Alginate lyase VxAly7B-CM mutant obtained through directed evolution of T7 biosensor as well as directed evolution method and application of alginate lyase VxAly7B-CM mutant

Abstract

The invention discloses an alginate lyase VxAly7B-CM mutant obtained through directed evolution of a T7 biosensor as well as a directed evolution method and application of the alginate lyase VxAly7B-CM mutant. The nucleotide sequence of a mutant 1 of the alginate lyase VxAly7B-CM provided by the invention is as shown in SEQ ID No.3, the amino acid sequence of the mutant 1 is as shown in SEQ ID No.4, the nucleotide sequence of a mutant 2 is as shown in SEQ ID No.5, and the amino acid sequence of the mutant 2 is as shown in SEQ ID No.6. The high specific activity and high stability of the mutant provided by the invention exceed those of most reported alginate lyase. The algin lyase VxAly7B-CM mutants 1 and 2 keep a catalytic mode and degradation products consistent with those of a wild type VxAly7B-CM, the degradation mode is an incision type, and the degradation final products are mainly unsaturated disaccharide, trisaccharide, tetrasaccharide and pentasaccharide. The invention also constructs a recombinant vector and a recombinant strain containing the mutant, and the recombinant vector and the recombinant strain can be used for degrading seaweed or algin to prepare AOS in industrial production.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and in particular relates to an alginate lyase VxAly7B-CM mutant obtained by directed evolution using a T7 biosensor, and a directed evolution method and application. Background Art

[0002] Alginate is a natural polysaccharide primarily derived from the cell walls of brown algae, comprising up to 40% of the dry weight of brown algae cells. Alginate is a linear anionic polysaccharide composed of β-D-mannuronic acid (M) and its C-5 diastereomer, α-L-guluronic acid (G), linked by a 1→4 glycosidic bond. Alginic oligosaccharides (AOS) are small saccharides with a degree of polymerization (DP) of 2–25, derived from the degradation of alginate. Numerous studies have demonstrated that AOS exhibit diverse biological activities, including anti-obesity, hypoglycemic, anti-inflammatory, antioxidant, anti-tumor, and gut microbiome regulation. Consequently, they hold broad application prospects in the food, pharmaceutical, agricultural, and environmental fields.

[0003] Due to its mild reaction conditions, strong substrate specificity, and high catalytic efficiency, enzymatic degradation has been widely used in the preparation of AOS. During this process, alginate lyases cleave the 1→4 glycosidic bonds of alginate via a β-elimination mechanism, forming a double bond between C4 and C5 at the non-reducing end, thereby generating unsaturated alginate oligosaccharides. Based on their mode of action, alginate lyases are classified as endo- and exo-types. Endo-type alginate lyases have an open catalytic cavity at both ends, randomly cleaving glycosidic bonds in the substrate. The final degradation product typically has a degree of polymerization between 2 and 6. Exo-type alginate lyases, on the other hand, cleave from the non-reducing end, primarily producing unsaturated alginate monosaccharides and smaller amounts of disaccharides and trisaccharides.

[0004] However, most natural alginate lyases originate from low-temperature marine environments and typically exhibit poor cold adaptability and thermal stability, making them difficult to meet the requirements of industrial high-temperature production. Therefore, improving the thermal stability and catalytic activity of alginate lyases has become a key issue in promoting the industrial production of AOS. Summary of the Invention

[0005] To address the insufficient thermal stability of existing alginate lyases, the present invention provides a VxAly7B-CM mutant of alginate lyase, obtained using T7 biosensor directed evolution, as well as methods and applications for such evolution. The provided alginate lyase mutant is thermostable. The protein stability biosensor constructed in the present invention, based on the T7 expression system, utilizes antibiotic resistance and fluorescence signals as screening phenotypes, enabling high-throughput screening of protein stability. The T7 biosensor offers advantages such as rapid enrichment of positive results, high sensitivity, and accurate results, providing a new tool for directed evolution of protein stability.

[0006] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions: The present invention provides an alginate lyase VxAly7B-CM mutant 1. The amino acid sequence of the alginate lyase VxAly7B-CM mutant 1 is shown in SEQ ID No. 4. The alginate lyase VxAly7B-CM mutant 1 is obtained by mutating the amino acid at position 188 from E to N, the amino acid at position 202 from S to A, and the amino acid at position 204 from S to G in the alginate lyase VxAly7B-CM with the amino acid sequence of SEQ ID No. 2.

[0007] The present invention provides an alginate lyase VxAly7B-CM mutant 2. The amino acid sequence of the alginate lyase VxAly7B-CM mutant 2 is shown in SEQ ID No. 6, wherein the amino acid at position 188 in the alginate lyase VxAly7B-CM with the amino acid sequence of SEQ ID No. 2 is mutated from E to N, the amino acid at position 204 is mutated from S to G, and the amino acid at position 413 is mutated from G to S.

[0008] The present invention also provides a gene encoding the alginate lyase VxAly7B-CM mutant 1. The nucleotide sequence of the gene encoding the mutant 1 is shown in SEQ ID No. 3.

[0009] The present invention also provides a gene encoding the alginate lyase VxAly7B-CM mutant 2. The nucleotide sequence of the gene encoding the mutant 2 is shown in SEQ ID No. 5.

[0010] The present invention also provides a recombinant expression vector comprising the gene encoding the alginate lyase VxAly7B-CM mutant 1 or the gene encoding the alginate lyase VxAly7B-CM mutant 2.

[0011] Furthermore, the recombinant expression vector is a pET-24a(+) vector.

[0012] The present invention also provides a recombinant strain comprising the gene encoding the alginate lyase VxAly7B-CM mutant 1 or the gene encoding the alginate lyase VxAly7B-CM mutant 2.

[0013] Furthermore, the recombinant strain is Escherichia coli BL21 (DE3).

[0014] The present invention provides a directed evolution method using a T7 biosensor, wherein the steps of the directed evolution method are as follows: (1) Rationally design mutation sites for target proteins that require directed evolution; (2) Construction of T7 biosensor: T7 biosensor expresses the target protein by fusion with T7 RNA polymerase, so that the stability of the target protein is linked to the transcriptional activity of T7 RNA polymerase, and uses antibiotic resistance and fluorescence signal as screening phenotypes; (3) The constructed T7 biosensor was used to conduct directed evolution screening of rationally designed mutation sites. The sensor can effectively distinguish protein variants with different thermodynamic stabilities. Cell antibiotic resistance and fluorescence intensity are significantly positively correlated with protein thermodynamic stability, thereby screening for protein stability variants.

[0015] Furthermore, the specific construction steps of the T7 biosensor in step (2) are as follows: using the pACYC-tet plasmid as an expression vector, inserting the target protein to be directed-evolved into the T7 RNA polymerase N601 site through a GC-rich flexible linker for fusion expression; and using the CRISPR / Cas9 gene editing system to insert the apramycin resistance gene controlled by the T7 promoter into the T7 RNA polymerase N601 site. aac and green fluorescent protein gene sfgfp Expression cassette knocked into E. coli BW25113 genome, obtain reporter system chassis strain E. coli BW-AG.

[0016] The present invention also provides a fusion expression vector of the target protein and T7 RNA polymerase in the T7 biosensor.

[0017] Furthermore, the fusion expression vector is a pACYC-tet vector.

[0018] The present invention also provides the chassis strain of the T7 biosensor.

[0019] Furthermore, the chassis strain is E. coli BW-AG.

[0020] Furthermore, the alginate lyase VxAly7B-CM mutant 1 (E188N / S202A / S204G) T m The value was 52.7 ℃, the optimum reaction temperature was 50 ℃, and the specific activity was 4060.76 U / mg.

[0021] Furthermore, the alginate lyase VxAly7B-CM mutant E188N / S202A / S204G has a heat inactivation half-life of 56.8 h at 50°C.

[0022] Furthermore, the degradation mode of the alginate lyase VxAly7B-CM mutant 1 (E188N / S202A / S204G) is endo-type, and the final degradation products are unsaturated alginate disaccharides, trisaccharides, tetrasaccharides and pentasaccharides.

[0023] Furthermore, the alginate lyase VxAly7B-CM mutant 2 (E188N / S204G / G413S) T m The optimum reaction temperature was 50 ℃, and the enzyme activity was 4215.17 U / mg.

[0024] Furthermore, the alginate lyase VxAly7B-CM mutant E188N / S204G / G413S has a heat inactivation half-life of 59.3 h at 50°C.

[0025] Furthermore, the degradation mode of the alginate lyase VxAly7B-CM mutant 2 (E188N / S204G / G413S) is endo-type, and the final degradation products are unsaturated alginate disaccharides, trisaccharides, tetrasaccharides and pentasaccharides.

[0026] Compared with the prior art, the advantages and technical effects of the present invention are as follows: the mutation sites of the alginate lyase VxAly7B-CM mutant 1 of the present invention are E188N / S202A / S204G, the mutation sites of the alginate lyase VxAly7B-CM mutant 2 are E188N / S204G / G413S, and the mutation sites of the mutants 1 and 2 are T m The values ​​increased to 52.7 °C and 52.5 °C respectively; at 50 °C, the enzyme activities were as high as 4060.76 U / mg and 4215.17 U / mg respectively. t 1 / 2The degradation time of mutants 1 and 2 was extended to 56.8 and 59.3 h, respectively, while maintaining the same catalytic mode and degradation products as wild-type VxAly7B-CM. The final degradation products were unsaturated alginate disaccharides, trisaccharides, tetrasaccharides, and pentasaccharides. The high catalytic activity and high stability of mutants 1 and 2 surpassed those of most reported alginate lyases and could be used in industrial production to degrade seaweed or alginate to produce AOS.

[0027] The present invention also constructs a protein stability biosensor based on the T7 expression system, which expresses the target protein by fusion with T7 RNA polymerase, so that the stability of the target protein is linked to the transcriptional activity of T7 RNA polymerase. The sandwich fusion design enables the T7 biosensor to effectively reduce the false positive rate that may be caused by head-to-tail fusion biosensors. In addition, the T7 biosensor can combine two reporter signals, antibiotic resistance and fluorescence intensity, for screening. Antibiotic resistance screening can effectively exclude unstable mutants, thereby quickly enriching positive results, and the results are intuitive and easy to operate; fluorescence signal detection provides more accurate stability information, and its high sensitivity can reflect subtle changes in protein stability. It can be automatically detected by fluorescence spectrometer or flow cytometer, thereby improving the throughput and efficiency of the experiment. The T7 biosensor has significant advantages such as fast enrichment of positive results, high sensitivity, and accurate results, providing new research ideas and screening tools for protein stability modification. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 indicates the purification of VxAly7B-CM and its mutants; Figure 2 represents the optimal reaction temperature of VxAly7B-CM and its mutants; Figure 3 The thermal stability of VxAly7B-CM and its mutants is shown (a: thermal stability of VxAly7B-CM and its mutants at 45°C; b: thermal stability of VxAly7B-CM and its mutants at 50°C); Figure 4 indicates the purification of mutant E188N / S204G; Figure 5 The optimal reaction temperature and thermal stability of VxAly7B-CM and its mutant E188N / S204G are shown (a: optimal reaction temperature of VxAly7B-CM and mutant E188N / S204G; b: thermal stability of VxAly7B-CM and mutant E188N / S204G at 45°C; c: thermal stability of VxAly7B-CM and mutant E188N / S204G at 50°C); Figure 6 It shows the principle of T7 biosensor sensing target protein stability; Figure 7 express E. coli Construction of the BW-A strain; Figure 8 express E. coli Construction of the BW-AG strain; Figure 9 represents the pACYC-tet- T7 RNAP-POI plasmid map; Figure 10 represents the cell fluorescence intensity when MBP is inserted into different sites of T7 RNA polymerase; Figure 11 It indicates that cellular antibiotic resistance is associated with protein stability; Figure 12 It indicates that the cell fluorescence intensity is correlated with protein stability; Figure 13 indicates flow cytometry screening; Figure 14 Represents the purification of VxAly7B-CM* and its mutants (M: Maker; lanes 1-17: WT*, L178S*, Y181K*, S202A*, T222A*, F262S*, N267K*, H297T*, E324S*, S367P*, V370I*, T377S*, E397L*, G413S*, M417F*, K234N / R245T / S250T*, L349M / S356P / R392H*); Figure 15 It indicates the thermal stability of VxAly7B-CM* and its mutants at 50°C; Figure 16 Figure 5. TLC analysis of degradation products (M: Marker, containing unsaturated disaccharides and trisaccharides; bands 1-7 correspond to degradation products collected at 0, 1, 5, 15, 30, 60, and 120 min, respectively). DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further explained in detail below with reference to the accompanying drawings and specific embodiments.

[0030] Example 1: Rational design of alginate lyase VxAly7B-CM

[0031] 1. Rational design of mutants The amino acid sequence of the alginate lyase VxAly7B-CM provided by the present invention is shown in SEQ ID No. 2, and the nucleotide sequence of the encoding gene is shown in SEQ ID No. 1. The amino acid sequence and simulated three-dimensional structure of the alginate lyase VxAly7B-CM were submitted to the EVcoupling and FireProt online websites. The predicted values ​​(ΔΔG) were obtained using the FoldX tool in EVcoupling (Mutation epistatic effects > 0) and FireProt. fold < -0.5 kcal / mol) was used as the screening criterion, and a total of 10 candidate mutants were obtained, namely E188D, E188N, S194M, S204G, Q214S, S296L, K368D, V370I, H375K and A384G, respectively. The 188th amino acid mutated from E to D, the 188th amino acid mutated from E to N, the 194th amino acid mutated from S to M, the 204th amino acid mutated from S to G, the 214th amino acid mutated from Q to S, the 296th amino acid mutated from S to L, the 368th amino acid mutated from K to D, the 370th amino acid mutated from V to I, the 375th amino acid mutated from H to K, and the 384th amino acid mutated from A to G. Mutation epistatic effects and ΔΔG of these mutants were observed. fold The values ​​are shown in Table 1.

[0032] Table 1 Mutation epistatic effects and ΔΔG of mutants fold value

[0033] 2. Construction of mutants and induced expression (1) Construction of mutant recombinant expression plasmid PCR amplification was performed using the KOD One™ PCR Master Mix Kit, the recombinant pET24a-VxAly7B-CM vector provided by the present invention, and the primers listed in Table 2. The PCR reaction was performed under the following conditions: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s; annealing at 50-60°C for 10 s; and extension at 68°C for 10 s / kb for 30 cycles, followed by extension at 68°C for 4 min. The PCR product was purified using a gel extraction kit (Omega) and transformed into E. coli In JM109 competent cells, positive clones were picked for DNA sequencing. A plasmid extraction kit (Tiangen Biochemical Technology) was used to extract the mutant expression plasmid that was sequenced correctly, and the mutant expression plasmid was transformed into the expression strain. E. coli BL21(DE3).

[0034] Table 2 PCR amplification primers for mutants

[0035] (2) Induced expression and purification of mutants The mutant expression plasmid E. coli BL21 (DE3) was streaked and a single colony was picked and placed in 5 mL of LB medium containing 30 μg / mL kanamycin sulfate. The culture was incubated at 37°C and 160 rpm for 12 h. The bacterial suspension was transferred to concentrated LB liquid medium with the same antibiotic at a ratio of 1:100 and incubated at 37°C and 160 rpm until the OD 600 The pH value was 0.4–0.6. Then, 100 μM isopropyl 1-thio-β-D-galactopyranoside (IPTG) was added and expression was induced at 18°C ​​and 160 rpm for 24 h. After fermentation, the cells were harvested by centrifugation at 4°C and 8,000 rpm for 15 min. The cells were resuspended in 20 mM PB buffer (pH 7.6) at 1 / 10 the volume of the fermentation broth and disrupted using a low-temperature, high-pressure homogenizer. The supernatant, the crude enzyme solution, was collected by centrifugation at 4°C and 8,000 rpm for 15 min. The crude enzyme solution was filtered through a 0.22 μm filter to remove impurities.

[0036] (His)6-tagged VxAly7B-CM and its mutants were purified using a HisTrap HP column. The protein was stored in 20 mM PB buffer (500 mM NaCl) at pH 7.6. The column was washed with a buffer containing 25 mM imidazole to remove unbound proteins. The imidazole concentration was then increased to 100 mM to elute the target protein. Finally, the protein was dialyzed against the storage buffer using a 3 kDa dialysis tubing overnight on ice to remove the imidazole.

[0037] Take 30 μL of protein sample and add 4x protein loading, boil for 10 min. Then perform SDS-PAGE electrophoresis. After staining with protein staining solution for 1 h, repeatedly decolorize with destaining solution until the background is clear, check the purity and molecular weight of the protein sample, and analyze the protein expression. Use BCA protein quantification kit (Biyuntian) to determine the protein concentration. Figure 1 As shown in the figure, each sample after purification had a single electrophoretic band, proving that the protein was successfully purified. The molecular weight of the protein was approximately 33 kDa, which was consistent with the predicted molecular weight.

[0038] 3. Characterization of the enzymatic properties of the mutants (1) Determination of mutant specific activity Enzyme activity was determined using the A235 assay to determine the presence of unsaturated double bonds in the reaction system. From a 1 mL reaction system, 100 μL of the appropriately diluted enzyme solution was added to 900 μL of preheated substrate solution (20 mM PB, 500 mM NaCl, pH 7.6) containing 0.3% (w / v) alginate. The reaction was incubated at 45°C for 10 min, and the absorbance change at 235 nm was recorded. One unit (U) of enzyme activity was defined as the amount of enzyme required to increase the absorbance at 235 nm by 0.1 per minute. As shown in Table 3, among all mutants, E188N exhibited the highest specific activity, reaching 3701.02 U / mg, approximately 1.26-fold that of the WT. The relative activities of E188D and S204G were 103% and 95% of the WT, respectively.

[0039] Table 3 VxAly7B-CM and its mutants T m Value and specific activity

[0040] (2) Mutants T m Value determination The protein melting temperature (MT) was determined by using a micro-differential scanning fluorimeter based on the changes in the autofluorescence of tryptophan and tyrosine during the unfolding process of the protein. T m Before the assay, the protein sample was diluted with buffer to a concentration of 1 mg mL -1 The solution was centrifuged at 4 °C and 12,000 r / min for 10 min to remove impurities. The scanning temperature was heated from 25 °C to 90 °C at a heating rate of 1 °C min -1 As shown in Table 3, compared with WT, E188D, E188N, S204G, S296L, K368D and V370I T m The values ​​of mutant S204G were all improved. T m The highest is 50.2°C (Δ T m = 3.2°C), E188N T m It is 48.9°C, second only to S204G.

[0041] (3) Determination of the optimal reaction temperature of mutants The enzyme activity of VxAly7B-CM and its mutants was measured at different temperatures using the aforementioned enzyme activity assay. Taking the highest enzyme activity as 100%, the relative enzyme activity at different reaction temperatures was calculated to determine the optimal reaction temperature for VxAly7B-CM and its mutants.

[0042] like Figure 2 As shown in the figure, WT maintains high enzyme activity at 35°C-45°C, with the optimal reaction temperature being 45°C. However, its activity decreases rapidly when the temperature is above 45°C. Notably, both E188N and S204G can maintain approximately 87% of their maximum enzyme activity at 50°C, demonstrating good high temperature tolerance.

[0043] (4) Determination of temperature stability of mutants An appropriate amount of pure enzyme was diluted with buffer to an appropriate multiple, incubated at a constant temperature, and enzyme activity was measured at different time points. The relative enzyme activity after incubation for different time periods was calculated, with the untreated enzyme activity as 100%. The thermal stability of VxAly7B-CM and its mutants at 45°C ( Figure 3 a). Compared to the WT, mutants E188D, E188N, S204G, S296L, K368D, and V370I showed improved thermostability. Mutant S204G was the most stable, retaining 78.6% and 57.1% of its activity after 24 and 36 hours of incubation, respectively. E188N and S296L were slightly less stable than S204G, but still retained approximately 57% of their initial enzyme activity after 36 hours of incubation.

[0044] Next, the mutants E188D, E188N, S204G, S296L, K368D, and V370I were tested for their thermal stability at 50 °C ( Figure 3 b). S204G exhibited excellent thermal stability, maintaining 60% of its activity after 6 h, significantly superior to WT and other mutants.

[0045] 4. Characterization of Enzymatic Properties of the Combined Mutant E188N / S204G According to the above experimental results, among the 10 candidate mutants, E188N and S204G performed best. Therefore, the present invention constructed a combined mutant E188N / S204G to further optimize the catalytic performance of VxAly7B-CM. E. coli The protein was successfully expressed in BL21 (DE3) and purified by nickel ion affinity chromatography to obtain electrophoresis-pure protein ( Figure 4 ).

[0046] The mutant E188N / S204G was determined to have Tm The value is 52.0°C (Δ T m =5°C), the highest among all mutants, indicating its superior structural stability. Figure 5 As shown in a, the optimal reaction temperature of the E188N / S204G mutant is 50°C, at which the specific activity is as high as 3823.80 U / mg, which is 33% higher than the highest specific activity of WT (2935.76 U / mg).

[0047] Incubate at 45°C ( Figure 5 b) Both WT and E188N / S204G maintained high activity in the initial stage (0–4 h); the enzyme activity of WT then decreased rapidly, falling to 67% of the initial activity after 12 h, while E188N / S204G maintained high activity for a long time, still retaining 64% of the initial activity after 36 h. Figure 5 c) E188N / S204G has a more significant stability advantage: the half-life of E188N / S204G (t 1 / 2 ) reached 38.4 h, which is approximately the wild type (t 1 / 2 These results fully demonstrate the application potential of E188N / S204G in high-temperature degradation of alginate.

[0048] Example 2: Construction of a protein stability biosensor based on the T7 expression system 1. Construction principle and method of T7 biosensor like Figure 6 As shown, the core design of the T7 biosensor provided by the present invention involves inserting a protein of interest (POI) into T7 RNA polymerase (sandwich design), achieving fusion expression of the two. This fusion establishes a direct link between the folding stability of the POI and the transcriptional activity of T7 RNAP. Specifically, when the POI remains stable, the N- and C-termini of T7 RNAP are able to reconstitute and maintain an active conformation, thereby efficiently recognizing the T7 promoter and driving the transcription of downstream antibiotic resistance genes and green fluorescent protein genes. Cells will emit a strong fluorescent signal and are able to grow on plates with high antibiotic concentrations. Conversely, if the folding of the protein of interest is unstable, T7 RNA polymerase will have difficulty reconstructing and maintaining an active conformation, and its transcriptional activity will be inhibited. In this case, the fluorescent signal within the cell will be significantly weakened, and the cell will appear antibiotic-sensitive.

[0049] 2. Construction of T7 biosensor chassis strain Selection E. coliBW25113 (purchased from Hangzhou Baosai Biotechnology Co., Ltd.) was used as the starting strain. This strain naturally lacks the T7 RNA polymerase encoding gene (T7 RNAP) and has the characteristics of a clear genetic background and convenient gene editing.

[0050] (1) Knock-in of apramycin resistance acc Apramycin resistance was selected as a resistance screening marker. In order to prevent the cells from producing enough resistance protein to resist high concentrations of apramycin when the target protein is less stable, the present invention knocked in aac The expression frame has been optimized.

[0051] First, the T7#1 weak promoter was used to control aac The promoter significantly reduces the transcription initiation efficiency by modifying the -10 region sequence, thereby reducing the expression of resistance proteins at the source and reducing the probability of false positive results.

[0052] Secondly, in aac An LVA degradation tag (amino acid sequence: AANDENYALVA) is introduced at the 5' end of the open reading frame to form a fusion expression construct. The LVA tag, acting as an unstable N-terminal signal, marks the resistance protein, prompting its rapid recognition and degradation by the ubiquitin-proteasome system, thereby shortening its intracellular half-life. The introduction of this tag further balances the dynamics of resistance protein synthesis and degradation, reducing background and false-positive rates, and improving the stability and reliability of the entire expression system.

[0053] like Figure 7 As shown, plasmid pSET156 was used as a template and primer pair t7#1-acc-F / acc_LVA-R was used to amplify the aac fragment. E. coli The BW25113 genome was used as a template and the primer pairs ldhA_UF / ldhA_UR and ldhA_DF / ldhA_DR were used to amplify ldhA Upstream and downstream homology arms. aac and ldhA The upstream and downstream homology arms are assembled in order, and the ligation products are recovered and purified as donor DNA fragments. E. coli BW25113 genome ldhA Sequencing verification of the successful knock-in of the acc_LVA gene expression cassette driven by the T7#1 promoter E. coli BW-A.

[0054] (2) Knock-in of the green fluorescent protein gene sfgfp In the above-mentioned strain E. coli Based on BW-A, continue typing sfgfp gene, and constructed strain E. coli BW-AG. The construction method is shown in Figure 8 Using pET28a(+)-sfGFP as a template, the primer pair T7-sfgfp-F / sfgfp-T7ter-R was used to amplify the expression frame of sfGFP controlled by T7 promoter as the knock-in target fragment. E. coli The BW-A genome was used as a template, and the primer pairs lacZ_UF / lacZ_UR and lacZ_DF / lacZ_DR were used to amplify the upstream and downstream homology arms of lacZ, respectively. The target fragment and the upstream and downstream homology arms of lacZ were assembled in an orderly manner using fusion PCR technology to obtain the Donor DNA fragment. The Donor DNA fragment was knocked into the E. coli BW-A genome lacZ Finally, the successful typing acc_ lva and sfgfp expression cassette strains E. coli BW-AG, a chassis strain used as the T7 biosensor.

[0055] 3. Construction of T7 RNA polymerase and target protein fusion expression plasmid like Figure 9 As shown, the pACYC-tet plasmid (chloramphenicol-resistant) is a suitable expression vector for T7 RNAP-POI fusion proteins. This plasmid contains the p15A replicon and has a low- to medium-copy number, which facilitates stable plasmid maintenance in cells and reduces the metabolic burden on host cells caused by excessive plasmid content. Furthermore, the pACYC-tet plasmid features a tetracycline (Tet)-inducible expression system. This rigorous regulatory mechanism allows precise control of target protein expression levels based on experimental requirements, improving protein expression stability and reproducibility. The target protein gene is ligated to the specific site of the T7 RNA polymerase via a glycine-serine-rich linker (GGGGSGGGGS).

[0056] (1) Construction of pACYC-tet-T7 RNAP plasmid First, the plasmid pACYC-tet-T7 RNAP was constructed to express only T7 RNA polymerase. E. coli The BL21 (DE3) genome was used as a template and the primer pair T7 RNAP (pACYC)-F / T7 RNAP (pACYC)-R was used to amplify the t7 rnapUsing the pACYC-tet plasmid as a template, the linearized vector backbone pACYC-tet was amplified using the primer pair pACYC(T7 RNAP)-F / pACYC(T7 RNAP)-R. The amplified product was Dpn After enzyme I digestion of the methylated template, gel recovery and purification were performed.

[0057] Assembled by Gibson t7 rnap The gene fragments were connected to the pACYC-tet vector backbone, and the assembled product was transferred into E. coli JM109 competent cells were used. Positive colonies were screened in LB medium containing 35 μg / mL chloramphenicol, and successful ligation was verified by colony PCR. Positive single clones were selected to extract plasmids and sequenced, ultimately obtaining the recombinant plasmid pACYC-tet-T7 RNAP, which was then transformed into the chassis strain by electroporation. E. coli BW-AG.

[0058] (2) Construction of pACYC-tet-T7 RNAP-POI plasmid In order to test the tolerance of different permissive cleavage sites of T7 RNA polymerase (N67-A68, K179-K180, K363-P364, P563-S564 and N601-T602) to insertions, MBP was selected as the target protein for intracellular experiments. By PCR amplification, the linear vector fragments split from the T7 RNA polymerase N67-A68, K179-K180, K363-P364, P563-S564, and N601-T602 were amplified using the primer pairs T7 RNAP(A68)-F / T7 RNAP(N67)-R, T7 RNAP(K180)-F / T7 RNAP(K179)-R, T7 RNAP(P364)-F / T7 RNAP(K363)-R, T7 RNAP(S564)-F / T7 RNAP(P563)-R, and T7 RNAP(T602)-F / T7 RNAP(N601)-R, respectively. The linear vector fragments split from the T7 RNA polymerase N67-A68, K179-K180, K363-P364, P563-S564, and N601-T602 were amplified using the primer pair MBP_linker-F / MBP_linker-R. E. coli The MBP encoding gene was amplified from the BL21(DE3) genome ( malE ).

[0059] Then, malE Gibson recombination was performed with the pACYC-tet-T7 RNAP vector backbone split at different sites. After chloramphenicol screening, colony PCR verification of the connection and sequencing, the fusion expression plasmids with MBP connected to different sites of T7 RNA polymerase were obtained and transformed into the chassis strain by electroporation. E. coli The corresponding expression strain was obtained in BW-AG.

[0060] Next, the fluorescence expression of cells expressing only complete T7 RNA polymerase and cells expressing MBP by inserting it into different sites of T7 RNA polymerase for fusion expression was detected. The strain was streaked on a solid LB plate containing 35 μg / mL chloramphenicol and cultured at 37°C for 12 h. A single colony was picked and transferred to 5 mL of LB medium containing 35 μg / mL chloramphenicol, and cultured at 37°C and 220 rpm until the logarithmic growth phase. 1 mL of bacterial solution was transferred to 100 mL of 1×M9 medium and cultured at 37°C and 220 rpm. When OD 600 When the OD value is 0.4-0.6, add IPTG with a final concentration of 10 μM and 10 ng / mL ATc, and induce expression at 30°C for 2 hours. Dilute the bacterial solution to an appropriate concentration and measure the OD value. 600 The green fluorescence intensity (Fluorescence) of the bacterial solution was measured using a multifunctional microplate reader with the following parameters set: excitation wavelength 488 nm, emission wavelength 510 nm, and calculation of Fluorescence / OD. 600 .

[0061] like Figure 10 As shown, using the fluorescence intensity of cells expressing only T7 RNA polymerase as the standard (set as 100%), the relative fluorescence intensity of the cells decreased to varying degrees when MBP was inserted into different cleavage sites of T7 RNA polymerase, indicating that the insertion of the exogenous protein negatively affected the activity of T7 RNA polymerase. Notably, when MBP was inserted into the N601 site, the fusion protein exhibited relatively high polymerase activity, with a relative fluorescence intensity of 68.3%. In contrast, when MBP was inserted into other sites, the fluorescence intensity dropped below 42.3%, indicating that these regions were more sensitive to insertion. Based on these results, the N601 site was selected as the site for exogenous protein insertion in subsequent experiments.

[0062] 4. Verify the feasibility of T7 biosensor (1) Selection of verification proteins and strain construction To verify whether the T7 biosensor can be used to screen protein stability, we first evaluated its ability to distinguish protein variants with different thermodynamic stability. Three proteins with significant differences in origin, size, and structural characteristics, namely Im7, G-CSF, and MBP, were selected as test proteins. For each protein, the wild type and five mutants were selected for testing. The ΔΔG fold It has been reported in the literature.

[0063] Since wild-type G-CSF has a high tendency to aggregate, G-CSF containing the C17S mutation was used as G-CSF-WT in this study. The pTrc-cysGA-Im7 plasmid and pUC57-G-CSF plasmid were used as templates, and the primer pair Im7_linker-F / Im7_linker-R was used to amplify the G-CSF. im7 Fragment, primer pair G-CSF_linker-F / G-CSF_linker-R amplification g-csf Then im7 and g-csf The fragment was seamlessly cloned with the pACYC-tet-T7 RNAP vector backbone to obtain the plasmid pACYC-tet-T7 RNAP-Im7 / G-CSF, and then transformed into the chassis strain by electroporation. E. coli BW -AG medium.

[0064] Using the pACYC-tet-T7 RNAP-Im7 / G-CSF / MBP plasmid as a template, site-directed mutagenesis was performed to construct Im7, G-CSF, and MBP mutants fused with T7 RNAP. The primers used are shown in Table 4. The correct plasmids verified by sequencing were transformed into E. coli BW-AG was used for subsequent experiments.

[0065] Table 4 Primers for amplification of Im7, G-CSF and MBP mutants , .

[0066] (2) Determination of the relationship between protein stability and cell resistance The minimum inhibitory concentration (MIC) of Im7, MBP and G-CSF was determined by microdilution method. mutant / MIC WT ) and ΔΔG fold The relationship between them.

[0067] ① Take out from -80℃ E. coli Streak the BW-AG / pACYC-tet-T7 RNAP-POI strain onto a solid LB plate containing 35 μg / mL chloramphenicol and incubate at 37°C for 12 h. Pick a single colony and transfer it to 5 mL of LB medium containing 35 μg / mL chloramphenicol and incubate at 37°C and 220 rpm until the logarithmic growth phase.

[0068] ② Take the above bacterial solution and adjust the OD value of the bacterial solution with sterile PBS solution. 600 =1.0. Then dilute the bacterial solution tenfold to 10 of the original -1 , 10-2 , 10-3 and 10 -4 1 µL of each bacterial dilution was dripped onto LB solid medium containing varying concentrations of apramycin (increasing from 25 µg / mL). The medium also contained 10 µM IPTG, 10 ng / mL ATc, and 35 µg / mL chloramphenicol. The culture was incubated at 30°C for 24 hours to induce expression of the T7 RNAP-POI fusion protein.

[0069] ③ Record the growth of bacteria at different dilution times in different concentrations of apramycin plates to calculate the minimum inhibitory concentration (MIC). -3 If the strain can grow on 50 μg / mL apramycin plates but not on 75 μg / mL apramycin plates, then the MIC (10 -3 ) is recorded as (50+10) μg / mL, that is, 60 μg / mL.

[0070] ④Analyze the relationship between mutant stability and cell resistance: Calculate 10 −2 , 10 −3 and 10 -4 MIC at dilution concentration mutant / MIC WT Ratio, and the average ratio of three dilutions. mutant / MIC WT ) and ΔΔG fold Fitting calculations were performed, and the error bars represent ln(MIC mutant / MIC WT ) is the standard deviation of the .

[0071] like Figure 11 As shown, for Im7, the MIC values ​​of cells expressing the known stable mutants N26K / T30N / S58R and T30N were significantly increased compared with the wild-type protein, showing higher antibiotic resistance.

[0072] Despite the presence of disulfide bonds in G-CSF and the large molecular weight of MBP protein, ln(MIC mutant / MIC WT ) and ΔΔG fold There was a significant linear correlation between the two groups, with R² of 0.84 and 0.76, respectively. Across all three protein classes, it was observed that as the thermodynamic stability of the protein increased, the cells exhibited a wider spectrum of antibiotic resistance. This result demonstrates the universality of the T7 biosensor in screening stable mutants for cellular resistance.

[0073] (3) Determination of the relationship between protein stability and cell fluorescence intensity Determination of Fluorescence / OD600 and ΔΔG of Im7, MBP and G-CSF fold The relationship between Figure 12 As shown in Figure 3 , the cellular relative fluorescence intensity and thermodynamic stability of these three protein types all showed a good linear correlation, with correlation coefficients R² of 0.89, 0.82, and 0.80, respectively. Compared with cellular antibiotic resistance, cellular fluorescence intensity can more sensitively reflect the relative stability of proteins.

[0074] Validated using model proteins (Im7, MBP, and G-CSF), the sensor effectively distinguished protein variants with varying thermodynamic stability. Cellular antibiotic resistance and fluorescence intensity were significantly positively correlated with protein thermodynamic stability. The T7 biosensor offers significant advantages, including rapid enrichment of positive results, high sensitivity, and accurate results, providing a new tool for directed evolution of protein stability.

[0075] The primer sequences used in Example 2 are as follows (5'-3'): ldhA_UF: TATTGATCCAGGTGTTAGGC; ldhA_UR:GGAATTGTTATCCGCTCACAATTCCCCTAAGGTGAGTCGTATTAAAGACTTTCTCCAGTGATGT; t7#1-acc-F: TGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGTCATCAGCGGTGGAGTG; acc_LVA-R: CCTTTCGGGCTTGTTAGCAGCCGGATCTCAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCTGCGCCAGATGAGCCAATCGACTGGCGAGCGG; ldhA_DF: GCTAACAAAGCCCGAAAGGAAGCTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTGTCTTGCCGCTCCCCTGCATTC; ldhA_DR:CAAACGCTGTAGCGAACAGTC; lacZ_UF: CATCAGCGCGTCAGTGCCGTG; lacZ_UR:GCATCACCGGCGATGATAAGCTGTCAAACATGAGAATTCC; T7-sfgfp-F:CTTATCATCGCCGGTGATGCCGGCCACGAT; sfgfp-T7ter-R:CAGCAAAAAACCCCTCAAGAC; lacZ_DF:GTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATT; lacZ_DR:GTAAAACGGCGAGGATGAGTGCAC; T7 RNAP(pACYC)-F:GAGGAGAAATCTAGAATGAACACGATTAACATCGCTAAG; T7 RNAP(pACYC)-R:TGGCAGCAGCCTAGGTTAATTACGCGAACGCGAAGTCCG; pACYC(T7 RNAP)-F:TTAACCTAGGCTGCTGCCACCGC; pACYC(T7 RNAP)-R:CATTCTAGATTTCTCCTCTTTCTCTAGTATTTCTC; MBP_linker-F:GGCGGTGGTGGTAGCGGAGGTGGGGGCTCAAAAATCGAAGAAGGTAAACTGG; MBP_linker-R:AGAGCCACCACCACCAGAACCGCCACCGCCCTTGGTGATACGAGTCTGCG; T7 RNAP(A68)-F:TCTGGTGGTGGTGGCTCTGCTGCCGCCAAGCCTCTCAT; T7 RNAP(N67)-R:TCCGCTACCACCACCGCCGTTATCCGCAACCTCACCAGC; T7 RNAP(K180)-F: TCTGGTGGTGGTGGCTCTAAAGCATTTATGCAAGTTGTCGAG; T7 RNAP(K179)-R:TCCGCTACCACCACCGCCCTTGTAGACGTGCCCTACGCCTTGTAGACGTGCCCTACGC; T7 RNAP(P364)-F:TCTGGTGGTGGTGGCTCTCCGGAAGACATCGACATGAATC; T7 RNAP(K363)-R: TCCGCTACCACCACCGCCTTTCATCGGGAGTTCTTCACG; T7 RNAP(S564)-F: TCTGGTGGTGGTGGCTCTAGTGAAACCGTTCAGGACATCTAC; T7 RNAP(P563)-R:TCCGCTACCACCACCGCCAGGAAGCAAGTTAACCGCGC; T7 RNAP(T602)-F: TCTGGTGGTGGTGGCTCTACTGGTGAAATCTCTGAGAAAGTC; T7 RNAP(N601)-R: TCCGCTACCACCACCGCCGTTCTCATCGGTCACGGTAAC; Im7_linker-F:GGCGGTGGTGGTAGCGGAGGTGGGGGCTCAGAACTGAAAAATAGTATTAGTGATTAC; Im7_linker-R: AGAGCCACCACCACCAGAACCGCCACCGCCCTGTTTAGCTCCTGGCTTACC; G-CSF_linker-F: GGCGGTGGTGGTAGCGGAGGTGGGGGCTCAACTCCGCTGGGTCCGGCGAG; G-CSF_linker-R: AGAGCCACCACCACCAGAACCGCCACCGCCCGGCTGAGCCAGGTGACGCAG.

[0076] Example 3: Directed evolution of alginate lyase VxAly7B-CM In Example 1, a stable VxAly7B-CM mutant, E188N / S204G, was obtained through rational design, demonstrating significantly improved enzyme activity and thermostability. This mutant is marked with an "*" in Example 3 to distinguish it from VxAly7B-CM. Based on this, the thermostability of VxAly7B-CM was further enhanced using directed evolution using the T7 biosensor system.

[0077] 1. Construction of VxAly7B-CM* mutant plasmid library (1) Construction of negative control strain First, construct the strain E. coli BW-AG / pACYC-tet-T7 RNAP-VxAly7B-CM* was used as a negative control for subsequent screening. Using the pET24a-VxAly7B-CM* plasmid as a template, the VxAly7B-CM* fragment was amplified using the primer pair VxAly7B-CM*_linker-F / VxAly7B-CM*_linker-R. VxAly7B-CM* was ligated into the pACYC-tet-T7 RNAP vector backbone using Gibson recombination, and the recombinant system was chemically transformed into E. coli JM109 was cultured overnight on LB solid medium containing 35 μg / mL chloramphenicol. Colony PCR was used to verify the connection. After sequencing, the circular plasmid was extracted to obtain pACYC-T7 RNAP-VxAly7B-CM* and transformed into the chassis strain. E. coli In BW-AG, a negative control strain was obtained E. coli BW-AG / pACYC-T7 RNAP-VxAly7B-CM*. The minimum inhibitory concentration of the negative control strain was determined by the microdilution method, MIC (10 -3 ) = 160 μg / mL.

[0078] (2) Construction of mutant library The target fragment was randomly mutated using the M5 Random Mutagenesis Kit. Using the pET24a-VxAly7B-CM* plasmid as a template, the VxAly7B-CM*_BsaI-F / VxAly7B-CM*_BsaI-R primer pair was used to amplify the VxAly7B-CM* fragment at a random mutation frequency of 1-3 bp / kb. The fragment had two ends with Bsa I restriction enzyme cutting site. The PCR product was gel-purified to obtain the VxAly7B-CM* random mutation DNA library. Using the pACYC-tet-T7 RNAP-VxAly7B-CM* plasmid as a template, the plasmid vector backbone was amplified using the primer pair pACYC-T7 RNAP_BsaI-F / pACYC-T7RNAP_BsaI-R, and the amplified product was added Dpn I was used to digest the methylated parent plasmid. After gel recovery and purification, the plasmid with two ends was obtained. Bsa I restriction enzyme cutting site linearized vector pACYC-T7 RNAP_BsaI.

[0079] 2. Directed evolution screening of stable mutants Transformation of mutant plasmid library into chassis strain E. coli In BW-AG, the library capacity was calculated to be 5×105 , meeting the mutation frequency requirements for the target fragment. In the first round of screening, stable mutants were selected using culture plates containing 200 μg / mL apramycin, and plasmids were extracted from positive colonies to establish the first-round screening library. Subsequently, a second round of random mutagenesis was performed using the first-round screening library as a template, with the mutation frequency also remaining at 1-3 bp / kb. To select mutants with greater resistance and stability, the apramycin screening concentration was increased to 250 μg / mL.

[0080] The results of the second round of antibiotic screening were collected and analyzed by Fortessa flow cytometer (BD, USA). Figure 13 Cells in the P2 range were collected to obtain mutants with the highest fluorescence intensity and the strongest stability. The collected cells were cultured and revived to obtain single clones on the plate.

[0081] 3. Expression and purification of mutants Twenty single clones from the plate were selected for sequencing. After removing duplicate and synonymous mutations, a total of 16 mutants were obtained, namely L178S*, Y181K*, S202A*, T222A*, F262S*, N267K*, H297T*, E324S*, S367P*, V370I*, T377S*, E397L*, G413S*, M417F* and two triple-point mutants K234N / R245T / S250T* and L349M / S356P / R392H*.

[0082] The pET-24a(+) plasmid with T7 promoter and His tag was used as the expression vector. E. coli BL21 (DE3) was used as the host strain to construct an expression system for the mutants. Subsequently, the mutants were induced for expression, and the target proteins were purified using a nickel column. SDS-PAGE analysis showed that all mutants were successfully expressed, with a prominent band observed at approximately 33 kDa, consistent with the theoretical molecular weight of VxAly7B-CM ( Figure 14 ).

[0083] 4. Characterization of the enzymatic properties of the mutants As shown in Table 5, among the 16 mutants, 11 mutants T m The values ​​were higher than those of VxAly7B-CM*, including L178S*, Y181K*, S202A*, T222A*, F262S*, N267K*, V370I*, T377S*, E397L*, G413S* and M417F*. T m The optimal reaction temperature (T opt) and specific activity. The optimal reaction temperature for all mutants remained within the 47-50°C range. At the optimal reaction temperature, G413S* exhibited the highest specific activity, reaching 4215.17 U / mg; S202A* also showed an improvement in specific activity, reaching 4060.76 U / mg.

[0084] Table 5 Specific activities and thermodynamic parameters of VxAly7B-CM* and its mutants

[0085] 5. Thermal stability of mutants The thermal stability of the mutants (S202A*, T222A*, N267K*, V370I*, E397L* and G413S*) at 50 °C was further determined. Figure 15 As shown in the figure, at 50°C, the enzyme activity of the mutants gradually decreased over time, but the rate of decrease varied significantly. The enzyme activities of T222A* and V370I* decreased rapidly, falling below 50% of the initial activity after 24 hours of incubation. However, the decay rates of S202A*, N267K*, E397L*, and G413S* slowed, demonstrating superior thermal stability to WT*.

[0086] Combined with the data in Table 6, the thermal stability of S202A* and G413S* has been significantly improved. 1 / 2 (50℃) The catalytic activity of these two mutants was significantly increased, extending to 56.8 h and 59.3 h, respectively, far exceeding the 38.4 h of WT*. Furthermore, the specific activity of these two mutants was also higher than that of WT*, indicating that their improved thermal stability was accompanied by a significant enhancement in catalytic efficiency. These results highlight the potential of S202A* and G413S* as high-performance mutants.

[0087] Table 6 Thermal inactivation half-life of VxAly7B-CM* and its mutants at 50°C

[0088] 6. Analysis of mutant degradation products Thin-layer chromatography (TLC) was used to determine the time-dependent degradation products of VxAly7B-CM, S202A* (E188N / S202A / S204G), and G413S* (E188N / S204N / G413S). Appropriate amounts of pure enzymes were added to a 0.3% (w / v) alginate substrate solution and mixed thoroughly. The mixture was then reacted at 45°C for 0, 1, 5, 15, 30, 60, and 120 min. Samples were immediately boiled for 10 min to terminate the reaction. 1 μL of each sample was dripped onto the corresponding position on a TLC plate. A prepared mixture of unsaturated alginate disaccharides and trisaccharides was used as a control. After developing the samples, the TLC plate was wetted with a color developer and heated at 120°C until color developed. The developing solvent was n-butanol, formic acid, and water (4:6:1, v / v / v); the developing agent was aniline-diphenylamine solution (4 g diphenylamine, 4 mL aniline, 20 mL 85% phosphoric acid, and 200 mL acetone).

[0089] Depend on Figure 16 The results indicate that VxAly7B-CM is an endo-acting alginate lyase. Initially, the reaction primarily produces high-molecular-weight sugar chains. As the reaction proceeds, the proportion of small oligosaccharides (ΔDP2 and ΔDP3) gradually increases, with the main products being ΔDP2, ΔDP3, ΔDP4, and ΔDP5. The mutation did not alter the catalytic mechanism, and the degradation product distributions of the two mutants remained consistent with those of the WT.

[0090] The above embodiments only represent the technical solutions of the present invention, rather than limiting the experiments. Although we have improved the experimental solutions, researchers in the same field can still make further improvements to the experimental solutions described above or make scientific equivalent replacements for the experimental steps. These changes do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. An alginate lyase VxAly7B-CM mutant 1, characterized in that: The amino acid sequence of the alginate lyase VxAly7B-CM mutant 1 is shown in SEQ ID No. 4, which is obtained by mutating the 188th amino acid from E to N, the 202nd amino acid from S to A, and the 204th amino acid from S to G in the alginate lyase VxAly7B-CM with the amino acid sequence of SEQ ID No.

2.

2. An alginate lyase VxAly7B-CM mutant 2, characterized in that: The amino acid sequence of the alginate lyase VxAly7B-CM mutant 2 is shown in SEQ ID No. 6, wherein the amino acid at position 188 of the alginate lyase VxAly7B-CM of SEQ ID No. 2 is mutated from E to N, the amino acid at position 204 is mutated from S to G, and the amino acid at position 413 is mutated from G to S.

3. The gene encoding the alginate lyase VxAly7B-CM mutant 1 according to claim 1 or the alginate lyase VxAly7B-CM mutant 2 according to claim 2, characterized in that: The nucleotide sequence of the gene encoding the mutant 1 is shown in SEQ ID No. 3; the nucleotide sequence of the gene encoding the mutant 2 is shown in SEQ ID No.

5. 4 . A recombinant expression vector comprising the gene encoding the alginate lyase VxAly7B-CM mutant 1 or the gene encoding the alginate lyase VxAly7B-CM mutant 2 according to claim 3 . 5 . A recombinant strain comprising the gene encoding the alginate lyase VxAly7B-CM mutant 1 or the gene encoding the alginate lyase VxAly7B-CM mutant 2 according to claim 3 .

6. A directed evolution method using a T7 biosensor, characterized in that: The steps of the directed evolution method are as follows: (1) Rationally design mutation sites for target proteins that require directed evolution; (2) Construction of T7 biosensor: T7 biosensor expresses the target protein by fusion with T7 RNA polymerase, so that the stability of the target protein is linked to the transcriptional activity of T7 RNA polymerase, and uses antibiotic resistance and fluorescence signal as screening phenotypes; (3) The constructed T7 biosensor was used to conduct directed evolution screening of rationally designed mutation sites. The sensor can effectively distinguish protein variants with different thermodynamic stabilities. Cell antibiotic resistance and fluorescence intensity are significantly positively correlated with protein thermodynamic stability, thereby screening for protein stability variants.

7. The directed evolution method using T7 biosensor according to claim 6, characterized in that: The specific construction steps of the T7 biosensor in step (2) are as follows: using the pACYC-tet plasmid as an expression vector, inserting the target protein to be directed-evolved into the N601 site of the T7 RNA polymerase through a GC-rich flexible linker for fusion expression; using the CRISPR / Cas9 gene editing system, the apramycin resistance gene controlled by the T7 promoter is inserted into the T7 RNA polymerase N601 site for fusion expression. aac and green fluorescent protein gene sfgfp Expression cassette knocked into E. coli BW25113 genome, obtain reporter system chassis strain E. coli BW-AG.

8. Use of the alginate lyase VxAly7B-CM mutant according to claim 1 or claim 2 in the preparation of a bioenzyme preparation for degrading seaweed or marine polysaccharides.

9. Use of the alginate lyase VxAly7B-CM mutant according to claim 1 or claim 2 in producing alginate oligosaccharides.

10. Use of the T7 biosensor according to claim 6 in high-throughput screening of protein stability.

Images