Application of LSR, LncRNA-LSR-AS1 or targeted siRNA in prevention and / or treatment of hyperlipemia or related diseases thereof

Abstract

The invention belongs to the technical field of biological medicines, and relates to application of LSR, LncRNA-LSR-AS1 or targeted siRNA in prevention and / or treatment of hyperlipidemia or related diseases thereof. The invention finds that the overexpression of the LSR gene shows a remarkable lipid-lowering effect in various hyperlipidemia models; the long-chain non-coding RNA (LncRNA-LSR-AS1) is specifically combined with a 3 'UTR (Untranslated Region) region of the LSR mRNA to negatively regulate the expression of the LSR gene; the targeting siRNA designed by aiming at the LncRNA-LSR-AS1 can be used for effectively inhibiting the expression of the LncRNA-LSR-AS1 and relieving the inhibiting effect of the LncRNA-LSR-AS1 on the LSR, so that the expression of the LSR is promoted. Effective intervention on hyperlipidemia can be achieved aiming at the target spots, the effects do not depend on an LDLR channel, and unique value is achieved for familial hypercholesterolemia with the poor PCSK9 inhibitor curative effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and relates to the use of LSR, LncRNA-LSR-AS1 or targeted siRNA in preventing and / or treating hyperlipidemia or related diseases. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Hyperlipidemia, also known as dyslipidemia, generally refers to elevated triglycerides and / or total cholesterol, elevated low-density lipoprotein cholesterol, and decreased high-density lipoprotein cholesterol in the plasma. Causes of the disease include gene mutations, various environmental factors such as poor diet, lack of physical activity, obesity, and other diseases such as diabetes, nephrotic syndrome, and liver disease. This abnormal blood lipid level can lead to lipid deposition in the arteries, accelerating the process of atherosclerosis and increasing the risk of cardiovascular events such as coronary heart disease, myocardial infarction, and stroke. Therefore, effective treatment of hyperlipidemia is crucial for preventing the occurrence of cardiovascular disease in patients.

[0004] Hyperlipidemia can be categorized into primary and secondary hyperlipidemia based on etiology. Familial hypercholesterolemia (FH) is a primary hyperlipidemia, a hereditary disorder characterized by mutations in specific genes. Its hallmark is a significant elevation in low-density lipoprotein cholesterol (LDL) levels. It has been determined that the pathogenic mutations in FH primarily occur in the genes for the low-density lipoprotein receptor (LDLR), apolipoprotein B (ApoB), proprotein convertase subtilisin / kexin type 9 (PCSK9), and LDLR adaptor protein 1 (LDLRAP1), with over 80% of cases involving LDLR mutations. Drug treatment for hyperlipidemia is key to reducing cardiovascular risk and requires individualized treatment based on the type of dyslipidemia, severity, and tolerability. Statins are first-line agents that significantly lower LDL cholesterol and mildly regulate triglycerides and high-density lipoprotein cholesterol (HDL) by inhibiting cholesterol synthesis. They are suitable for patients with primarily elevated LDL cholesterol, but they are associated with side effects such as hepatotoxicity, muscle-related adverse reactions (such as myalgia and rhabdomyolysis), and the potential for dysglycemia. Fibrates activate PPAR-α and significantly lower triglycerides. They are used for hypertriglyceridemia, but gastrointestinal reactions are common, and their combination with statins requires caution regarding the risk of myopathy. Niacin can increase HDL cholesterol, but due to side effects such as facial flushing, elevated blood sugar, and elevated serum uric acid, it is currently not a preferred option. PCSK9 inhibitors are potent lipid-lowering drugs that lower LDL cholesterol by targeting PCSK9 and are suitable for refractory hyperlipidemia. However, they require long-term injections, are costly, and their long-term safety remains to be verified. Furthermore, PCSK9 inhibitors are ineffective in treating patients with familial hypercholesterolemia. Therefore, the development of novel hyperlipidemia treatments to address these deficiencies is urgently needed. Summary of the Invention

[0005] The lipolysis-stimulated lipoprotein receptor (LSR) is a newly discovered member of the angulin family of tricellular tight junctions (tTJs) located in most epithelial tissues. Studies have shown that LSR has a high affinity for triglyceride-rich lipoproteins, chylomicrons (CMs), and low-density lipoproteins (LDLs), helping to clear residual CMs and triglyceride-rich lipoproteins from the blood. In the presence of free fatty acids, LSR recognizes apolipoprotein B and apolipoprotein E (ApoE), leading to the internalization and degradation of lipoprotein particles. Currently, no drugs have been shown to exert lipid-lowering effects by directly or indirectly regulating LSR.

[0006] Further research by the present invention demonstrates that overexpression of the LSR gene can promote the uptake and degradation of low-density lipoprotein (LDL) by hepatocytes. Using high-fat diet mice, LDLR knockout mice, and LDLR heterozygous mouse models, AAV-LSR significantly reduced serum total cholesterol (T-CHO), triglycerides (TG), LDL, and very low-density lipoprotein (vLDL) levels, and reduced hepatic lipid deposition. In particular, the efficacy in LDLR-deficient FH mice was significantly superior to that of PCSK9 inhibitors, indicating that LSR may serve as a target for the prevention and / or treatment of hyperlipidemia or its related diseases. Furthermore, further research by the present invention revealed that a long noncoding RNA (LncRNA, ENST00000685454.2, designated LncRNA-LSR-AS1 in this invention) can reduce LSR expression. By inhibiting LncRNA-LSR-AS1 expression, LSR expression can be promoted, thereby preventing or treating hyperlipidemia or its related diseases. Therefore, LncRNA-LSR-AS1 may also serve as a target for the prevention and / or treatment of hyperlipidemia or its related diseases. The present invention further provides small interfering RNA (siRNA) that can inhibit the expression of LncRNA-LSR-AS1 based on LncRNA-LSR-AS1 as a target, so as to promote LSR expression, thereby achieving the prevention and / or treatment of hyperlipidemia or its related diseases.

[0007] Based on the above research results, the purpose of the present invention is to provide the use of LSR, LncRNA-LSR-AS1 or targeted siRNA in preventing and / or treating hyperlipidemia or its related diseases.

[0008] Specifically, the technical solution provided by the present invention is as follows: In the first aspect, a targeted siRNA, which can specifically bind to LncRNA-LSR-AS1, induce its degradation or inhibit its expression, thereby reducing the level of LncRNA-LSR-AS1, wherein the LncRNA-LSR-AS1 is a LncRNA with a sequence as shown in SEQ ID NO.20.

[0009] In some embodiments, the targeting siRNA is a double-stranded RNA of 17 to 25 nucleotides, and the sense strand sequence thereof is as described in any one of the following: (a1) having a nucleotide sequence as shown in SEQ ID NO. X, where X is an odd number ranging from 27 to 55; (a2) a nucleotide sequence having at least 90% identity with the nucleotide sequence described in (a1) or at least 15 consecutive nucleotides; (a3) a nucleotide sequence that is at least 70% identical to the nucleotide sequence described in (a1) and retains the biological function of the sequence from which it is derived; The antisense strand sequence is as follows: (b1) having a nucleotide sequence as shown in SEQ ID NO. (X+1), where X is an odd number ranging from 27 to 55; (b2) a nucleotide sequence having at least 90% identity with the nucleotide sequence described in (b1) or at least 15 consecutive nucleotides; (b3) A nucleotide sequence that is at least 70% identical to the nucleotide sequence described in (b1) and retains the biological function of the sequence from which it is derived.

[0010] In one or more embodiments, X is 27, 29, 31, 33, 35, 39, 43, 49 or 51. That is, the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: si-6: Sense chain: ACGUUCUCCGGCCGGCGGC, as shown in SEQ ID NO. 27; Antisense strand: GCCGCCGGAGAACGUUU, as shown in SEQ ID NO. 28; si-26: Sense chain: CGGGCGCGGGCCGGGCCAG, as shown in SEQ ID NO. 29; Antisense strand: CUGGCCCGGCCCGCGCCCGUU, as shown in SEQ ID NO.30; si-43: Sense chain: AGGCUGGGUCUCUUCCUCC, as shown in SEQ ID NO.31; Antisense strand: GGAGGAAGAGACCCAGCCUUU, as shown in SEQ ID NO. 32; si-69: Sense chain: GGACUCCGGUGCCCCCGGG, as shown in SEQ ID NO. 33; Antisense strand: CCCGGGGGCACCGGAGUCCUU, as shown in SEQ ID NO.34; si-87: Sense chain: GACGCGGCGCUUUACAGAC, as shown in SEQ ID NO. 35; Antisense strand: GUCUGUAAAGCGCCGCGUCUU, as shown in SEQ ID NO.36; si-131: Sense chain: CGCCCCGCGCGGCCGAACA, as shown in SEQ ID NO. 39; Antisense strand: UGUUCGGCCGCGCGGGGCGUU, as shown in SEQ ID NO.40; si-151: Sense chain: AUGGUUCUCUCCAGAGCUU, as shown in SEQ ID NO.43; Antisense strand: AAGCUCUGGAGAGAACCAUUU, as shown in SEQ ID NO.44; si-190: Sense chain: ACUCGGGAGGGGUAUGGCA, as shown in SEQ ID NO.49; Antisense strand: UGCCAUACCCCUCCCGAGUUU, as shown in SEQ ID NO. 50; si-214: Sense chain: UCAUCAGUGUUCCUUCAAA, as shown in SEQ ID NO.51; Antisense strand: UUUGAAGGAACACUGAUGAUU, as shown in SEQ ID NO.52.

[0011] Here, C, G, U, and A represent cytidine-3'-phosphate, guanosine-3'-phosphate, uridine-3'-phosphate, and adenosine-3'-phosphate, respectively.

[0012] In one or more embodiments, the sense strand sequence has the nucleotide sequence shown in SEQ ID NO.43.

[0013] In one or more embodiments, the antisense strand sequence has the nucleotide sequence shown in SEQ ID NO.44.

[0014] In a second aspect, a modified siRNA is obtained by chemically modifying the sense strand and / or antisense strand of the targeting siRNA described in the first aspect of the present invention.

[0015] The purpose of chemically modifying the sense strand and / or antisense strand of the targeting siRNA in the present invention is to: prevent the targeting siRNA from being catalyzed and degraded by nucleases while ensuring the activity of the targeting siRNA, so as to ensure RNA interference (RNAi) of the targeting siRNA on the target LncRNA-LSR-AS1; and / or to increase the base interaction with the target LncRNA-LSR-AS1, thereby enhancing RNAi on the target LncRNA-LSR-AS1.

[0016] In the process of nuclease-catalyzed degradation of siRNA, firstly, the main attack target of nuclease is the phosphodiester bond backbone; secondly, siRNA belongs to RNA, and its unique 2'-OH can directly participate in nucleophilic attack under the catalytic action of nuclease, such as attacking the phosphate group, forming a cyclic phosphodiester while breaking the phosphoester bond, and then forming a hydrolysis product under the action of alkali; thirdly, some nucleases use specific bases as active sites for recognition.

[0017] Because the primary target of nuclease attack is the phosphodiester backbone, the chemical modifications described herein include backbone modifications of the sense and / or antisense strands. The primary target of nuclease attack on the phosphodiester backbone is the phosphorus atom, and even slight changes to this atom can significantly affect the enzyme's degradation. Therefore, the most studied backbone modifications are those of the phosphorus atom. For example, thiolation (i.e., modification of a phosphodiester bond to a phosphorothioate diester bond (the modified nucleotide is a phosphorothioate-modified nucleotide)) enhances the nuclease resistance of siRNA and increases its stability. Backbone modifications include, but are not limited to, phosphorothioate, phosphorodithioate, methylphosphonate, methoxypropyl phosphate, boranophosphate, fluorophosphate, and aminophosphoric acid modifications.

[0018] Since the 2'-OH of siRNA undergoes nucleophilic attack under the catalysis of nucleases, thereby initiating subsequent reactions and further causing degradation, the chemical modification described in the present invention includes ribose modification. Among them, ribose modification is mainly the modification of the chemical group at the 2' position of ribose. Among them, the chemical group modification at the 2' position of ribose refers to converting the hydroxyl group at the 2' position of ribose into other chemical groups, such as H (i.e., deoxynucleotide), halogen (fluorine, chlorine, bromine, iodine, etc.), alkyl (such as methyl, ethyl, propyl, etc. C1-C6 alkyl), alkenyl (such as vinyl, propenyl, allyl, etc. C2-C6 alkenyl), substituted alkyl (such as halogen (fluorine, chlorine, bromine, iodine), hydroxyl, nitro, amino, C1-C6 alkoxy substituted alkyl, wherein the alkyl can be methyl, ethyl, propyl, etc. C1-C6 alkyl), alkoxy (such as methoxy, ethoxy, propoxy, etc. C The 2' position of ribose can be composed of 2'-1' alkyl groups, substituted alkoxy groups (such as halogen (fluorine, chlorine, bromine, iodine), hydroxyl, nitro, amino, alkoxy substituted by C1-C6 alkoxy, wherein the alkoxy is as described above), amino, azido, arabinosyl, substituted arabinosyl (arabinosyl containing halogen (fluorine, chlorine, bromine, iodine) and other substituents), substituted amine groups (such as C1-C6 alkyl mono-substituted or di-substituted amine groups), etc. The introduction of other chemical groups at the 2' position of ribose not only affects the nucleophilic attack performance of 2'-OH, but also increases the steric hindrance, so that siRNA has stronger resistance to nuclease hydrolysis.

[0019] The chemical modifications described herein also include base modifications, which modify bases to enhance interactions between bases, thereby enhancing the effect on the target mRNA. Base modifications include, but are not limited to, methyl modifications, halogen modifications, alkynyl modifications, thio modifications, fluoro modifications, azido modifications, and amino modifications. The base-modified nucleotides can be abasic nucleotides, morpholino nucleotides, locked nucleotides, and the like.

[0020] In some embodiments, the modified siRNA is represented by formula (I): Sense strand: 5'-np-Na-YYY-Nb-nq-3' Antisense strand: 3'-np'-Na'-Y'Y'Y'-Nb'-nq'-5' (I) in: np, np', nq and nq' are 0 to 2 nucleotides respectively; each nucleotide is connected to the adjacent nucleotide through a phosphorothioate bond; Na, Nb, Na' and Nb' each independently represent an oligonucleotide sequence, wherein the oligonucleotide sequence is a sequence comprising 0-25 nucleotides, and the sequence comprises at least two different types of modified nucleotides; YYY and Y'Y'Y' each independently represent a motif consisting of three consecutive nucleotides, each nucleotide being modified with the same chemical group, specifically, a 2'-O-methyl or 2'-fluoro modification.

[0021] In some embodiments, the YYY motif occurs at or near the cleavage site of the sense strand.

[0022] In the siRNA provided by the present invention, a motif (i.e., YYY) in which three consecutive nucleotides are modified with the same chemical group (especially 2'-O-methyl modification (methoxy modification at the 2' position of ribose) or 2'-fluoro modification (fluorine modification at the 2' position of ribose)) can effectively increase the resistance of siRNA to nuclease degradation and enhance the binding stability with the target siRNA. For example, in the sense strand of S1 obtained by chemically modifying the sequence shown in SEQ ID NO.43, the nucleotides at positions 10-12 are YYY, and YYY are all modified with 2' methoxy; in the antisense strand of S1 obtained by chemically modifying the sequence shown in SEQ ID NO.44, the nucleotides at positions 11-13 are Y'Y'Y', and Y'Y'Y' are all modified with 2' methoxy; in the sense strand of S2 obtained by chemically modifying the sequence shown in SEQ ID NO.43, the nucleotides at positions 9-11 are YYY, and YYY are all modified with 2' fluoro; in the antisense strand of S2 obtained by chemically modifying the sequence shown in SEQ ID NO.44, the nucleotides at positions 8-11 are Y'Y'Y', and Y'Y'Y' are all modified with 2' fluoro; in the sense strand of S3 obtained by chemically modifying the sequence shown in SEQ ID NO.43, the nucleotides at positions 9-11 are YYY, and YYY are all modified with 2' fluoro; In the antisense strand of S3 obtained after chemical modification of the sequence shown in NO.44, nucleotides 9-11 are Y'Y'Y', and Y'Y'Y' are all modified with 2' methoxy groups; In some embodiments, the chemical modification is a chemically modified nucleotide, and the chemically modified nucleotide is any one or more of methoxy-modified nucleotides, methoxyethyl-modified nucleotides, aminopropyl-modified nucleotides, dimethylaminoethyl-modified nucleotides, aminopropyl-modified nucleotides, amino-modified nucleotides, azide-modified nucleotides, alkyl-modified nucleotides, F-arabinose-modified nucleotides, allyl-modified nucleotides, fluorine-modified nucleotides, deoxynucleotides, hydroxyl-modified nucleotides, phosphorothioate-modified nucleotides, abasic nucleotides, morpholino nucleotides, and locked nucleotides. The chemically modified groups are fluorinated or non-fluorinated groups. The non-fluorinated groups can be alkyl groups (e.g., C1-C6 alkyl groups, which can be methyl, ethyl, propyl, etc.), alkenyl groups (e.g., C2-C6 alkenyl groups, which can be vinyl, propenyl, allyl, etc.), substituted alkyl groups (e.g., halogen (fluorine, chlorine, bromine, iodine), hydroxyl groups, nitro groups, amino groups, or alkyl groups substituted with C1-C6 alkoxy groups, where the alkyl group can be C1-C6 alkyl), alkoxy groups (e.g., C1-C6 alkoxy groups), substituted alkoxy groups (e.g., halogen (fluorine, chlorine, bromine, iodine), hydroxyl groups, nitro groups, amino groups, or alkoxy groups substituted with C1-C6 alkoxy groups, where the alkoxy group is as described above), hydroxyl groups, phosphorothioate groups, amino groups, azido groups, or substituted amine groups (e.g., mono- or di-substituted C1-C6 alkyl amine groups). Alternatively, the chemical modification can be to form peptide nucleic acids, phosphorodiamidate morpholino oligonucleotides, or locked nucleic acids. Furthermore, the non-fluorinated groups can be methoxy groups, ethoxy groups, etc. Here, C1 means the carbon number is 1, and C6 means the carbon number is 6.

[0023] In some embodiments, the chemical modification includes ribose modification, and the ribose modification includes any one or more of methoxy modification, fluoro modification, methoxyethyl modification, locked nucleic acid modification, deoxy modification, amino modification, morpholino modification, aminopropyl modification, dimethylaminoethyl modification, azido modification, allyl modification, alkyl modification, alkoxy modification, and F-arabinose modification.

[0024] In some embodiments, the chemical modification comprises a backbone modification comprising a phosphorothioate modification, a phosphorodithioate modification, a methylphosphonate modification, a methoxypropylphosphate modification, a boranophosphate modification, a fluorophosphate modification, or an aminophosphono modification.

[0025] In some embodiments, the chemical modification includes base modification, and the base modification includes methyl modification, halogen modification, alkynyl modification, thio modification, fluoro modification, azide modification, and amino modification.

[0026] In one or more embodiments, the chemically modified group connects two adjacent nucleotides. The chemically modified group is a phosphorothioate group.

[0027] In one or more embodiments, the chemically modified group replaces the hydroxyl group at the 2' position of the ribose group of the nucleotide. The chemically modified group is fluorine, alkyl, substituted alkyl, alkoxy, amino, substituted amine, etc.

[0028] In one or more embodiments, the chemically modified group modifies at least one nucleotide in the targeting siRNA. Further, the chemically modified group modifies one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, eleven nucleotides, twelve nucleotides, thirteen nucleotides, fourteen nucleotides, fifteen nucleotides, sixteen nucleotides, seventeen nucleotides, eighteen nucleotides, nineteen nucleotides or all nucleotides of the sense strand in the siRNA. Further, the chemically modified group modifies one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, eleven nucleotides, twelve nucleotides, thirteen nucleotides, fourteen nucleotides, fifteen nucleotides, sixteen nucleotides, seventeen nucleotides, eighteen nucleotides, nineteen nucleotides or all nucleotides of the antisense strand in the siRNA.

[0029] In one or more embodiments, the sense strand sequence of the targeted siRNA has a nucleotide sequence as shown in SEQ ID NO.43.

[0030] In one or more embodiments, the antisense strand sequence of the targeted siRNA has a nucleotide sequence as shown in SEQ ID NO.44.

[0031] In a third aspect, an siRNA conjugate is obtained by conjugating the targeted siRNA described in the first aspect of the present invention or the modified siRNA described in the second aspect of the present invention with a pharmaceutically acceptable targeting group.

[0032] In some embodiments, the pharmaceutically acceptable targeting group can be galactose or N-acetylgalgactosamine (GalNAc). N-acetylgalactosamine is a ligand that binds to the asialoglycoprotein receptor (ASGPR) on the liver surface. The asialoglycoprotein receptor is an endocytic receptor specifically expressed by hepatocytes. N-acetylgalactosamine serves as a targeting molecule to deliver small RNA to the liver.

[0033] In some embodiments, the pharmaceutically acceptable targeting group is attached to the 3' end or the 5' end of the sense strand of the targeting siRNA.

[0034] In a fourth aspect, a composition comprises the targeted siRNA according to the first aspect of the present invention, the modified siRNA according to the second aspect of the present invention, or the conjugate of the siRNA according to the third aspect of the present invention, and excipients.

[0035] The excipients described in the present invention can be carriers with loading and / or transport functions, such as buffer solutions, physiological saline, lipid nanoparticles (LNPs, generally composed of triglycerides or their analogous compounds, cholesterol or their analogous compounds, phospholipids or their analogous compounds), polymer nanoparticles (such as nanocapsules and nanospheres formed by PEI coating), inorganic nanoparticles (such as silica nanoparticles, iron oxide nanoparticles, etc.); they can also be excipients, such as diluents, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorption carriers or lubricants, etc.

[0036] The dosage form of the composition of the present invention is tablet, capsule, powder, pill, granule, solution, suspension, syrup, injection, suppository, inhalant or spray.

[0037] In the composition of the present invention, the weight content of the targeted siRNA, siRNA modifications or siRNA conjugates in the composition is 1%-99%.

[0038] In a fifth aspect, any one of the following uses of the targeted siRNA according to the first aspect of the present invention, the modified siRNA according to the second aspect of the present invention, the conjugate of the siRNA according to the third aspect of the present invention, or the composition according to the fourth aspect of the present invention: (c1) Application in the preparation of a preparation for promoting LSR expression; (c2) Use in the preparation of a preparation for improving the ability of hepatocytes to take up low-density lipoprotein; (c3) Preparation for use in preventing and / or treating hyperlipidemia; (c4) Preparation for use in preventing and / or treating hyperlipidemia-related diseases.

[0039] The preparation of the present invention can be a medicine or a reagent for scientific research.

[0040] The treatment described in the present invention refers to a method implemented to obtain beneficial or desired clinical results. For the purpose of the present invention, beneficial or desired clinical results include, but are not limited to, alleviating symptoms, reducing the scope of the disease, stabilizing (i.e., no longer worsening) the state of the disease, delaying or slowing the development of the disease, improving or alleviating the state of the disease, and alleviating symptoms (whether partial or complete).

[0041] Prevention, as used in this invention, refers to avoiding, reducing, stopping, or delaying the onset of a disease or disease-related symptoms, where the disease or disease-related symptoms have not yet appeared before the administration of the relevant drug. "Prevention" does not necessarily require completely preventing the onset of a disease or disease-related symptoms. For example, if the administration of the relevant drug can reduce the risk of a subject developing a specific disease or disease-related symptom, or reduce the severity of related symptoms that later appear, it can be considered "preventing" the onset or development of the disease.

[0042] Hyperlipidemia as described herein includes primary hyperlipidemia (optionally heterozygous familial hypercholesterolemia or homozygous familial hypercholesterolemia) or secondary hyperlipidemia. Hyperlipidemia can also be categorized as hypercholesterolemia, hypertriglyceridemia, combined hyperlipidemia, and low high-density lipoprotein cholesterol. Hyperlipidemia-related diseases as described herein include cardiovascular diseases (e.g., atherosclerosis, coronary heart disease (e.g., angina pectoris, myocardial infarction), hypertension, etc.), cerebrovascular diseases (e.g., cerebral infarction, cerebral hemorrhage, etc.), acute pancreatitis, peripheral vascular diseases (e.g., lower limb arteriosclerosis obliterans, retinopathy, renal artery stenosis, etc.), non-alcoholic fatty liver disease, hyperfatty acidemia, obesity, and metabolic diseases (e.g., diabetes, metabolic syndrome, etc.).

[0043] In a sixth aspect, LncRNA-LSR-AS1 is used as a target in screening products for preventing and / or treating hyperlipidemia or its related diseases, and the sequence of the LncRNA-LSR-AS1 is shown in SEQ ID NO.20.

[0044] The hyperlipidemia or related diseases described in the sixth application of the present invention are the same as the hyperlipidemia or related diseases described in the fifth application of the present invention.

[0045] In some embodiments, LncRNA-LSR-AS1 is used as a target for preventing and / or treating hyperlipidemia. LncRNA-LSR-AS1, as an antisense long non-coding RNA of the LSR gene, inhibits LSR protein expression and affects lipid metabolism by targeting and binding to the 3'UTR region of LSR mRNA. Inhibiting the expression of LncRNA-LSR-AS1 or its binding activity to the 3'UTR of LSR mRNA can relieve the inhibition of LSR expression and promote LSR expression, thereby achieving the effect of lowering blood lipid levels, and is used to develop products for preventing and / or treating hyperlipidemia and related diseases.

[0046] In a seventh aspect, any one of the following uses of an agent for inhibiting LncRNA-LSR-AS1 expression; (d1) Use in the preparation of drugs for preventing and / or treating hyperlipidemia or its related diseases; (d2) Application in the preparation of a preparation for promoting LSR gene expression; (d3) Use in the preparation of a preparation for improving the ability of hepatocytes to take up low-density lipoprotein; Wherein, the sequence of the LncRNA-LSR-AS1 is shown as SEQ ID NO.20.

[0047] The hyperlipidemia or related diseases described in the seventh application of the present invention are the same as the hyperlipidemia or related diseases described in the fifth application of the present invention.

[0048] The reagents for inhibiting the expression of LncRNA-LSR-AS1 described in the present invention can be antisense oligonucleotides (ASOs), modified antisense oligonucleotides, conjugates of antisense oligonucleotides, polypeptides, proteins (proteins and polypeptides are formed by sequentially connecting basic amino acid structural units, wherein the molecular weight of proteins is higher than that of polypeptides), small molecule inhibitors, siRNAs, modified siRNAs, conjugates of siRNAs, substances for implementing lentiviral infection or gene knockout. In some embodiments, the reagents for inhibiting the expression of LncRNA-LSR-AS1 are siRNAs, modified siRNAs, or conjugates of siRNAs. The siRNAs involved in the reagents for inhibiting the expression of LncRNA-LSR-AS1 described in the present invention are the same as the targeted siRNAs described in the first aspect of the present invention. That is, the siRNA is a double-stranded RNA, and its sense strand sequence is as described in any of the following: (a1) having a nucleotide sequence as shown in SEQ ID NO. X, where X is an odd number ranging from 27 to 55; (a2) a nucleotide sequence having at least 90% identity with the nucleotide sequence described in (a1) or at least 15 consecutive nucleotides; (a3) a nucleotide sequence that is at least 70% identical to the nucleotide sequence described in (a1) and retains the biological function of the sequence from which it is derived; The antisense strand sequence is as follows: (b1) having a nucleotide sequence as shown in SEQ ID NO. (X+1), where X is an odd number ranging from 27 to 55; (b2) a nucleotide sequence having at least 90% identity with the nucleotide sequence described in (b1) or at least 15 consecutive nucleotides; (b3) A nucleotide sequence that is at least 70% identical to the nucleotide sequence described in (b1) and retains the biological function of the sequence from which it is derived.

[0049] In one or more embodiments, the sense strand sequence has the nucleotide sequence shown in SEQ ID NO.43.

[0050] In one or more embodiments, the antisense strand sequence has the nucleotide sequence shown in SEQ ID NO.44.

[0051] The modified siRNA involved in the reagent for inhibiting LncRNA-LSR-AS1 expression of the present invention is the same as the modified siRNA described in the second aspect of the present invention. That is, the modified siRNA is obtained by chemically modifying the sense strand and / or antisense strand of the siRNA described in the first aspect of the present invention.

[0052] In some embodiments, the chemically modified group is a fluorine or non-fluorine group, wherein the non-fluorine group can be an alkyl group (e.g., a C1-C6 alkyl group, which can be methyl, ethyl, propyl, etc.), an alkenyl group (e.g., a C2-C6 alkenyl group, which can be vinyl, propenyl, allyl, etc.), a substituted alkyl group (e.g., a halogen (fluorine, chlorine, bromine, iodine), a hydroxyl group, a nitro group, an amino-substituted alkyl group, wherein the alkyl group can be a C1-C6 alkyl group), an alkoxy group (e.g., a C1-C6 alkoxy group), a hydroxyl group, a phosphorothioate group, an amino group, an azide group, or a substituted amine group (e.g., a C1-C6 alkyl mono- or di-substituted amine group); or, the chemical modification is to form a peptide nucleic acid, a phosphorodiamidate morpholino oligonucleotide, or a locked nucleic acid. Furthermore, the non-fluorine group is a methoxy group, an ethoxy group, etc.

[0053] In one or more embodiments, the chemically modified group connects two adjacent nucleotides. The chemically modified group is a phosphorothioate group.

[0054] In one or more embodiments, the chemically modified group replaces the hydroxyl group at the 2' position of the ribose group of the nucleotide. The chemically modified group is fluorine, alkyl, substituted alkyl, alkoxy, amino, substituted amine, etc.

[0055] In one or more embodiments, the chemically modified group modifies at least one nucleotide in the siRNA. Further, the chemically modified group modifies one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, eleven nucleotides, twelve nucleotides, thirteen nucleotides, fourteen nucleotides, fifteen nucleotides, sixteen nucleotides, seventeen nucleotides, eighteen nucleotides, nineteen nucleotides or all of the nucleotides of the sense strand in the siRNA. Further, the chemically modified group modifies one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, ten nucleotides, eleven nucleotides, twelve nucleotides, thirteen nucleotides, fourteen nucleotides, fifteen nucleotides, sixteen nucleotides, seventeen nucleotides, eighteen nucleotides, nineteen nucleotides or all of the nucleotides of the antisense strand in the siRNA.

[0056] In one or more embodiments, the sense strand sequence of the siRNA has the nucleotide sequence shown in SEQ ID NO.43.

[0057] In one or more embodiments, the antisense strand sequence of the siRNA has the nucleotide sequence shown in SEQ ID NO.44.

[0058] The siRNA conjugate involved in the agent for inhibiting LncRNA-LSR-AS1 expression described in the present invention is the same as the siRNA conjugate described in the third aspect of the present invention. That is, the siRNA conjugate is obtained by conjugating the siRNA described in the first aspect of the present invention or the modified siRNA described in the second aspect of the present invention with a pharmaceutically acceptable targeting group.

[0059] In some embodiments, the pharmaceutically acceptable targeting group can be galactose or N-acetylgalactosamine. N-acetylgalactosamine is a ligand that binds to the asialoglycoprotein receptor on the liver surface. The asialoglycoprotein receptor is an endocytic receptor specifically expressed by hepatocytes. N-acetylgalactosamine serves as a targeting molecule to deliver small RNA to the liver.

[0060] In some embodiments, the pharmaceutically acceptable targeting group is attached to the 3' end or the 5' end of the sense strand of the siRNA.

[0061] In the eighth aspect, the downstream target gene LSR gene and / or protein of LncRNA-LSR-AS1 is used as a target in screening products for preventing and / or treating hyperlipidemia or its related diseases, the mRNA sequence of LSR is shown in any one of SEQ ID NO.1-19, and LncRNA-LSR-AS1 is a LncRNA with a sequence shown in SEQ ID NO.20.

[0062] The hyperlipidemia or related diseases described in the eighth aspect of the present invention are the same as the hyperlipidemia or related diseases described in the fifth aspect of the present invention.

[0063] In some embodiments, the product is one or more of a eukaryotic expression plasmid, adenovirus, adeno-associated virus, lentivirus, retrovirus, LNP liposome, gene editing system components, homologous recombination vector, ASO, ASO modifications, ASO conjugates, small molecule inhibitors, siRNA, siRNA modifications, or siRNA conjugates. The recombinant expression vector contains an LSR gene or a gene fragment with more than 90% homology to the LSR gene, and the polypeptide, protein, antisense oligonucleotide, small molecule inhibitor, siRNA, siRNA modifications, or siRNA conjugates can upregulate LSR gene and / or LSR protein expression.

[0064] In some embodiments, promoting the expression of the LSR gene can increase the ability of hepatocytes to take up low-density lipoprotein; inhibiting the expression of the LSR gene can reduce the ability of hepatocytes to take up low-density lipoprotein, thereby screening products for preventing and / or treating hyperlipidemia or its related diseases.

[0065] In a ninth aspect, any one of the following uses of the downstream target molecule LSR of LncRNA-LSR-AS1 or an agent for promoting the expression of the downstream target molecule LSR of LncRNA-LSR-AS1; (e1) Use in the preparation of drugs for preventing and / or treating hyperlipidemia or its related diseases; (e2) Use in the preparation of a preparation for improving the ability of hepatocytes to take up low-density lipoprotein; (e3) Use in the preparation of a preparation for reducing lipid deposition in liver tissue.

[0066] The mRNA sequence of LSR is shown in any one of SEQ ID NOs. 1-19, and LncRNA-LSR-AS1 is the LncRNA with a sequence shown in SEQ ID NO. 20.

[0067] The hyperlipidemia or related diseases described in the ninth aspect of the present invention are the same as the hyperlipidemia or related diseases described in the fifth aspect of the present invention.

[0068] The reagents for promoting LSR expression include vector-based adenovirus, lentivirus, LNP liposome, gene editing system components or homologous recombination vectors and microinjection technology that specifically target the LSR gene, or agonists of the LSR protein.

[0069] The LSR gene and / or protein described in the present invention is ubiquitous in humans and animals and has cross-species characteristics. Therefore, the application scope of the LSR gene and / or protein described above in the present invention is not limited to humans, but also includes animals of other species other than humans that contain LSR genes and / or proteins, such as cats, dogs, monkeys, mice, etc.

[0070] The beneficial effects of the present invention are: 1. The present invention demonstrates, through in vitro experiments with human liver cell lines and in vivo experiments with a high-fat mouse model, that overexpressing LSR significantly enhances cellular LDL uptake, significantly reduces T-CHO, TG, LDL, and vLDL concentrations in mouse serum, and reduces lipid content in liver tissue. Compared to existing drugs, LSR, a protein expressed natively by the body, has fewer side effects. In particular, in patients with familial hypercholesterolemia with LDLR gene deletions, its lipid-lowering effect is significantly superior to existing therapeutics targeting PSCK9 or LDLR.

[0071] 2. The present invention has discovered a LncRNA for inhibiting LSR expression. This LncRNA interacts with the 3'UTR region of LSR. When its expression level in cells decreases, the expression of LSR will increase accordingly. Therefore, this LncRNA can be used as a target for preventing and / or treating hyperlipidemia or its related diseases. Based on this LncRNA as a target, the present invention further designed a series of siRNAs and their modifications and conjugates. Experiments show that these siRNAs and their modifications and conjugates can increase the effect of Hep3B, HepG2 and HepaRG cells on LDL uptake. Among them, siRNA si-151 can significantly increase the effect of Hep3B, HepG2 and HepaRG cells on LDL uptake. Its effect on promoting LDL uptake in LDLR knockout hepatocytes is significantly better than that of Incisiran, a siRNA drug targeting PCSK9 that is already on the market. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0073] Figure 1 This is a graph showing the results of DiI-LDL uptake by hepatocytes in the control group and the LSR overexpression group in Example 1 of the present invention; Figure 2 Graph showing the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of mice in the high-fat diet control group and the LSR overexpression group in Example 2 of the present invention; Figure 3 Oil red staining (A) and quantification (B) of liver tissue of mice in the high-fat diet control group and LSR overexpression group in Example 2 of the present invention; Figure 4Graph showing the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of LDLR knockout mice in the high-fat diet control group and the LSR overexpression group in Example 3 of the present invention; Figure 5 Oil red staining (A) and quantification (B) of liver tissue of LDLR knockout mice in the high-fat diet control group and LSR overexpression group in Example 3 of the present invention; Figure 6 Graph showing the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of the LDLR knockout mice in the normal diet control group and the LSR overexpression group in Example 4 of the present invention; Figure 7 Graph showing the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of LDLR heterozygous mice in the high-fat diet control group and the LSR overexpression group in Example 5 of the present invention; Figure 8 Oil red staining (A) and quantification (B) of liver tissue of LDLR heterozygous mice in the high-fat diet control group and LSR overexpression group in Example 5 of the present invention; Figure 9 Graph showing the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of LDLR heterozygous mice in the normal diet control group and the LSR overexpression group in Example 6 of the present invention; Figure 10 Graph showing the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of aged mice in the control group and the LSR overexpression group in Example 7 of the present invention; Figure 11 The graphs show the relative expression of LSR mRNA in HepG2 (A), Hep3B (B) and HepaRG (C) cells in the control group and LncRNA groups at different concentrations in Example 9 of the present invention; Figure 12 Graph showing the relative expression of LSR mRNA in HepG2 (A), Hep3B (B) and HepaRG (C) cells in the control group and different siRNA sequence groups in Example 11 of the present invention; Figure 13 Graph showing the relative expression of LSR mRNA in HepG2 (A), Hep3B (B) and HepaRG (C) cells in the control group and si-151 groups at different concentrations in Example 12 of the present invention; Figure 14 Graph showing the relative expression of LncRNA-LSR-AS1 in HepG2 (A), Hep3B (B), and HepaRG (C) cells in the control group and si-151 groups at different concentrations in Example 12 of the present invention; Figure 15Graphs showing the expression (A) and quantification (B) of LSR protein in hepatocytes of the control group and the si-151 group in Example 13 of the present invention; Figure 16 Graph showing the relative expression of LSR mRNA in HepG2 (A), Hep3B (B) and HepaRG (C) cells in the control group and the differently modified si-151 groups in Example 15 of the present invention; Figure 17 Graph showing the relative expression of LncRNA-LSR-AS1 in HepG2 (A), Hep3B (B) and HepaRG (C) cells in the control group and different modified si-151 groups in Example 15 of the present invention; Figure 18 Graph showing the relative expression of LSR mRNA in HepG2 (A), Hep3B (B) and HepaRG (C) cells in the control group and S3 group at different concentrations in Example 15 of the present invention; Figure 19 Graphs showing the results of Dil-LDL uptake by HepG2 (A), Hep3B (B) and HepaRG (C) cells in the control group, S3 group and si-PCSK9 group in Example 17 of the present invention; Figure 20 This is a graph showing the results of Dil-LDL uptake by liver organoids in the control group, S3 group, and si-PCSK9 group in Example 18 of the present invention; Figure 21 Graphs showing the results of Dil-LDL uptake by control HepG2 cells, and LDLR knockout HepG2 (A), Hep3B (B), and HepaRG (C) cells in the control, S3, and si-PCSK9 groups in Example 19 of the present invention; Figure 22 Graphs showing the concentration of vLDL in the serum of mice in the AAV-CTL group and the AAV-LSR group in the high-fat model of C57BL / 6 mice (A), LDLR knockout mice on a high-fat diet (B), and LDLR heterozygous mice on a high-fat diet (C) in Example 20 of the present invention. DETAILED DESCRIPTION

[0074] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0075] Example 1 Overexpression of LSR promotes LDL uptake in human liver cell lines Step 1: Construction of LSR overexpression plasmid LSR includes human LSR213, human LSR 201, human LSR 202, human LSR 203, human LSR 204, human LSR 205, human LSR 206, human LSR 207, human LSR 208, human LSR 209, human LSR 210, human LSR211, human LSR 212, human LSR 213, human LSR 214, mouse LSR 201, mouse LSR 202, mouse LSR 203, mouse LSR 204, and mouse LSR 205.

[0076] The nucleotide sequence (5'-3') of the human LSR 213 mRNA (ENST00000605618.6) is:

[0077] The nucleotide sequence (5'-3') of the human LSR 201 mRNA (ENST00000347609.8) is:

[0078] The nucleotide sequence (5'-3') of the human LSR 202 mRNA (ENST00000354900.7) is:

[0079] The nucleotide sequence (5'-3') of the human LSR 203 mRNA (ENST00000360798.7) is:

[0080] The nucleotide sequence (5'-3') of the human LSR 204 mRNA (ENST00000361790.7) is:

[0081] The nucleotide sequence (5'-3') of the human LSR 205 mRNA (ENST00000427250.5) is:

[0082] The nucleotide sequence (5'-3') of the mRNA of human LSR 206 (ENST00000597446.1) is as follows: GGAGGATACCCTGGAGACGTTGACAGGAGTAGCTCAGCTGGTGGCCAAGGCTCCTATGTACCCCTGCTTCGGGACACGGACAGCAGTGTGGCCTCTGGTGAGAATCCATCGTCCCGAAGTTGGATGTGCCTGTAAGGGAGAGGGGTGGGCCAGGATCCATCCTCCCAAACCGACCACCACCCCCCTGTCCCTAGAAGTCCGCAGTGGCTACAGGATTCAGGCCAGCCAGCAGGACGACTCCATGCGGGTCCTGTACTACATGGAGAAGGAGCTGGCCAACTTCGACCCTTCTCGACCTGGCCCCCCCAGTGGCCGTGTGGAGCGGGCCATGAGTGAAGTCACCTCCCTCCACGAGGACGACTGGCGATCTCGGCCTTCCCGGGGCCCTGCCCTCACCCCGATCCGGGATGAGGAGTGGGGTGGCCACTCCCCCCGGAGTCCCAGGGGATGGGACCAGGAGCCCGCCAGGGAGCAGGCA, as shown in SEQ ID NO.7.

[0083] The nucleotide sequence (5'-3') of the mRNA of human LSR 207 (ENST00000597933.5) is as follows: CCCCAGTGGAAGTGGAGAAGTCAGGCGCCACCAACAAGCCTCTCCCAGCCAGGACTTTGCTTAGACTCGCTCCTCCCGGCAGGGCGCACCTAGGCGGGTCCATCGCCAGCCGGGGAGAGGGGTTTGGGCAGGGAGGGAACAGGTGCGCGGCGGGACCCGCCCTATCTCAACAGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTCTTCCAGCCTGTGACCCTGCCCTGTACCTACCAGATGACCTCGACCCCCACGCAACCCATCGTCATCTGGAAGTACAAGTCTTTCTGCCGGGACCGCATCGCCGATGCCTTCTCCCCGGCCAGCGTCGACAACCAGCTCAATGCCCAGCTGGCAGCCGGGAACCCAGGCTACAACCCCTACGTTGAGTGCCAGGACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGGGAGGACCTCAGGGGTGGCTGAGCTCTTACCTGGTTTTCAGGCGGGGCCCATAGAAGACTGGCTCTTCGTGGTTGTGGTATGCCTGGCTGCCTTCCTCATCTTCCTCCTCCTGGGCATCTGCTGGTGCCAGTGCTGCCCGCACACTTGCTGCTGCTACGTCAGGTGCCCCTGCTGCCCAGACAAGTGCTGCTGCCCCGAGGCCCGTAAGTGTCCCGCTCATGGCCACCCTGGTTT, as shown in SEQ ID NO.8.

[0084] The nucleotide sequence (5'-3') of the mRNA of human LSR 208 (ENST00000599658.1) is: GACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGGGAGGACCTCAGGGGTGGCTGAGCTCTTACCTGGTTTTCAGGCGGGGCCCATAGAAGTGTATGCCGCCGGCAAAGCAGCCACCTCAGGTGTTCCCAGCATTTATGCCCCCAGCACCTATGCCCACC, as shown in SEQ ID NO.9.

[0085] The nucleotide sequence (5'-3') of the mRNA of human LSR 209 (ENST00000601623.5) is: <000,0296>AGGAAGTGAAACTCCCTGGACGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTCTTCCAGCCTGTGACCCTGCCCTGTACCTACCAGATGACCTCGACCCCCACGCAACCCATCGTCATCTGGAAGTACAAGTCTTTCTGCCGGGACCGCATCGCCGATGCCTTCTCCCCGGCCAGCGTCGACAACCAGCTCAATGCCCAGCTGGCAGCCGGGAACCCAGGCTACAACCCCTACGTTGAGTGCCAGGACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGACTGGCTCTTCGTGGTTGTGGTATGCCTGGCTGCCTTCCTCAT, as shown in SEQ ID NO.10.

[0086] The nucleotide sequence (5'-3') of the human LSR 210 mRNA (ENST00000602003.1) is: GTGTACCTGGGCCGAACCATTCACCGGAGCGCGCAGCGGGTGGAGTGTGGCTCGGAGGACCGCGGCGGGTCAAGCACCTTTCTCCCCCATATCTGAAAGCATGCCCTTTGTCCACGTCGTTTACGCTCATTAAAACTTCCAGAATGCAACA GGACGGACTTGGAGTAGGGACAAGGAACGGAAGTGGGAAGGGGAGGAGCGTGCACCCCTCCTGGCCTTGGTGCGCGCCGCGCCCCCTAAGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTC, such as SEQ Shown as ID NO.11.

[0087] The nucleotide sequence (5'-3') of the human LSR 211 mRNA (ENST00000602044.2) is: GTGTGGCTTCTGCTTAGCACCTGGTGCACAGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTCTTCCAGCCTGTGACCCTGCCCTGTACCTACCAGATGACCTCGACCCCCACGCAACCCATCGTCATCTGGAAGTACAAGTCTTTCTGCCGGGACCGCATCGCCGATGCCTTCTCCCCGGCCAGCGTCGACAACCAGCTCAATGCCCAGCTGGCAGCCGGGAACCCAGGCTACAACCCCTACGTTGAGTGCCAGGACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGGCAGGGACCACTGGCCCACAGTGCCTCCAATCACCCAAGCCAAACTAAGAGAAGAGTGGAGACAATTGGAGACTCTGCCTTTTCAAAGTCTCATTTTTAAAAAAAATCCAGACTTGGGGTCCGGGTGCGGTAGTTCATGCCTGTAATCCCAGCACTTTGGGA, as shown in SEQ ID NO. 12.

[0088] The nucleotide sequence (5'-3') of the mRNA of human LSR 212 (ENST00000602122.5) is:

[0089] The nucleotide sequence (5'-3') of the human LSR 214 mRNA (ENST00000621372.4) is:

[0090] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 201 (ENSMUST00000001279.15) is:

[0091] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 202 (ENSMUST00000098553.11) is:

[0092] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 203 (ENSMUST00000108116.10) is:

[0093] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 204 (ENSMUST00000147431.2) is:

[0094] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 205 (ENSMUST00000205961.2) is:

[0095] The pQCXIP plasmid was used to construct an intracellular LSR overexpression plasmid containing the nucleotide sequence of human LSR 213 mRNA. A single copy of the LSR mRNA sequence was cloned into the EcoR I / BamH I site of the pQCXIP plasmid to obtain the LSR overexpression plasmid.

[0096] Step 2: Cell culture and transfection In a 24-well plate, 1 μg of LSR overexpression plasmid and 2 μl of P3000 were added to each well. TM 25 μl DMEM (Gibco) containing Reagent (purchased from Invitrogen, catalog number L3000015) and 25 μl DMEM (purchased from Meilun Biotechnology) containing Lipofectamine 3000 (purchased from Invitrogen, catalog number L3000015) were added at a volume of 0.75 μl per well. The two were mixed and incubated at room temperature (25°C) for 15 minutes. The above mixture was added to a plate containing 3.5×10 5 After culturing at 37°C for 12 hours, human liver cancer cell lines Hep3B cells and HepG2 cells were cultured in DMEM complete medium (purchased from Meilun Biotechnology), and human primary liver cell line HepaRG cells were cultured in William's E medium (purchased from Gibco). The cells were harvested after 48 hours.

[0097] Step 3: LDL uptake 1. Aseptically dilute DiI-LDL to 40 mg / ml in culture medium.

[0098] 2. Add the diluted DiI-LDL to a 24-well plate and incubate at 37°C for 5 hours.

[0099] 3. Remove the culture medium containing DiI-LDL.

[0100] 4. Wash cells three times with probe-free medium.

[0101] 5. Fluorescence microplate reader detection, using standard rhodamine excitation, recommended wavelength: excitation: 554 nm, emission: 571 nm.

[0102] like Figure 1 As shown, overexpression of LSR significantly increased the uptake of LDL in Hep3B, HepG2, and HepaRG cells.

[0103] Example 2 Overexpression of LSR significantly reduces blood lipid levels in hyperlipidemia mice Step 1: Construction of a high-fat model in C57BL / 6 mice Feeding C57BL / 6 mice a high-fat diet is a common method for establishing an animal model of hyperlipidemia. In this example, 6-week-old C57BL / 6 male mice were fed a normal diet for 2 weeks to acclimate to the housing environment. They were then fed a high-fat diet for 8 weeks and randomly divided into two groups. Each group was injected with 100 μl of AAV virus containing LSR mRNA (SEQ ID NO. 15) (AAV-LSR) or empty virus (AAV-CTL) via retroorbital vein injection. 11 vg. Blood was collected from the tail vein every two weeks to measure total cholesterol (T-CHO), triglycerides (TG), and low-density lipoprotein (LDL). Mice were euthanized 16 weeks after AAV treatment, and plasma and liver tissue were collected for subsequent analysis.

[0104] Step 2: Detection of T-CHO, TG and LDL in serum The concentrations of T-CHO, TG, and LDL in the serum of each group of mice were measured using commercially available kits according to the manufacturer's instructions. The T-CHO assay kit (A111-1-1, Nanjing Jiancheng Bioengineering Institute), the TG assay kit (A110-1-1, Nanjing Jiancheng Bioengineering Institute), and the LDL assay kit (A113-1-1, Nanjing Jiancheng Bioengineering Institute) were used.

[0105] Step 3: Oil red staining of liver tissue 1. Fix the prepared liver frozen sections in 4% paraformaldehyde for 5 minutes; 2. Rinse three times with distilled water; 3. Clean with 60% isopropyl alcohol; 4. Dye with 60% Oil Red O solution for 10 minutes; 5. 60% isopropyl alcohol color separation; 6. Rinse three times with distilled water; 7. Hematoxylin counterstaining; 8. Wash with PBS buffer for 1 minute; 9. Rinse three times with distilled water; 10. Seal the slides with glycerol, observe and take photos.

[0106] like Figure 2 As shown in Figures A, B, and C, the concentrations of T-CHO, TG, and LDL in the serum of mice in the AAV-LSR group were significantly reduced compared with those in the AAV-CTL group. Figure 3 As shown in Figures A and B, the lipid content in the liver tissue of mice in the AAV-LSR group was significantly reduced compared with that in the AAV-CTL group. These results suggest that LSR can effectively improve hyperlipidemia.

[0107] Example 3 Overexpression of LSR significantly reduces blood lipid levels in LDLR knockout mice fed a high-fat diet Step 1: Construction of a high-fat diet model in LDLR knockout mice This example is based on Example 2, retaining steps 1 to 3, and replacing the mice described in step 1 with the LDLR knockout mice described in Example 3.

[0108] like Figure 4 As shown in Figures A, B, and C, the concentrations of T-CHO, TG, and LDL in the serum of mice in the AAV-LSR group were significantly reduced compared with those in the AAV-CTL group. Figure 5 As shown in Figures A and B, the lipid content in the liver tissue of mice in the AAV-LSR group was significantly reduced compared with that in the AAV-CTL group. These results suggest that LSR can effectively improve familial hypercholesterolemia caused by LDLR deficiency.

[0109] Example 4 Overexpression of LSR significantly reduces blood lipid levels in LDLR knockout mice fed a normal diet In this example, 6-week-old male LDLR knockout mice were fed a normal diet for 2 weeks and then randomly divided into two groups. AAV virus containing LSR mRNA (SEQ ID NO. 15) (AAV-LSR) or empty virus (AAV-CTL) was injected into each mouse via retroorbital vein, with 100 μl of virus (2×10 11 vg. Blood was collected from the tail vein every two weeks to measure total cholesterol, triglycerides, and low-density lipoprotein (LDL) in the blood lipid profile. After 16 weeks of AAV treatment, the mice were euthanized and plasma was collected for subsequent testing. The testing process was performed according to step 2 of Example 3.

[0110] like Figure 6 As shown in Figures A, B, and C, the concentrations of T-CHO, TG, and LDL in the serum of the AAV-LSR group mice were significantly decreased compared with those of the AAV-CTL group mice.

[0111] Example 5 Overexpression of LSR significantly reduces blood lipid levels in LDLR heterozygous mice fed a high-fat diet This example is based on Example 3, retaining steps 1 to 3, and replacing the LDLR knockout mice described in step 1 with the LDLR heterozygous mice described in Example 5.

[0112] like Figure 7 As shown in Figures A, B, and C, the concentrations of T-CHO, TG, and LDL in the serum of mice in the AAV-LSR group were significantly reduced compared with those in the AAV-CTL group. Figure 8As shown in Figures A and B, the lipid content in the liver tissue of mice in the AAV-LSR group was significantly reduced compared with that in the AAV-CTL group. These results suggest that LSR can effectively improve LDLR heterozygous familial hypercholesterolemia.

[0113] Example 6 Overexpression of LSR significantly reduces blood lipid levels in LDLR heterozygous mice fed a normal diet This example is based on Example 4, retaining steps 1 to 2, and replacing the LDLR knockout mice described in step 1 with the LDLR heterozygous mice described in Example 6.

[0114] like Figure 9 As shown in Figures A, B, and C, the concentrations of T-CHO, TG, and LDL in the serum of the AAV-LSR group mice were significantly decreased compared with those of the AAV-CTL group mice.

[0115] Example 7 Overexpression of LSR significantly reduces blood lipid levels in aged mice In this example, 18-month-old C57BL / 6 male mice fed a normal diet were randomly divided into two groups and injected retro-orbitally with AAV virus containing LSR mRNA (SEQ ID NO. 15) (AAV-LSR) or empty virus (AAV-CTL). Each mouse was injected with 100 μl of virus at a dose of 2 × 10 11 vg. Sixteen weeks after AAV treatment, mice were euthanized and plasma was collected for subsequent testing. The testing process was performed according to step 2 of Example 2.

[0116] like Figure 10 As shown in Figures A, B, and C, the serum levels of T-CHO, TG, and LDL in the AAV-LSR group were significantly lower than those in the AAV-CTL group. These results suggest that LSR can effectively improve aging-related elevated blood lipids.

[0117] Example 8 A LncRNA for Inhibiting LSR Expression This study discovered a 270-nt antisense noncoding transcript, ENST00000685454.2, that interacts with the 3'UTR of LSR. When its expression in cells decreases, LSR expression increases. The lncRNA sequence (5'-3') is as follows: GGGGCACGTTCTCCGGCCGGCGGCGCGGGCGGGCCGGGCCAGGCTGGGTCTCTTCCTCCCGGCCCCGGACTCCGGTGCCCCCGGGACGGCGGCGCTTTACAGACGCATACGGGAGCAGCCCCGGTCCCCCGCCCG CGCGGCCGAACAAATGGTTCTCTCCAGAGCTTGTGATTATACGTTTTATTAGACTCGGGAGGGGTATGGCAGGGCTTCATCAGTGTTCCTTCAAATTAAAAAAAAAAATACAAAAGCTACGTAGAAAACGTCA, as in SEQ Shown as ID NO.20.

[0118] Example 9 An unmodified LncRNA that inhibits LSR expression This example provides an experiment for screening unmodified LncRNAs that inhibit LSR expression in two human liver cancer cell lines, Hep3B cells and HepG2 cells, and a human primary liver cell line, HepaRG cells. The experimental process is as follows: Step 1: Construction of LncRNA expression plasmid pLVX The pLVX plasmid was used to construct a lncRNA intracellular expression plasmid containing the entire nucleotide sequence of lncRNAENST00000685454.2 (LncRNA-LSR-AS1, SEQ ID NO: 20) to obtain a lncRNA expression plasmid.

[0119] Step 2: Cell culture and transfection In a 12-well plate, 1 μg of pLVX plasmid and 2 μl of P3000 reagent were added to DMEM (purchased from Meilun Biotechnology) at a volume of 25 μl per well. 3 μl of Lipofectamine 3000 (purchased from Invitrogen, catalog number L3000015) was also added to each well. The two were mixed and incubated at room temperature (25°C) for 15 minutes to obtain a mixture. The above mixture was added to a 3.5×10 5 After culturing at 37°C for 12 hours, human liver cancer cell lines Hep3B cells and HepG2 cells were cultured in DMEM complete medium (purchased from Meilun Biotechnology), and human primary liver cell line HepaRG cells were cultured in William's E medium (purchased from Gibco). The cells were harvested after 48 hours.

[0120] Step 3: RNA extraction: (1) Add 1 ml of Trizol to each well and homogenize thoroughly using a homogenizer. Ensure that there is no clogging when aspirating with a 1 ml pipette tip. After homogenization, aspirate 1 ml and transfer it to a 1.5 ml sterile RNase-free centrifuge tube. Let it stand at room temperature for 10 min to fully lyse the kidney tissue.

[0121] (2) After standing, add 200 μl of chloroform to each centrifuge tube, cover it and shake vigorously for 15 seconds. Let it stand at room temperature for about 3 minutes, and then centrifuge it at 4°C and 12,000×g for 15 minutes to separate the three phases. The aqueous phase containing RNA is on the top.

[0122] (3) Use a 200 μl pipette to aspirate 500 μl of the aqueous phase after centrifugation, add 500 μl of isopropanol, mix well, and let it stand at room temperature for 10 min to precipitate RNA. After standing, centrifuge at 4°C and 12,000 × g for 10 min to obtain RNA precipitate.

[0123] (4) Discard the liquid in the centrifuge tube, leaving the RNA precipitate, add 1 ml of 75% alcohol to wash the RNA precipitate, shake to make the RNA float to achieve the purpose of thorough washing, centrifuge at 7500×g at 4℃ for 5 min, and repeat this step.

[0124] (5) Discard the 75% alcohol again and centrifuge at 7500×g for 5 min at 4°C to allow the remaining liquid on the tube wall to gather at the bottom of the tube.

[0125] (6) Carefully remove excess liquid with a pipette, avoiding contact with the RNA precipitate. Air-dry the RNA at room temperature for approximately 10 minutes. Observe carefully until the edges of the RNA clumps are clear, indicating that the RNA has dried. Add an appropriate amount of DEPC water (300-500 μl) to dissolve the RNA. Incubate in a 56°C water bath for 10 minutes to obtain an RNA solution for subsequent experiments.

[0126] Step 4: RNA reverse transcription (1) Take 1 μl of the dissolved RNA solution and measure the concentration using a Nano1000 RNA concentration meter. Adjust the concentration to between 200-300 ng / μl. Take 1 μg of RNA and perform reverse transcription according to the reverse transcription kit (Acry Bio). The obtained cDNA is subjected to real-time fluorescence quantitative PCR or frozen at -80°C.

[0127] Step 5: qPCR reaction The qPCR reaction system is shown in Table 1.

[0128] Table 1 qPCR reaction system

[0129] The qPCR reaction conditions are shown in Table 2.

[0130] Table 2 qPCR reaction conditions

[0131] Primer F (including LSR -F, LncRNA-LSR-AS1 -F, GAPDH -F), Primer R (including LSR -R, LncRNA-LSR-AS1 -R, GAPDH The -R)) sequence looks like this: LSR -F: GACGTTGACAGGAGTAGCTCAG, as shown in SEQ ID NO. 21; LSR -R: CCTTCTCCATGTAGTACAGGACC, as shown in SEQ ID NO. 22; LncRNA-LSR-AS1 -F:TTACAGACGCATACGGGAGC, as shown in SEQ ID NO.23; LncRNA-LSR-AS1 -R:TGATGAAGCCCTGCCATACC, as shown in SEQ ID NO.24; GAPDH -F:TGATGACATCAAGAAGGTGGTGAAG, as shown in SEQ ID NO.25; GAPDH -R: TCCTTGGAGGCCATGTGGGCCAT, as shown in SEQ ID NO.26.

[0132] The reaction was performed for 40 cycles. After the reaction was completed, the exported data were saved and the Ct difference (ΔCt) method was used to perform relative quantitative calculation of the target gene LSR in each test group. The calculation method is as follows: ΔCt (test group) = Ct (test group target gene) – Ct (test group reference gene) ΔCt (control group) = Ct (control group target gene) – Ct (control group internal reference gene) The expression level of LSR mRNA in the test group was normalized with the control group as the benchmark, and the expression level of LSR mRNA in the control group was defined as 1.

[0133] The relative expression level of LSR mRNA in the test group = 2 -ΔCt(测试组) like Figure 11As shown in Figures A, B, and C, overexpression of LncRNA-LSR-AS1 in human liver cancer cell lines Hep3B cells and HepG2 cells and human primary liver cell line HepaRG cells resulted in a significant decrease in LSR mRNA expression.

[0134] Example 10 A siRNA for Promoting LSR Expression This embodiment provides an siRNA for promoting LSR expression. The nucleotide sequence of the siRNA is designed based on LncRNA-LSR-AS1 (ENST00000685454.2).

[0135] The siRNA sequences are shown in Table 3.

[0136] Table 3 siRNA sequences

[0137] Example 11 Screening of unmodified siRNA for promoting LSR expression This example provides an experiment for screening unmodified siRNAs that promote LSR expression in two human hepatocellular carcinoma cell lines, Hep3B and HepG2, and a primary human liver cell line, HepaRG. To screen for siRNAs that effectively target LncRNA-LSR-AS1, cells were transfected with siRNAs of varying sequences for 48 hours. Total RNA was then harvested and the expression of LncRNA-LSR-AS1 and LSR mRNA was measured by qRT-PCR. Based on Experimental Example 9, steps 1 to 5 were retained, and the LncRNA-LSR-AS1 described in step 1 was replaced with the siRNA described in Experimental Example 11.

[0138] like Figure 12 As shown in Figures A, B, and C, seven groups of siRNA (si-6, si-26, si-43, si-69, si-87, si-131, si-151, si-190, and si-214) all have the effect of promoting the increase in LSR mRNA expression. Among them, the expression level of LSR mRNA in the si-151 group was significantly increased, indicating that si-151 has a more obvious promoting effect on the expression of LSR.

[0139] Example 12 Detection of on-target activity of unmodified siRNA for promoting LSR In Example 8, a lncRNA ENST00000685454.2 (lncRNA-LSR-AS1, SEQ ID NO. 20) was discovered. Inhibiting this lncRNA through siRNA resulted in activation of the LSR. In Example 7, an siRNA, si-151, was discovered that effectively targets the lncRNA-LSR-AS1. After 48 hours of transfection of cells with varying concentrations of si-151, total RNA was harvested and the expression levels of lncRNA-LSR-AS1 and LSR mRNA were measured by qRT-PCR to determine whether si-151 regulates the LSR. Based on Example 9, steps 1 to 5 were retained, with the siRNA described in step 1 replaced by the siRNA described in Example 11.

[0140] like Figure 13 As shown in Figures A, B, and C, among the four concentrations of siRNA si-151, the expression level of LSR mRNA at 1.25 μg / ml was significantly increased; Figure 14 As shown in A, B, and C, among the four concentrations of siRNA si-151, the expression level of LncRNA-LSR-AS1 in the 1.25 μg / ml group was significantly reduced, indicating that 1.25 μg / ml siRNA si-151 has high inhibitory activity.

[0141] Example 13 siRNA promotes LSR protein expression This example provides an experiment to test whether siRNA promotes LSR expression by inhibiting LncRNA-LSR-AS1 in two human liver cancer cell lines, Hep3B cells and HepG2 cells, and a human primary liver cell line, HepaRG cells. Based on Example 9, steps 1 to 5 were retained, and the siRNA described in step 1 was replaced with siRNA si-151 described in Example 12. Based on Example 1, steps 1 and 2 were retained, and total cell protein was then collected for Western blot analysis to detect LSR protein expression. The experimental steps are as follows: Step 3: Protein extraction and BCA quantification After washing the cells with PBS, the residual liquid was aspirated, and an appropriate amount of RIPA lysis buffer and protease inhibitors were added. After the cells were fully lysed on ice, they were centrifuged at 12000 rpm and 4°C for 10 min. The supernatant was collected and the protein concentration of the cell lysate was detected using a BCA kit.

[0142] Step 4: Western Blot detection of LSR protein expression 50 μg of protein was loaded onto the gel and transferred to the membrane. The membrane was blocked with 5% skim milk powder at room temperature for 2 hours, incubated with LSR and β-actin antibodies on a shaker at 4°C overnight, washed three times with PBS, incubated with rabbit antibodies at room temperature for 2 hours, and developed after washing three times with PBS.

[0143] like Figure 15 As shown in Figures A and B, siRNA si-151 significantly increased the expression of LSR protein in human hepatoma cell lines Hep3B cells and HepG2 cells, as well as human primary liver cell line HepaRG cells.

[0144] Example 14 Modified siRNA for Promoting LSR Expression The target gene is located in the liver, and siRNA is known to enter the liver, and targeting in the liver can be enhanced by adding a GalNac conjugate. Therefore, delivery is relatively simple by injecting siRNA into the blood.

[0145] Example 15 Modified siRNA for Promoting LSR Expression This example provides an experiment for screening modified siRNAs that promote LSR expression in human liver cancer cell lines Hep3B and HepG2 cells, and human primary liver cell line HepaRG cells. Based on Example 9, steps 1 to 5 are retained, and the siRNA described in step 1 is replaced with the siRNA (S0) and modified siRNA described in Experimental Example 12. This example provides a modified siRNA for promoting LSR expression. The siRNA modified according to formula (I) includes S1, S2, and S3, wherein formula (I) is as follows: Sense strand: 5'-np-Na-YYY-Nb-nq-3' Antisense strand: 3'-np'-Na'-Y'Y'Y'-Nb'-nq'-5' (I) in: np, np', nq and nq' are 0 to 2 nucleotides respectively; each nucleotide is connected to the adjacent nucleotide through a phosphorothioate bond; Na, Nb, Na' and Nb' each independently represent an oligonucleotide sequence, wherein the oligonucleotide sequence is a sequence comprising 0-25 nucleotides, and the sequence comprises at least one of modified nucleotides and unmodified nucleotides or a combination thereof, and the sequence comprises at least two different types of modified nucleotides; YYY and Y'Y'Y' each independently represent a motif consisting of three consecutive nucleotides, and each nucleotide is modified with the same chemical group.

[0146] The positive strand of S1 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43, wherein np and nq are 0 nucleotides, and from the 5' end to the 3' end, positions 1-9 are Na, positions 10-12 are YYY, positions 13-19 are Nb, nucleotides at positions 7, 8, 10, 11, 12, 14, and 17 are nucleotides modified with 2' methoxy groups, the nucleotides at positions 18 and 19 are connected by a thiophosphate group, and the 3' end is modified with GalNac; the antisense strand of S1 is obtained by chemically modifying the sequence shown in SEQ ID NO. The sequence shown in NO.44 is obtained after chemical modification, wherein np' is 2 nucleotides, nq' is 0 nucleotides, and from the 5' end to the 3' end, positions 1-10 are Na', positions 11-13 are Y'Y'Y', positions 14-21 are Nb', the nucleotides at positions 18 and 19, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotides at positions 1, 2, 5, 7, 11, 12, 13, 17, 19, and 20 are 2'-methoxy-modified nucleotides, and the nucleotide at position 6 is 2'-fluoro-modified nucleotides; The positive strand of S2 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43, wherein np and nq are 0 nucleotides, and from the 5' end to the 3' end, positions 1-8 are Na, positions 9-11 are YYY, and positions 12-19 are Nb. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups. The nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, and 19 are 2'-methoxy-modified nucleotides, the nucleotides at positions 7, 9, 10, and 11 are 2'-fluoro-modified nucleotides, and the 3' end is modified with GalNac. The antisense strand of S2 is obtained by chemically modifying the sequence shown in SEQ ID NO. The sequence shown in NO.44 is obtained after chemical modification, wherein np' is 2 nucleotides, nq' is 0 nucleotides, and from the 5' end to the 3' end, positions 1-7 are Na', positions 8-10 are Y'Y'Y', and positions 11-21 are Nb'. The nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups. The nucleotides at positions 1, 3, 4, 5, 11, 13, 15, 16, 17, 18, 19, 20, and 21 are 2'-methoxy-modified nucleotides, the nucleotides at positions 2, 6, 8, 9, 10, 12, and 14 are 2'-fluoro-modified nucleotides, and position 7 is an ethylene glycol nucleic acid. The positive strand of S3 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43, wherein np and nq are 0 nucleotides, and from the 5' end to the 3' end, positions 1-8 are Na, positions 9-11 are YYY, and positions 12-19 are Nb. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups. The nucleotides at positions 2, 4, 6, 8, 12, 14, 16, and 18 are 2'-methoxy-modified nucleotides, and the nucleotides at positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, and 19 are 2'-fluoro-modified nucleotides. The 3' end is modified with GalNac. The antisense strand of S3 is obtained by chemically modifying the sequence shown in SEQ ID NO. The sequence shown in NO.44 is obtained after chemical modification, wherein np' is 2 nucleotides, nq' is 0 nucleotide, and from the 5' end to the 3' end, positions 1-8 are Na', positions 9-11 are Y'Y'Y', and positions 12-21 are Nb'. The nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups. The nucleotides at positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, 20, and 21 are 2'-methoxy-modified nucleotides, and the nucleotides at positions 2, 4, 6, 8, 12, 14, 16, and 18 are 2'-fluoro-modified nucleotides.

[0147] like Figure 16 As shown in A, B, and C in Figure 3, the GalNac siRNA conjugate S3 significantly increased the expression of LSR mRNA. Figure 17 As shown in Figures A, B, and C, the GalNac siRNA conjugate S3 significantly reduced the expression of LncRNA ENST00000685454.2, indicating that the modified siRNA numbered S3 has high inhibitory activity. Figure 18 As shown in Figures A, B, and C, among the five concentrations of S3, the expression level of LSR mRNA in the 50 nM group increased significantly, indicating that 50 nM S3 has high inhibitory activity.

[0148] Example 16 siRNA promotes cellular uptake of LDL This example provides an siRNA targeting LncRNA-LSR-AS1 to promote cellular uptake of LDL, wherein the siRNA includes si-151 (SEQ ID NO.43 and SEQ ID NO.44).

[0149] Example 17 siRNA promotes cellular uptake of LDL This example provides an assay for detecting siRNA-induced LDL uptake in cells. Based on Example 13, steps 1 and 2 were retained, and in step 2, a 96-well plate was used instead of a 12-well plate. The remaining experimental steps are as follows: Step 3: LDL uptake 1. Aseptically dilute DiI-LDL to 40 mg / ml in culture medium.

[0150] 2. Add the diluted DiI-LDL to a 24-well plate and incubate at 37°C for 5 hours.

[0151] 3. Remove the culture medium containing DiI-LDL.

[0152] 4. Wash cells three times with probe-free medium.

[0153] 5. Fluorescence microplate reader detection, using standard rhodamine excitation, recommended wavelength: excitation: 554 nm, emission: 571 nm.

[0154] like Figure 19 As shown in Figures A, B, and C, S3 significantly increased the uptake of LDL by Hep3B, HepG2, and HepaRG cells.

[0155] Example 18 siRNA Promotes LDL Uptake in Liver Organoids This example provides an assay for detecting the effect of siRNA on LDL uptake in liver organoids. The experimental steps are as follows: Step 1: Culture of human liver organoids The HepatiCult™ Organoid Kit (Human) from STEMCELL Technologies was used according to the manufacturer's instructions. Patient liver tissue was washed, digested, and centrifuged to obtain a cell suspension. This cell suspension was mixed with Matrigel and seeded onto 24-well plates. The medium was regularly changed during culture, and organoid growth was monitored. On day 13 of culture, organoids were mechanically dissociated from Matrigel and replated onto 24-well plates.

[0156] Step 2: LDL uptake 1. The LDL uptake capacity of liver organoids was measured after treatment with 50 nM S3 for 48 hours.

[0157] 2. Aseptically dilute DiI-LDL to 40 mg / ml in culture medium.

[0158] 3. Add the diluted DiI-LDL to a 24-well plate and incubate at 37°C for 5 hours.

[0159] 4. Remove the culture medium containing DiI-LDL.

[0160] 5. Wash cells three times with probe-free medium.

[0161] 6. Fluorescence microplate reader detection, using standard rhodamine excitation, recommended wavelength: excitation: 554 nm, emission: 571 nm.

[0162] like Figure 20 As shown, S3 significantly increased the uptake of LDL in liver organoids.

[0163] Example 19 siRNA Promotes LDL Uptake Ability of LDLR Knockout Cells This example provides a detection experiment for siRNA to promote cellular uptake of LDL. Based on Example 17, LDLR gene knockout HepG2, Hep3B and HepaRG cells were used to replace wild-type HepG2, Hep3B and HepaRG cells.

[0164] like Figure 21 As shown in Figures A, B, and C, the LDL uptake capacity of LDLR knockout cells was significantly increased after S3 treatment, but there was no significant change in the PCSK9 siRNA treatment group compared with the control group.

[0165] in addition, Figure 21 Figures A, B, and C show that siRNA si-151 increased LDL uptake in Hep3B, HepG2, and HepaRG cells by 46%, while Incisiran siRNA promoted LDL uptake in these three cell types by 6%. This suggests that si-151's effect on promoting LDL uptake in LDLR-knockout hepatocytes is significantly greater than that of Incisiran, a marketed siRNA drug targeting PCSK9.

[0166] Example 20 LSR significantly reduces the concentration of very low density lipoprotein (vLDL) in serum In this example, an animal model was constructed according to step 1 of Example 2, Example 3, and Example 5.

[0167] Step 2: Detection of T-CHO, TG and LDL in serum The concentration of vLDL in the serum of each group of mice was determined using a commercial kit according to the manufacturer's instructions. vLDL detection kit (H249-1-2, Nanjing Jiancheng Bioengineering Institute) was used.

[0168] like Figure 22As shown in Figures A, B, and C, in the C57BL / 6 mouse high-fat model, LDLR knockout mice fed a high-fat diet, and LDLR heterozygous mice fed a high-fat diet, the concentration of vLDL in the serum of the AAV-LSR group mice was significantly decreased compared with that of the AAV-CTL group mice, indicating that LSR can effectively reduce the concentration of vLDL in the body's serum.

[0169] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A targeted siRNA, characterized in that The targeted siRNA can specifically bind to LncRNA-LSR-AS1, induce its degradation or inhibit its expression, thereby reducing the level of LncRNA-LSR-AS1, wherein the LncRNA-LSR-AS1 is a LncRNA with a sequence as shown in SEQ ID NO.

20.

2. The targeted siRNA according to claim 1, wherein The targeting siRNA is a double-stranded RNA of 17 to 25 nucleotides, and the sense strand sequence is as follows: (a1) having a nucleotide sequence as shown in SEQ ID NO. X, where X is an odd number ranging from 27 to 55; (a2) a nucleotide sequence having at least 90% identity with the nucleotide sequence described in (a1) or at least 15 consecutive nucleotides; (a3) a nucleotide sequence that is at least 70% identical to the nucleotide sequence described in (a1) and retains the biological function of the sequence from which it is derived; The antisense strand sequence is as follows: (b1) having a nucleotide sequence as shown in SEQ ID NO. (X+1), where X is an odd number ranging from 27 to 55; (b2) a nucleotide sequence having at least 90% identity with the nucleotide sequence described in (b1) or at least 15 consecutive nucleotides; (b3) A nucleotide sequence that is at least 70% identical to the nucleotide sequence described in (b1) and retains the biological function of the sequence from which it is derived.

3. The targeted siRNA according to claim 2, wherein X is 27, 29, 31, 33, 35, 39, 43, 49 or 51.

4. The targeted siRNA according to claim 1, wherein The sense strand sequence has the nucleotide sequence shown in SEQ ID NO.43; Alternatively, the antisense strand sequence has the nucleotide sequence shown in SEQ ID NO.

44.

5. A modified siRNA, characterized in that: The target siRNA is obtained by chemically modifying the sense strand and / or antisense strand of the target siRNA according to any one of claims 1 to 4.

6. The modified siRNA according to claim 5, wherein: Represented by formula (I): Sense strand: 5'-np-Na-YYY-Nb-nq-3' Antisense strand: 3'-np'-Na'-Y'Y'Y'-Nb'-nq'-5' (I) in: np, np', nq, and nq' are 0 to 2 nucleotides, respectively; Na, Nb, Na' and Nb' each independently represent an oligonucleotide sequence, wherein the oligonucleotide sequence is a sequence comprising 0-25 nucleotides, and the sequence comprises at least two different types of modified nucleotides; YYY and Y'Y'Y' each independently represent a motif consisting of three consecutive nucleotides, and each nucleotide is modified with the same chemical group.

7. The modified siRNA according to claim 6, wherein: The YYY motif occurs at or near the cleavage site on the sense strand.

8. The modified siRNA according to claim 5, wherein: The chemical modification is a chemically modified nucleotide, and the chemically modified nucleotide is any one or more of a methoxy-modified nucleotide, a methoxyethyl-modified nucleotide, an aminopropyl-modified nucleotide, a dimethylaminoethyl-modified nucleotide, an amino-modified nucleotide, an azide-modified nucleotide, an alkyl-modified nucleotide, an F-arabinose-modified nucleotide, an allyl-modified nucleotide, a fluorine-modified nucleotide, a deoxynucleotide, a hydroxyl-modified nucleotide, a thiophosphate-modified nucleotide, an abasic nucleotide, a morpholino nucleotide, and a locked nucleotide.

9. The modified siRNA according to claim 5, characterized in that: Chemical modifications include ribose modifications, which include any one or more of methoxy modification, fluoro modification, methoxyethyl modification, locked nucleic acid modification, deoxy modification, amino modification, morpholino modification, aminopropyl modification, dimethylaminoethyl modification, azido modification, allyl modification, alkyl modification, alkoxy modification, and F-arabinose modification.

10. The modified siRNA according to claim 5, wherein: Chemical modifications include backbone modifications, including phosphorothioate modifications, phosphorodithioate modifications, methylphosphonate modifications, methoxypropylphosphonate modifications, boranophosphate modifications, fluorophosphate modifications, or aminophosphonate modifications.

11. The modified siRNA according to claim 5, wherein: Chemical modifications include base modifications, which include methyl modification, halogenation modification, alkynyl modification, fluoro modification, thio modification, azido modification, and amino modification.

12. A siRNA conjugate, characterized in that: The target siRNA is obtained by coupling the targeted siRNA according to any one of claims 1 to 4 or the modified siRNA according to any one of claims 5 to 11 with a pharmaceutically acceptable targeting group.

13. The siRNA conjugate according to claim 12, characterized in that: The pharmaceutically acceptable targeting group is galactose or N-acetylgalactosamine; and / or, the pharmaceutically acceptable targeting group is linked to the 3' end or 5' end of the sense strand of the siRNA.

14. A composition characterized in that: The invention comprises the targeted siRNA according to any one of claims 1 to 4, the modified siRNA according to any one of claims 5 to 11, or the conjugate of the siRNA according to claim 12 or 13, and excipients.

15. The composition according to claim 14, wherein The excipient is a carrier and / or excipient, wherein the carrier is one or more of a buffer solution, physiological saline, lipid nanoparticles, polymer nanoparticles, and inorganic nanoparticles; and the excipient is one or more of a diluent, a filler, a binder, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, and a lubricant.

16. The composition according to claim 14, wherein The composition is in the form of tablets, capsules, powders, pills, granules, solutions, suspensions, syrups, injections, suppositories, inhalants or sprays.

17. The composition according to claim 14, wherein The weight content of the targeted siRNA, siRNA modification or siRNA conjugate in the composition is 1%-99%.

18. Any of the following uses of the targeted siRNA according to any one of claims 1 to 4, the modified siRNA according to any one of claims 5 to 11, the siRNA conjugate according to claim 12 or 13, or the composition according to any one of claims 14 to 17: (c1) Application in the preparation of a preparation for promoting LSR expression; (c2) Use in the preparation of a preparation for improving the ability of hepatocytes to take up low-density lipoprotein; (c3) Preparation for use in preventing and / or treating hyperlipidemia; (c4) Preparation for use in preventing and / or treating hyperlipidemia-related diseases.

19. The use according to claim 18, characterized in that: Hyperlipidemia includes primary hyperlipidemia or secondary hyperlipidemia; Alternatively, hyperlipidemia-related diseases include one or more of cardiovascular system diseases, cerebrovascular diseases, acute pancreatitis, peripheral vascular diseases, non-alcoholic fatty liver disease, hyperfatty acidemia, obesity, and metabolic-related diseases.

20. The use according to claim 18, characterized in that: The hyperlipidemia includes heterozygous familial hypercholesterolemia or homozygous familial hypercholesterolemia.

21. Use of LncRNA-LSR-AS1 as a target in screening products for preventing and / or treating hyperlipidemia or its related diseases, wherein the LncRNA-LSR-AS1 is the LncRNA with the sequence shown in SEQ ID NO.

20.

22. The use according to claim 21, characterized in that: LncRNA-LSR-AS1, as the antisense long noncoding RNA of the LSR gene, inhibits LSR protein expression and affects lipid metabolism by targeting the 3'UTR region of LSR mRNA; inhibiting the expression of LncRNA-LSR-AS1 or its binding activity to the 3'UTR of LSR mRNA can relieve the inhibition of LSR expression and promote LSR expression.

23. Any of the following uses of an agent that inhibits LncRNA-LSR-AS1 expression; (d1) Use in the preparation of drugs for preventing and / or treating hyperlipidemia or its related diseases; (d2) Application in the preparation of a preparation for promoting LSR gene expression; (d3) Use in the preparation of a preparation for improving the ability of hepatocytes to take up low-density lipoprotein; in, The LncRNA-LSR-AS1 is a LncRNA with a sequence as shown in SEQ ID NO.

20.

24. The use according to claim 23, characterized in that: The reagent for inhibiting LncRNA-LSR-AS1 expression is an antisense oligonucleotide, a modified antisense oligonucleotide, a conjugate of an antisense oligonucleotide, a polypeptide, a protein, a small molecule inhibitor, siRNA, a modified siRNA or a conjugate of siRNA.

25. Use of the LSR gene and / or its protein, a downstream target gene of lncRNA-LSR-AS1, as a target for screening products for preventing and / or treating hyperlipidemia or related diseases, wherein the mRNA sequence of LSR is as shown in any one of SEQ ID NOs. 1-19, and lncRNA-LSR-AS1 is the lncRNA with the sequence shown in SEQ ID NO.

20.

26. The use according to claim 25, wherein the product is one or more of a eukaryotic expression plasmid, adenovirus, adeno-associated virus, lentivirus, retrovirus, LNP liposome, gene editing system element, homologous recombination vector, ASO, ASO modification, ASO conjugate, small molecule inhibitor, siRNA, siRNA modification or siRNA conjugate.

27. The use according to claim 25, characterized in that: Promoting the expression of LSR genes and / or proteins can lower blood lipid levels; inhibiting the expression of LSR genes and / or proteins can increase blood lipid levels, thereby screening products for preventing and / or treating hyperlipidemia or its related diseases.

28. Any of the following uses of the downstream target molecule LSR of lncRNA-LSR-AS1 or an agent that promotes the expression of the downstream target molecule LSR of lncRNA-LSR-AS1; (e1) Use in the preparation of drugs for preventing and / or treating hyperlipidemia or its related diseases; (e2) Use in the preparation of a preparation for improving the ability of hepatocytes to take up low-density lipoprotein; (e3) Use in the preparation of a preparation for reducing lipid deposition in liver tissue; in, The mRNA sequence of the downstream target molecule LSR of lncRNA-LSR-AS1 is shown in any one of SEQ ID NOs. 1-19, and lncRNA-LSR-AS1 is a lncRNA with a sequence shown in SEQ ID NO. 20.

Images