preparation method specifically comprises the following steps: inoculating the recombinant strain into an LB solid culture medium containing ampicillin, culturing to obtain a bacterial liquid; adding the bacterial liquid into an M9Y culture medium with glucose as the sole carbon source for culturing, adding IPTG, inducing culture, and obtaining the inositol; wherein the M9Y culture medium with glucose as the sole carbon source contains, in addition to glucose, 6g Na2HPO4, 0.5g NaCl, 3g KH2PO4, 1g NH4Cl, 5g yeast extract, 0.5mmol / L MgSO4, and 0.1mmol / L calcium chloride per 1L of culture medium.
8. The method for preparing inositol as claimed in claim 7, wherein The inositol preparation method specifically includes the following steps: inoculating the recombinant strain into LB solid culture medium containing 100 mg / L ampicillin and culturing at 37°C overnight; picking positive clones, inoculating them into LB liquid culture medium containing 100 mg / L ampicillin, and culturing at 37°C and 180 rpm for 5 hours to obtain a bacterial solution; setting the glucose concentration to 5 g / L-40 g / L and the pH value to 5.0-9.0, inoculating the seed solution at an inoculum amount of 1%-10% (V / V) into a 250 mL shake flask containing 50 mL fermentation medium, and culturing at 37°C and 180 rpm until the fermentation liquid OD reaches 0. 600 When the pH value is between 0.4 and 0.6, IPTG with a final concentration of 0.05-1.5 mM is added for induction, and the culture is continued at 24° C. and 180 rpm for 48 h, followed by centrifugation to obtain the inositol.
9. The method for preparing inositol as claimed in claim 8, wherein The glucose concentration is 9 g / L; the IPTG concentration is 0.1 mM; the seed solution inoculation amount is 7%; and the initial pH value is 8.
3.
10. Use of the method for preparing inositol according to any one of claims 6 to 9 in the prepared inositol.