RNAi reagents for inhibiting pcsk9 expression, pharmaceutical compositions and methods of use thereof

Abstract

The present disclosure relates to RNAi agents, e.g., double-stranded RNAi agents, e.g., small interfering RNA (siRNA) molecules, capable of inhibiting the expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene. Pharmaceutical compositions comprising the PCSK9 RNAi agent and methods of using the same are also disclosed. In some embodiments, the PCSK9 RNAi agents disclosed herein can be conjugated to targeting ligands, including ligands comprising N-acetyl-galactosamine, to facilitate delivery to hepatocytes. In vivo delivery of the PCSK9 RNAi agent provides inhibition of expression of the PCSK9 gene, and thus reduction of the PCSK9 protein. RNAi agents may be used in methods of treating diseases or conditions mediated at least in part by PCSK9 gene expression, said diseases or conditions include, inter alia, hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial low beta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygene dyslipidemia, heart disease, cardiovascular disease (CVD) comprising clinical atherosclerotic cardiovascular diseases (ASCVD).

Description

[0001] Cross-reference to related applications This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 487,899, filed March 2, 2023, the contents of which are incorporated herein by reference in their entirety.

[0002] sequence list This application contains a sequence list (compliant with standard ST26) that has been submitted in XML format and is incorporated herein by reference in its entirety. The XML sequence list file is named 30708-WO_SeqListing.xml, was created on February 27, 2024, and has a size of 1581 kb. Invention Field

[0003] This disclosure relates to RNA interference (RNAi) agents, such as double-stranded RNAi agents, for inhibiting the expression of the proprotein convertase subtilisin kexin 9 (PCSK9) gene, pharmaceutical compositions including PCSK9 RNAi agents, and methods of using them for treating PCSK9-related diseases and conditions. Background of the Invention The proprotein convertase subtilisin kexin 9, or PCSK9, is a key player in plasma cholesterol metabolism and has been identified by scientists in academia and industry as a target for the treatment of hypercholesterolemia (Peterson et al., J Lipid Res. 2008). Low-density lipoprotein (LDL) is the main transporter of cholesterol in the bloodstream. LDL-cholesterol (LDL-C) is normally cleared from the bloodstream via receptor-mediated endocytosis in the liver via LDL receptors (Horton et al., 2006). Maintaining adequate levels of LDL receptors is crucial for preventing LDL-C accumulation, as excessively high levels of LDL-C in the blood (hypercholesterolemia) and tissues are associated with the development of atherosclerotic plaques and cardiovascular disease (Horton et al., 2006; Klein-Szanto & Bassi, 2019). Mutations in LDL receptors, or mutations affecting LDL binding to receptors, have been shown to contribute to hypercholesterolemia. In addition, gain-of-function mutations in PCSK9 have been found to increase LDL levels by promoting the degradation of LDL receptors, while loss-of-function mutations lead to hypocholesterolemia and significantly reduce the risk of coronary heart disease (Horton et al., 2006; Klein-Szanto & Bassi, 2019).

[0005] Therefore, PCSK9 has become a therapeutic target for cholesterol-lowering therapies. Statins that increase LDL receptor expression and antibody therapies that inhibit PCSK9 are already on the market, but some patients have experienced tolerability issues that prevent their use as effective treatments. Various small molecule inhibitors of PCSK9, as well as inhibitors that block LDL receptor binding, are in clinical development, and small interfering RNA (siRNA) specific to PCSK9 mRNA has recently been approved in the UK and the US, but these drugs also have certain drawbacks. Given the role of PCSK9 in controlling plasma LDL levels and the severity of disease when hypercholesterolemia is uncontrolled, further development of additional inhibitory therapies could provide the necessary options to improve cardiovascular health in patients with elevated LDL-C. Invention Overview This article discloses a novel RNAi reagent for inhibiting PCSK9 gene expression.

[0007] In some implementations, the PCSK9 RNAi reagent comprises: The antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of the antisense strand sequences in Table 2, and A sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand. The antisense strand and / or sense strand, wherein all or substantially all nucleotides are modified nucleotides, and wherein the RNAi reagent is linked to a targeting ligand comprising N-acetyl-galactosamine.

[0008] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 adjacent nucleotides that differs from the 15 adjacent nucleotides of any sense strand sequence in Tables 2, 4, 5C, 7B, or 8 by 0 or 1 nucleotide, and wherein the sense strand has a region on the 15 adjacent nucleotides that is at least 85% complementary to the antisense strand.

[0009] In some implementations, at least one nucleotide of the RNAi reagent comprises a modified internucleotide bond.

[0010] In some embodiments, the modified nucleotides of the PCSK9 RNAi reagent disclosed herein are selected from: 2′-O-methyl nucleotides, 2′-fluoronucleotides (also known as 2′-deoxy-2′-fluoronucleotides), 2′-deoxynucleotides, 2′,3′-seco nucleotide mimics (also known as unlocked nucleotides or UNA), locked nucleotides, 2′-F-arabinonucleotides, 2′-methoxyethyl nucleotides, debased nucleotides, ribitol, reverse nucleotides, reverse 2′-O-methyl nucleotides, reverse 2′-deoxy nucleotides, 2′-amino-modified nucleotides, 2′-alkyl-modified nucleotides, morpholinonucleotides, nucleotides containing 5′-vinylphosphonate, nucleotides containing 5′-cyclopropylphosphonate, and 3′-O-methyl nucleotides.

[0011] In other embodiments, all or substantially all modified nucleotides of the RNAi reagents disclosed herein are 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.

[0012] In some implementations, the 5' end of the antisense strand includes 5'-cyclopropylphosphonate-2'-O-methylnucleotide.

[0013] In some implementations, the antisense strand consists of, is substantially composed of, or contains any of the modified antisense strand sequences in Table 3.

[0014] In some implementations, the sense strand consists of, is substantially composed of, or contains any of the modified sense strand sequences in Table 4.

[0015] In some implementations, the antisense strand contains the nucleotide sequence of any of the modified sequences in Table 3, and the sense strand contains the nucleotide sequence of any of the modified sequences in Table 4.

[0016] The RNAi reagent disclosed herein is linked to a targeting ligand comprising N-acetyl-galactosamine. In a further embodiment, the targeting ligand is linked to the sense strand. In some embodiments, the targeting ligand is linked to the 5' end of the sense strand.

[0017] In some embodiments, the sense strand is 15 to 30 nucleotides long, and the antisense strand is 21 to 30 nucleotides long. In other embodiments, the sense strand and antisense strand are each 21 to 27 nucleotides long. In still other embodiments, the sense strand and antisense strand are each 21 to 24 nucleotides long. In yet another embodiment, the sense strand and antisense strand are each 21 nucleotides long.

[0018] In some implementations, the RNAi reagent has two blunt ends.

[0019] In some embodiments, the sense chain includes one or two terminal caps. In other embodiments, the sense chain includes one or two reverse debasing residues.

[0020] In some embodiments, the RNAi reagent consists of a sense strand and an antisense strand, which form a double-stranded sequence of the double-stranded structure shown in Tables 5A, 5B, 5C or 8.

[0021] In some embodiments, the sense strand further includes a reverse debasement residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or at both.

[0022] In some implementations, the targeting ligand comprises: ,or .

[0023] In a further embodiment, the targeting ligand is linked to the sense strand of the RNAi reagent via a phosphodiester or thiophosphate bond, and comprises or consists of the following: ,or .

[0024] In some embodiments, the PCSK9 RNAi reagent comprises an antisense strand and a sense strand, wherein the antisense strand comprises or is composed of the nucleotide sequence of SEQ ID NO:401, and the sense strand comprises or is composed of the nucleotide sequence of SEQ ID NO:430.

[0025] In some embodiments, the PCSK9 RNAi reagent comprises a modified antisense strand and a modified sense strand, wherein the modified antisense strand comprises or is composed of the nucleotide sequence of SEQ ID NO:309, and the modified sense strand comprises or is composed of the nucleotide sequence of SEQ ID NO:368.

[0026] This document also discloses compositions comprising the disclosed RNAi reagent, wherein the compositions further comprise pharmaceutically acceptable excipients.

[0027] In addition, this article also provides a method for inhibiting PCSK9 gene expression in hepatocytes of human subjects in vivo, the method comprising introducing an effective amount of the disclosed PCSK9 RNAi reagent or the disclosed composition into the subject.

[0028] This article further provides a method for treating PCSK9-related diseases, conditions, or symptoms, comprising administering a therapeutically effective amount of the disclosed composition to a subject in need of such treatment.

[0029] In some implementations, the diseases include hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypoβ-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases.

[0030] In some embodiments, the RNAi reagent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject weight. In some embodiments, the PCSK9 RNAi reagent disclosed herein is administered as a single injection of a fixed dose containing about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, or about 400 mg of PCSK9 RNAi reagent active pharmaceutical ingredient, as described in Table 8.

[0031] This article also provides the use of the disclosed RNAi reagents or compositions for the treatment of diseases, conditions, or symptoms at least partially mediated by PCSK9 gene expression.

[0032] This document further provides the use of the disclosed RNAi reagents or compositions for the preparation of pharmaceutical compositions for the treatment of diseases, conditions, or symptoms at least partially mediated by PCSK9 gene expression. Brief description of the attached diagram Figure 1A-1D The chemical structure of PCSK9 RNAi reagent AD09327, shown as a free acid, is represented, wherein the targeting ligands (NAG37) are linked to the 5' end of the sense strand (SEQ ID PAIR NO: 309 / 368).

[0034] Figures 2A-2D The chemical structure of PCSK9 RNAi reagent AD09327, shown as a sodium salt, is represented, wherein the targeting ligands (NAG37) are linked to the 5' end of the sense strand (SEQ ID PAIR NO: 309 / 368). Invention Details The disclosed RNAi reagents, their compositions, and methods of use can be more readily understood by referring to the following detailed description, which forms part of this disclosure. It should be understood that this disclosure is not limited to what is specifically described and / or shown herein, and the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting.

[0036] It should be understood that, although for clarity, certain features of this disclosure included herein are described in the context of separate embodiments, they may also be provided in combination in a single embodiment. Conversely, for brevity, the various features of the disclosed methods described in the context of a single embodiment may also be provided separately or in any sub-combination.

[0037] definition As used herein, “RNAi reagent” means a chemical composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting (e.g., under appropriate conditions, degrading or inhibiting) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. As used herein, RNAi reagents may act through RNA interference mechanisms (i.e., by inducing RNA interference through interaction with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanism or pathway. Although it is considered that RNAi reagents act primarily through RNA interference mechanisms as used herein, the disclosed RNAi reagents are not bound to or limited to any particular pathway or mechanism of action. The RNAi reagents disclosed herein consist of sense and antisense strands and include, but are not limited to, small (or short) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi reagent described herein is at least partially complementary to the target mRNA (i.e., PCSK9 mRNA). The RNAi reagent may include one or more modified nucleotides and / or one or more non-phosphodiester bonds.

[0038] As used herein, when referring to the expression of a given gene, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” mean, as measured by the level of RNA transcribed from the gene, or the level of polypeptide, protein, or protein subunit translated from mRNA, in a cell, cell population, tissue, organ, or subject in which the gene is transcribed, when the cell, cell population, tissue, organ, or subject is treated with the RNAi reagent described herein, the expression of the gene is reduced compared to a second cell, cell population, tissue, organ, or subject who has not been treated in this way.

[0039] As used herein, the terms "sequence" and "nucleotide sequence" refer to a sequence of nucleobases or nucleotides described by consecutive letters using standard nomenclature. A nucleotide sequence may contain unmodified and / or modified nucleotides. Oligonucleotides or nucleic acid molecules may contain unmodified and / or modified nucleotides.

[0040] As used herein, “base,” “nucleotide base,” or “nucleobase” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes primary purine bases adenine and guanine, and primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed., Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphorous amide compounds containing modified nucleobases) is known in the art.

[0041] As used herein, the term "nucleotide" has the same meaning as commonly understood in the art. Therefore, as used herein, the term "nucleotide" refers to a glycoside comprising a sugar moiety, a base moiety, and a covalently linked group (bonding group), such as a phosphate ester or thiophosphate ester nucleoside bond, and encompasses naturally occurring nucleotides, such as DNA or RNA, as well as non-naturally occurring nucleotides comprising modified sugar and / or base moieties, the latter also referred to herein as nucleotide analogs. In this document, a single nucleotide may be referred to as a monomer or unit.

[0042] As used herein, and unless otherwise stated, when used to describe a first nucleobase or nucleotide sequence (e.g., a sense strand or targeting mRNA of an RNAi reagent) relating to a second nucleobase or nucleotide sequence (e.g., an antisense strand or single-stranded antisense oligonucleotide of an RNAi reagent), the term "complementary" means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (forming base-pairing hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions) under certain standard conditions and to form a double-stranded or double-helical structure. Those skilled in the art will be able to select the set of conditions most appropriate for the hybridization assay. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and, at least to the extent that the hybridization requirements described above are satisfied, include native or modified nucleotides or nucleotide mimics. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af, as defined herein, are complementary to U (or T) and identical to A.

[0043] As used herein, “completely complementary” or “perfectly complementary” means that in a hybridization pair of nucleobase or nucleotide sequences, all (100%) bases in the adjacent sequence of the first oligonucleotide hybridize with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0044] As used herein, "partially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 70% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridizes with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0045] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 85% but not all of the bases in the adjacent sequence of the first oligonucleotide hybridizes with the same number of bases in the adjacent sequence of the second oligonucleotide. The adjacent sequence may contain all or part of the first or second nucleotide sequence.

[0046] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” refer to the nucleobase or nucleotide matching between the sense and antisense strands of the RNAi reagent, or between the antisense strand of the RNAi reagent and the PCSK9 mRNA sequence.

[0047] As used herein, when applied to nucleic acid sequences, the terms "substantially identical" or "substantially identical" mean that a nucleotide sequence (or a portion thereof) has at least about 85% sequence identity or more, such as at least 90%, at least 95%, or at least 99%, compared to a reference sequence. The percentage of sequence identity is determined by comparing two best-aligned sequences within a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same type of nucleic acid base appears below them to arrive at the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein covers nucleotide sequences substantially identical to the nucleotide sequences disclosed herein.

[0048] As used herein, the terms “individual,” “patient,” and “subject” are used interchangeably to refer to a member of any animal species, including but not limited to birds, humans and other primates, and other mammals including commercially relevant mammals or animal models such as mice, rats, monkeys, cattle, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0049] As used herein, the terms “treat,” “treatment,” etc., refer to a method or procedure taken to provide relief or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject. As used herein, “treat” and “treatment” may include prevention, management, preventive treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more disease symptoms in a subject.

[0050] As used herein, “PCSK9-related disease or condition” includes any disease or condition that can be treated with PCSK9 RNAi reagents (i.e., a reduction in PCSK9 gene expression and therefore a reduction in the amount of PCSK9 protein found in cells or tissues that can provide a therapeutic benefit to the subject), including but not limited to hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobeta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), or any other disease or condition in which a reduction in low-density lipoprotein cholesterol (LDL-C) is desired or would benefit the subject or patient.

[0051] As used herein, when referring to RNAi reagents, the phrase “introduced into cells” means the functional delivery of the RNAi reagent into cells. The phrase “functional delivery” means the delivery of the RNAi reagent into cells in a manner that enables it to have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0052] Unless otherwise stated, symbols are used as in this document. The use of "it" means that any one or more groups may be attached to it within the scope of the invention as described herein.

[0053] As used herein, the term "isomer" refers to a compound that has the same molecular formula but differs in the bonding order or properties of its atoms or in the spatial arrangement of its atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are non-overlapping mirror images are called "enantiomers," or sometimes optical isomers. The carbon atom bonded to four different substituents is called a "chiral center."

[0054] As used herein, for each structure in which an asymmetry center is present, and thus produces enantiomers, diastereomers, or other stereoisomers, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms, unless specifically identified in the structure as having a particular conformation. For example, the structures disclosed herein are intended to cover mixtures of diastereomers and single stereoisomers.

[0055] As used in the claims herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps, and those materials or steps that do not substantially affect the essential and novel features of the invention.

[0056] It will be readily understood and appreciated by those skilled in the art that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed contemplate certain functional groups, such as OH, SH, or NH, which may be protonated or deprotonated. As will be readily understood by those skilled in the art, the disclosure herein is intended to cover the disclosed compounds and compositions regardless of their protonated state based on the environment (e.g., pH). Accordingly, compounds described herein having unstable protons or basic atoms should also be understood to represent salt forms of the respective compounds. The compounds described herein may be in the form of free acids, free bases, or salts. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of this invention.

[0057] As used herein, when referring to a connection between two compounds or molecules, the terms “connected” or “combined” mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, as used herein, the terms “connected” and “combined” may refer to a connection between a first compound and a second compound, with or without any intermediate atoms or groups of atoms.

[0058] As used herein, the term “including” is used to mean the phrase “including but not limited to” and is interchangeable with the phrase “including but not limited to”. Unless the context clearly indicates otherwise, the term “or” is used herein to mean the term “and / or” and is interchangeable with the term “and / or”.

[0059] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While suitable methods and materials are described below, similar or equivalent methods and materials may be used in the practice or testing of this invention. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the definitions included in this specification shall prevail. Furthermore, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0060] When values ​​are explicitly stated, it should be understood that values ​​of approximately the same quantity or amount as the stated value are also within the scope of this disclosure. When a combination is disclosed, each element sub-combination of that combination is also specifically disclosed and within the scope of this disclosure. Conversely, when different elements or groups of elements are disclosed individually, their combinations are also disclosed. When any element of this disclosure is disclosed as having multiple alternatives, examples of such disclosure in which each alternative is excluded individually or in any combination with other alternatives are also disclosed; more than one element of this disclosure may have such exclusions, and all combinations of elements having such exclusions are disclosed herein.

[0061] Other objects, features, aspects, and advantages of the invention will become apparent from the following detailed description, accompanying drawings, and claims.

[0062] RNAi reagents This document describes RNAi reagents for inhibiting PCSK9 gene expression. Each PCSK9 RNAi reagent comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 18 to 49 nucleotides in length. The sense strand and antisense strand can be the same length, or they can be different lengths. In some embodiments, the sense strand and antisense strand are each independently 21 to 27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 to 24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length, and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 nucleotides in length. In some embodiments, the antisense strand of the RNAi reagent is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, the sense strand of the RNAi reagent is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides long. The sense and antisense strands are annealed to form a double strand, and in some embodiments, the double-stranded RNAi reagent has a double strand length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0063] Examples of nucleotide sequences for forming the PCSK9 RNAi reagent are provided in Tables 2, 3, 4, 5C, 7A, 7B, and 8. Examples of duplexes of the RNAi reagent, including the sense and antisense sequences in Tables 2, 3, 4, 5C, 7A, and 7B, are shown in Tables 5A, 5B, 5C, and 8.

[0064] In some embodiments, the length of the region of complete complementarity, substantial complementarity, or partial complementarity between the sense and antisense strands is 15-26 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) and is located at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides, which are incompletely complementary, substantially complementary, or partially complementary).

[0065] The sense strand of the PCSK9 RNAi reagent described herein comprises at least 15 consecutive nucleotides and has at least 85% identity with the core sequence (also referred to herein as the "core" or "core sequence") of the same number of nucleotides in the PCSK9 mRNA. In some embodiments, the sense core sequence is 100% (perfectly) complementary to or at least about 85% (substantially) complementary to the core sequence in the antisense strand, and therefore, the sense core sequence is typically identical or at least about 85% identical to a nucleotide sequence of the same length present in the PCSK9 mRNA target (sometimes referred to, for example, as the target sequence). In some embodiments, the length of the sense core is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense core is 17 nucleotides. In some embodiments, the length of the sense core is 19 nucleotides. In some embodiments, the length of the sense core is 21 nucleotides.

[0066] The antisense strand of the PCSK9 RNAi reagent described herein comprises at least 15 consecutive nucleotides, which is at least 85% complementary to the core segment of the same number of nucleotides in the PCSK9 mRNA and the core segment of the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (completely) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the PCSK9 mRNA target (e.g., the target sequence). In some embodiments, the length of the antisense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the antisense strand core segment is 21 nucleotides. In some embodiments, the length of the antisense strand core segment is 19 nucleotides. The sense strand core segment sequence may be the same length as the corresponding antisense core sequence, or it may be a different length.

[0067] The sense and antisense strands of the PCSK9 RNAi reagent are annealed to form a double helix. The sense and antisense strands of the PCSK9 RNAi reagent can be partially, substantially, or completely complementary to each other. Within the complementary double helix region, the sense core sequence is at least 85% or 100% complementary to the antisense core sequence. In some implementations, the sense core sequence contains a sequence of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, which is at least 85% or 100% complementary to the corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides of the antisense core sequence (i.e., the sense and antisense core sequences of the PCSK9 RNAi reagent have regions of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, which are at least 85% or 100% base-paired).

[0068] In some embodiments, the antisense strand of the PCSK9 RNAi reagent disclosed herein differs from any antisense strand sequence in Tables 2, 3, 5C, 7A, or 8 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the PCSK9 RNAi reagent disclosed herein differs from any sense strand sequence in Tables 2, 4, 5C, 7B, or 8 by 0, 1, 2, or 3 nucleotides.

[0069] In some embodiments, the sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, 5' end, or both 3' and 5' ends of the core sequence. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding sequence in the PCSK9 mRNA. The additional nucleotides of the sense strand (if present) may be identical or different from the corresponding sequence in the PCSK9 mRNA. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding additional nucleotides of the sense strand (if present).

[0070] As used herein, the extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core sequence and / or antisense strand core sequence. The extended nucleotides on the sense strand may or may not be complementary to the corresponding nucleotides in the antisense strand (or core sequence nucleotides or extended nucleotides). Conversely, the extended nucleotides on the antisense strand may or may not be complementary to the corresponding nucleotides in the sense strand (or core sequence nucleotides or extended nucleotides). In some embodiments, both the sense and antisense strands of the RNAi reagent contain 3' and 5' extensions. In some embodiments, one or more 3' extended nucleotides of one strand are base-paired with one or more 5' extended nucleotides of the other strand. In other embodiments, one or more 3' extended nucleotides of one strand are not base-paired with one or more 5' extended nucleotides of the other strand. In some embodiments, the PCSK9 RNAi reagent has an antisense strand containing a 3' extension and a sense strand containing a 5' extension. In some embodiments, the extended nucleotides are unpaired and form overhangs. As used herein and in the art, "protruding end" refers to an extension of one or more unpaired nucleotide segments located at the terminal end of the sense or antisense strand that does not form part of the hybrid or double-stranded portion of the RNAi reagent disclosed herein.

[0071] In some embodiments, the PCSK9 RNAi reagent comprises a 3' extended antisense strand having a length of 1, 2, 3, 4, 5, or 6 nucleotides. In other embodiments, the PCSK9 RNAi reagent comprises a 3' extended antisense strand having a length of 1, 2, or 3 nucleotides. In some embodiments, one or more antisense extended nucleotides comprise nucleotides complementary to the corresponding PCSK9 mRNA sequence. In some embodiments, one or more antisense extended nucleotides comprise nucleotides not complementary to the corresponding PCSK9 mRNA sequence.

[0072] In some embodiments, the PCSK9 RNAi reagent comprises a 3' extended sense strand having a length of 1, 2, 3, 4, or 5 nucleotides. In some embodiments, one or more sense strand extending nucleotides comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the PCSK9 mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0073] The sense strand may have a 3′ extension and / or a 5′ extension. In some embodiments, the PCSK9 RNAi reagent comprises a sense strand with a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the PCSK9 mRNA sequence.

[0074] Examples of sequences for forming PCSK9 RNAi reagents are provided in Tables 2, 3, 4, 5C, 7A, 7B, and 8. In some embodiments, the antisense strand of the PCSK9 RNAi reagent comprises any sequence from Tables 2, 3, 5C, 7A, or 8. In some embodiments, the antisense strand of the PCSK9 RNAi reagent contains, or is composed of, any of the modified sequences in Table 3. In some embodiments, the antisense strand of the PCSK9 RNAi reagent comprises the nucleotides (5' end) of any sequence from Tables 2, 3, 5C, 7A, or 8. The 3' end) sequence is 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21. In some embodiments, the sense strand of the PCSK9 RNAi reagent comprises any sequence from Tables 2, 4, 5C, 7B, or 8. In some embodiments, the sense strand of the PCSK9 RNAi reagent comprises any nucleotide (5' end) from Tables 2, 4, 5C, 7B, or 8. (3' end) Sequences of 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21. In some embodiments, the sense strand of the PCSK9 RNAi reagent contains, or is composed of, any of the modified sequences in Table 4.

[0075] In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, both ends of the RNAi reagent form blunt ends. In some embodiments, neither end of the RNAi reagent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi reagent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).

[0076] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi reagent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi reagent form a frayed end. In some embodiments, both ends of the RNAi reagent form frayed ends. In some embodiments, neither end of the RNAi reagent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi reagent where the terminal nucleotides of the two annealed strands form a pair (i.e., no overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi reagent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating a 3' or 5' overhang. In some implementations, the RNAi reagent contains: a blunt end and a folded end, a blunt end and a 5' protrusion, a blunt end and a 3' protrusion, a folded end and a 5' protrusion, a folded end and a 3' protrusion, two 5' protrusions, two 3' protrusions, a 5' protrusion and a 3' protrusion, two folded ends, or two blunt ends. Typically, when present, the protrusions are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0077] The PCSK9 RNAi reagent disclosed herein may also consist of one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the PCSK9 RNAi reagent are modified nucleotides. The PCSK9 RNAi reagent disclosed herein may further comprise one or more modified internucleotide bonds, such as one or more phosphate thioester bonds. In some embodiments, the PCSK9 RNAi reagent contains one or more modified nucleotides and one or more modified internucleotide bonds. In some embodiments, 2'-modified nucleotides are combined with modified internucleotide bonds.

[0078] In some embodiments, the PCSK9 RNAi reagent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the PCSK9 RNAi reagent is prepared as a pharmaceutically acceptable salt. In some embodiments, the PCSK9 RNAi reagent is prepared as a pharmaceutically acceptable sodium salt. Such forms, well-known in the art, are within the scope of the invention disclosed herein.

[0079] Modified nucleotides When used in various oligonucleotide constructs, the modified nucleotides can preserve the activity of the compound in cells, while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the oligonucleotide construct.

[0080] In some embodiments, the PCSK9 RNAi reagent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2’-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, debased nucleotides, 2'-modified nucleotides, reverse nucleotides, nucleotides containing modified nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-open-ring nucleotide mimics (unlocked nucleotide analogs or unlocked nucleotides), locked nucleotides, 3'-O-methoxy (2' nucleoside-linked) nucleotides, 2'-F-arabinonucleotides, 5'-Me, 2'-fluoronucleotides, morpholinonucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to herein or in the art as 2′-methoxynucleotides), 2'-fluoronucleotides (also referred to herein or in the art as 2'-deoxy-2'-fluoronucleotides), 2'-deoxynucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to herein or in the art as 2'-MOE nucleotides), 2'-aminonucleotides, and 2'-alkylnucleotides. All positions in a given compound need not be uniformly modified. Instead, more than one modification may be incorporated into a single PCSK9 RNAi reagent, or even into a single nucleotide. The sense and antisense strands of the PCSK9 RNAi reagent can be synthesized and / or modified using methods known in the art. Modification at one nucleotide does not depend on modification at another nucleotide.

[0081] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of 2-aminoadenine, adenine, and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- Thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.

[0082] In some embodiments, the 5' and / or 3' ends of the antisense strand may include a debase residue (Ab), which may also be referred to as a "debase site" or "debase nucleotide." A debase residue (Ab) is a nucleotide or nucleoside lacking a nucleotide base at the 1' position of the sugar moiety. In some embodiments, the debase residue may be placed inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional debase residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the debase (deoxyribose) residue may be replaced with a ribitol (debase ribose) residue.

[0083] In some embodiments, all or substantially all nucleotides of the RNAi reagent are modified nucleotides. As used herein, an RNAi reagent in which substantially all nucleotides present are modified nucleotides is an RNAi reagent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (i.e., unmodified) in both the sense and antisense strands. As used herein, a sense strand in which substantially all nucleotides present are modified nucleotides is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides are unmodified ribonucleotides. As used herein, an antisense strand in which substantially all nucleotides present are modified nucleotides is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi reagent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are described in Table 6 herein.

[0084] Modified internucleotide bonds In some embodiments, one or more nucleotides of the PCSK9 RNAi reagent are linked by non-standard bonds or a backbone (i.e., modified internucleotide bonds or a modified backbone). Modified internucleotide bonds or backbones include, but are not limited to, thiophosphate groups (represented herein as lowercase "s"), chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl-phosphate triesters, alkylphosphonates (e.g., methylphosphonate or 3'-alkylenephosphonate), chiral phosphonates, hypophosphonates, aminophosphates (e.g., 3'-aminoaminophosphate, aminoalkylaminophosphate, or thiocarbonylaminophosphate), thiocarbonylalkylphosphonate, thiocarbonylalkylphosphate triester, morpholino bonds, borane phosphates with normal 3'-5' bonds, analogs of 2'-5' linked borane phosphates, or borane phosphates with reverse polarity, wherein adjacent nucleotide pairs link 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleotide bonds or backbone lack phosphorus atoms. Modified internucleotide bonds lacking phosphorus atoms include, but are not limited to, bonds between short-chain alkyl or cycloalkyl sugars, mixed heteroatom and alkyl or cycloalkyl sugars, or bonds between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfone backbones, methylacetyl and thiomethylacetyl backbones, methylenemethylacetyl and thiomethylacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0085] In some embodiments, the sense strand of the PCSK9 RNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds, and the antisense strand of the PCSK9 RNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphate thioester bonds. In some embodiments, the sense strand of the PCSK9 RNAi reagent may contain 1, 2, 3, or 4 phosphate thioester bonds, and the antisense strand of the PCSK9 RNAi reagent may contain 1, 2, 3, or 4 phosphate thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphate thioester bonds.

[0086] In some embodiments, the sense strand of the PCSK9 RNAi reagent contains at least two phosphate-thioester nucleoside bonds. In some embodiments, the phosphate-thioester nucleoside bonds are located between nucleotides at positions 1-3 starting from the 3' end of the sense strand. In some embodiments, one phosphate-thioester nucleoside bond is located at the 5' end of the sense strand nucleotide sequence, and another phosphate-thioester bond is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphate-thioester nucleoside bonds are located at the 5' end of the sense strand, and another phosphate-thioester bond is located at the 3' end of the sense strand. In some embodiments, the sense strand does not include any phosphate-thioester nucleoside bonds between nucleotides, but contains one, two, or three phosphate-thioester bonds between terminal nucleotides at both the 5' and 3' ends and optionally present reverse debasement residues at the end cap. In some embodiments, the targeting ligand is linked to the sense strand via phosphate-thioester bonds.

[0087] In some embodiments, the antisense strand of the PCSK9 RNAi reagent contains four phosphate-thioester nucleoside bonds. In some embodiments, the four phosphate-thioester nucleoside bonds are between nucleotides at positions 1-3 starting from the 5' end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 starting from the 5' end. In some embodiments, three phosphate-thioester nucleoside bonds are located between positions 1-4 starting from the 5' end of the antisense strand, and a fourth phosphate-thioester nucleoside bond is located between positions 20-21 starting from the 5' end of the antisense strand. In some embodiments, the PCSK9 RNAi reagent contains at least three or four phosphate-thioester nucleoside bonds in the antisense strand.

[0088] Capped residues or parts In some embodiments, the sense strand may include one or more capping residues or portions, sometimes referred to in the art as a “cap,” “terminal cap,” or “capped residue.” As used herein, a “capped residue” is a nonnucleotide compound or other portion that may be incorporated at one or more ends of the nucleotide sequence of the RNAi reagent disclosed herein. In some cases, the capping residue may be to provide certain beneficial properties to the RNAi reagent, such as protection against exonuclease degradation. In some embodiments, an inverse debasement residue (invAb) (also referred to in the art as an “inverse debasement site”) is added as a capping residue. (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Patent No. 5,998,203). Capping residues are generally known in the art and include, for example, inverse debasement residues and carbon chains, such as terminal PCSK9H7 (propyl), C6H 13 (Hexyl) or C 12 H 25 (Dodecyl) group. In some embodiments, the capping residue is present at the 5' end, the 3' end, or both the 5' and 3' ends of the sense chain. In some embodiments, the 5' end and / or the 3' end of the sense chain may include more than one reverse deoxyribose moiety as a capping residue.

[0089] In some embodiments, one or more inverse debase residues (invAbs) are added to the 3' end of the sense strand. In some embodiments, one or more inverse debase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues or inverse debase sites are inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. In some embodiments, one or more inverse debase residues or inverse debase sites are included at or near one or more terminal ends of the sense strand of the RNAi reagent, allowing for enhanced activity or other desired properties of the RNAi reagent.

[0090] In some embodiments, one or more inverse debase residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverse debase residues may be inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. The inverse debase residues may be linked via phosphate esters, thiophosphate esters (e.g., shown herein as (invAb)s), or other nucleoside-to-nucleotide linkages. In some embodiments, including one or more inverse debase residues at or near one or more terminal ends of the sense strand of the RNAi reagent may allow for enhanced activity or other desired properties of the RNAi reagent. In some embodiments, the inverse debase (deoxyribose) residue may be replaced with an inverse ribitol (debased ribose) residue. In some embodiments, the 3' end of the antisense core sequence or the 3' end of the antisense sequence may include an inverse debase residue. The chemical structures of the inverse debase deoxyribose residues are shown in Table 6 below.

[0091] PCSK9 RNAi reagent The PCSK9 RNAi reagent disclosed in this article is designed to target a specific location on the PCSK9 gene (e.g., SEQ ID NO:1).

[0092] NM_174936.4, Homo sapiens ( Homo sapiens ), proprotein convertase subtilisin / kexin type 9 (PCSK9), mRNA transcript (SEQ ID NO:1): 1 agcgacgtcg aggcgctcat ggttgcaggc gggcgccgcc gttcagttca gggtctgagc 61 ctggaggagt gagccaggca gtgagactgg ctcgggcggg ccgggacgcg tcgttgcagc 121 agcggctccc agctcccagc caggattccg cgcgcccctt cacgcgccct gctcctgaac 181 ttcagctcct gcacagtcct ccccaccgca aggctcaagg cgccgccggc gtggaccgcg 241 cacggcctct aggtctcctc gccaggacag caacctctcc cctggccctc atgggcaccg 301 tcagctccag gcggtcctgg tggccgctgc cactgctgct gctgctcctg ctgctcctgg 361 gtcccgcggg cgcccgtgcg caggaggacg aggacggcga ctacgaggag ctggtgctag 421 ccttgcgttc cgaggac ggcctggccg aagcacccga gcacggacc acagccacct 481 tccaccgctg cgccaaggat ccgtggaggt tgcctggcac ctacgtggtg gtgctgaagg 541 aggagaccca cctctcgcag tcagagcgca ctgcccgccg cctgcaggcc caggctgccc 601 gccggggata cctcaccaag atcctgcatg tcttccatgg ccttcttcct ggcttcctgg 661 tgaagatgag tggcgacctg ctggagctgg ccttgaagtt gccccatgtc gactacatcg 721 aggaggactc ctctgtcttt gcccagagca tcccgtgga cctggagcgg attackccctc 781 cacggtaccg ggcggatgaa taccagcccc ccgacggagg cagcctggtg gaggtgtatc 841 tcctagacac cagcatacag agtgaccacc gggaaatcga gggcagggtc atggtcaccg 901 acttcgagaa tgtgcccgag gaggacggga cccgcttcca cagacaggcc agcaagtgtg 961 acagtcatgg cacccacctg gcaggggtgg tcagcggccg ggatgccggc gtggccaagg 1021 gtgccagcat gcgcagcctg cgcgtgctca actgccaagg gaagggcacggttagcggca 1081 ccctcatagg cctggagttt attcggaaaa gccagctggt ccagcctgtggggccactgg 1141 tggtgctgct gcccctggcg ggtgggtaca gccgcgtcct caacgccgcctgccagcgcc 1201 tggcgagggc tggggtcgtg ctggtcaccg ctgccggcaa cttccgggacgatgcctgcc 1261 tctactcccc agcctcagct cccgaggtca tcacagttgg ggccaccaatgcccaagacc 1321 agccggtgac cctggggact ttggggacca actttggccg ctgtgtggacctctttgccc 1381 caggggagga catcattggt gcctccagcg actgcagcac ctgctttgtgtcacagagtg 1441 ggacatcaca ggctgctgcc cacgtggctg gcattgcagc catgatgctgtctgccgagc 1501 cggagctcac cctggccgag ttgaggcaga gactgatcca cttctctgccaaagatgtca 1561 tcaatgaggc ctggttccct gaggaccagc gggtactgac ccccaacctggtggccgccc 1621 tgccccccag cacccatggg gcaggttggc agctgttttg caggactgtatggtcagcac 1681 actcggggcc tacacggatg gccacagccg tcgcccgctg cgccccagatgaggagctgc 1741 tgagctgctc cagtttctcc aggagtggga agcggcgggg cgagcgcatggaggcccaag 1801 ggggcaagct ggtctgccgg gcccacaacg cttttgggg tgagggtgtctacgccattg 1861 ccaggtgctg cctgctaccc caggccaact gcagcgtcca cacagctccaccagctgagg 1921 ccagcatggg gacccgtgtc cactgccacc aacagggcca cgtcctcacaggctgcagct 1981 2041 agcccaacca gtgcgtgggc cacagggagg ccagcatcca cgcttcctgctgccatgccc 2101 caggtctgga atgcaaagtc aaggagcatg gaatcccggc ccctcaggagcaggtgaccc 2161 tggcctgcga ggagggctgg accctgactg gctgcagtgc cctccctgggacctcccag 2221 tcctggggc ctacgccgta gaacacgt gtgtagtcag gagccgggacgtcagcacta 2281 caggcagcac cagcgaaggg gccgtgacag ccgttgccat ctgctgccggagccggcacc 2341 tggcgcaggc ctcccaggag ctccagtgac agccccatcc caggatgggtgtctggggag 2401 ggtcaagggc tggggctgag ctttaaaatg gttccgactt gtccctctctcagccctcca 2461 tggcctggca cgaggggatg gggatgcttc cgcctttccg gggctgctggcctggccctt 2521 gagtggggca gcctccttgc ctggaactca ctcactctgg gtgcctcctccccaggtgga 2581 ggtgccagga agctccctcc ctcactgtgg ggcatttcac cattcaaacaggtcgagctg 2641 tgctcgggtg ctgccagctg ctcccaatgt gccgatgtcc gtgggcagaatgacttttat 2701 tgagctcttg ttccgtgcca ggcattcaat cctcaggtct ccaccaaggaggcaggattc 2761 ttcccatgga taggggaggg ggcggtaggg gctgcaggga caaacatcgttggggggtga 2821 gtgtgaaagg tgctgatggc cctcatctcc agctaactgt ggagaagcccctgggggctc 2881 cctgattaat ggaggcttag ctttctggat ggcatctagc cagaggctggagacaggtgc 2941 gcccctggtg gtcacaggct gtgccttggt ttcctgagcc acctttactctgctctatgc 3001 caggctgtgc tagcaacacc caaaggtggc ctgcggggag ccatcacctaggactgactc 3061 ggcagtgtgc agtggtgcat gcactgtctc agccaacccg ctccactacccggcagggta 3121 cacattcgca cccctacttc acagaggaag aaacctggaa ccagagggggcgtgcctgcc 3181 aagctcacac agcaggaact gagccagaaa cgcagattgg gctggctctgaagccaagcc 3241 tcttcttact tcacccggct gggctcctca tttttacggg taacagtgaggctgggaagg 3301 ggaacacaga ccaggaagct cggtgagtga tggcagaacg atgcctgcaggcatggaact 3361 ttttccgtta tcacccaggc ctgattcact ggcctggcgg agatgcttctaaggcatggt 3421 cgggggagag ggccaacaac tgtccctcct tgagcaccag ccccacccaagcaagcagac 3481 atttatcttt tgggtctgtc ctctctgttg cctttttaca gccaacttttctagacctgt 3541 tttgcttttg taacttgaag atatttattc tgggttttgt agcatttttattaatatggt 3601 gactttttaa aataaaaaca aacaaacgtt gtcctaa

[0093] As defined herein, an antisense strand sequence is designed to target the PCSK9 gene at a given location on the gene when the 5' terminal nucleobase of the antisense strand aligns with the position 21 nucleotides downstream (towards the 3' end) from the gene location when it pairs with gene bases. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the PCSK9 gene at position 3536 requires that, when paired with gene bases, the 5' terminal nucleobase of the antisense strand aligns with position 3556 of the PCSK9 gene.

[0094] As provided in this article, the PCSK9 RNAi reagent does not require position 1 (5′) on the antisense strand. The nucleobase at position 3′ is complementary to the gene, provided that the antisense strand and the gene, spanning a core segment sequence of at least 15 consecutive nucleotides, have at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). For example, for the PCSK9 RNAi reagent disclosed herein designed to target position 3536 of the PCSK9 gene, the 5' nucleotide of the antisense strand of the PCSK9 RNAi reagent must be aligned with position 3556 of the gene; however, the 5' nucleotide of the antisense strand may, but is not required to, be complementary to position 3556 of the PCSK9 gene, provided that the antisense strand and the gene, spanning at least 15 consecutive nucleotides, have at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). As particularly illustrated by the examples disclosed herein and as is well known in the art, the specific binding site of the gene via the antisense strand of the PCSK9 RNAi reagent (e.g., whether the PCSK9 RNAi reagent is designed to target the PCSK9 gene at position 3536 or some other position) is important for the level of inhibition achieved by the PCSK9 RNAi reagent and for the molecularly achieved toxicity profile. (See, for example, Kamola et al.) The siRNA Non- seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0095] In some embodiments, the PCSK9 RNAi reagent disclosed herein targets the PCSK9 gene at or near the location of the PCSK9 gene sequence shown in Table 1. In some embodiments, the antisense strand of the PCSK9 RNAi reagent disclosed herein includes a core sequence that is fully complementary, substantially complementary, or at least partially complementary to the PCSK9 21-mer sequence disclosed in Table 1.

[0096] Table 1. PCSK9 21-mer mRNA target sequence (from Homo sapiens PCSK9, mRNA, GenBank NM_174936.4 (SEQ ID NO:1))

[0097] In some implementations, the PCSK9 RNAi reagent includes an antisense strand, wherein the antisense strand (5′) Position 21 of the 3′ can form a base pair with position 1 of the 21-mer target sequence disclosed in Table 1. In some embodiments, the PCSK9 RNAi reagent includes an antisense strand, wherein the antisense strand (5′) Position 1 of 3′ can form a base pair with position 21 of the 21-mer target sequence disclosed in Table 1.

[0098] In some implementations, the PCSK9 RNAi reagent includes an antisense strand, wherein the antisense strand (5′) Position 2 of the 3′ can form a base pair with position 20 of the 21-mer target sequence disclosed in Table 1. In some embodiments, the PCSK9 RNAi reagent includes an antisense strand, wherein the antisense strand (5′) Positions 2 to 18 of 3′ can each form a base pair with the corresponding complementary bases at positions 18 to 2 of the 21-mer target sequence disclosed in Table 1.

[0099] For the RNAi reagents disclosed in this paper, at the antisense strand (5' end) The nucleotide at position 1 (3' end) can be completely complementary to the PCSK9 gene, or it can be non-complementary to the PCSK9 gene. In some embodiments, at position 1 (5' end) of the antisense strand... The nucleotide at position 1 (3' end) is U, A, or dT. In some embodiments, the nucleotide at position 1 (5' end) of the antisense strand is U, A, or dT. The nucleotide at position 1 (3' end) forms an A:U or U:A base pair with the sense strand.

[0100] In some implementations, the antisense strand of the PCSK9 RNAi reagent contains nucleotides (5' end) of any antisense strand sequence from Tables 2, 3, 5C, 7A, or 8. The 3' end) sequence is 2-18, 2-19, 2-20, or 2-21. In some embodiments, the PCSK9 RNAi sense strand contains nucleotides (5' end) of any sense strand sequence from Tables 2, 4, 5C, 7B, or 8. (3' end) Sequences of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18 or 1-18.

[0101] In some implementations, the antisense strand of the PCSK9 RNAi reagent contains nucleotides (5' end) of any antisense strand sequence from Tables 2, 3, 5C, 7A, or 8. The 3' end) sequence is 2-18, 2-19, 2-20, or 2-21. In some embodiments, the PCSK9 RNAi sense strand contains nucleotides (5' end) of any sense strand sequence from Tables 2, 4, 5C, 7B, or 8. (3' end) Sequences of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18 or 1-18.

[0102] In some implementations, the PCSK9 RNAi reagent consists of: (i) nucleotides (5' end) containing any antisense strand sequence from Table 2 or Table 3. (ii) antisense strands of sequences 2-18 or 2-19 (3' end), and nucleotides containing any sense strand sequence from Table 2 or Table 4 (5' end). (3' end) A meaningful chain of sequences of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18 or 1-18.

[0103] In some implementations, the PCSK9 RNAi reagent consists of: (i) nucleotides (5' end) containing any antisense strand sequence from Table 2 or Table 3. (ii) antisense strands of sequences 2-18 or 2-19 (3' end), and nucleotides containing any sense strand sequence from Table 2 or Table 4 (5' end). (3' end) A meaningful chain of sequences of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18 or 1-18.

[0104] In some implementations, the PCSK9 RNAi reagent includes the core 21-mer nucleotide sequence shown in Table 2 below.

[0105] Table 2. Core sequence of the antisense and sense strands of the PCSK9 RNAi reagent (N = any nucleobase;)

[0106] The sense and antisense strands of a PCSK9 RNAi reagent containing or composed of the sequences in Table 2 can be modified or unmodified nucleotides. In some embodiments, the PCSK9 RNAi reagent having a sense and antisense strand sequence containing or composed of the sequences in Table 2 is entirely or substantially entirely modified nucleotides.

[0107] In some embodiments, the antisense strand of the PCSK9 RNAi reagent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the PCSK9 RNAi reagent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0108] As used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleobases (including nucleobases found on both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases not complementary to the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobases as the N nucleotides at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases different from the N nucleotides at the corresponding position on the other strand.

[0109] Table 3 provides the antisense strands of certain modified PCSK9 RNAi reagents, along with their potential unmodified nucleotide sequences. Table 4 provides the sense strands of certain modified PCSK9 RNAi reagents, along with their potential unmodified nucleotide sequences. In the formation of PCSK9 RNAi reagents, each nucleotide in each potential nucleotide sequence listed in Tables 3 and 4, as well as in Table 2 above, can be a modified nucleotide.

[0110] The PCSK9 RNAi reagent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have regions of at least 85% complementarity on adjacent 15, 16, 17, 18, 19, 20, or 21 nucleotide sequences.

[0111] In some implementations, the antisense strand of the PCSK9 RNAi reagent contains the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0112] In some embodiments, the PCSK9 RNAi reagent comprises or consists of a double-stranded sequence having the nucleobase sequences of the sense and antisense strands of any of the sequences in Tables 2, 3, or 4. In some embodiments, the PCSK9 RNAi reagent comprises or consists of a double-stranded sequence prepared or provided as a sodium salt, a mixed salt, or a free acid.

[0113] Examples of antisense strands containing modified nucleotides are provided in Tables 3 and 5C. Examples of sense strands containing modified nucleotides are provided in Tables 4 and 5C.

[0114] As used in Tables 3, 4, 5C, 7A, 7B, and 8, the following symbols are used to indicate modified nucleotides and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine 3'-phosphate I = Inosine 3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-thiophosphate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-thiophosphate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-thiophosphate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-thiophosphate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-thiophosphate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-thiophosphate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-Thiophosphate Cf = 2'-Fluorocytidine-3'-phosphate Cfs = 2'-Fluorocytidine-3'-Thiophosphate Gf = 2'-Fluoroguanosine-3'-phosphate Gfs = 2'-Fluoroguanosine-3'-Thiophosphate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-thiophosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-thiophosphate A UNA = 2',3'-open-ring-adenosine-3'-phosphate, see Table 6 A UNA s = 2',3'-open-ring-adenosine-3'-thiophosphate, see Table 6 C UNA = 2',3'-open ring-cytidine-3'-phosphate, see Table 6 C UNA s = 2',3'-open-ring-cytidine-3'-thiophosphate, see Table 6 G UNA = 2',3'-open-ring-guanosine 3'-phosphate, see Table 6 G UNA s = 2',3'-open-ring-guanosine 3'-thiophosphate, see Table 6 U UNA = 2',3'-open-ring-uridine-3'-phosphate, see Table 6 U UNA s = 2',3'-open-ring-uridine-3'-thiophosphate, see Table 6 a_2N = 2′-O-methyl-2-aminoadenosine-3′-phosphate, see Table 6 a_2Ns = 2′-O-methyl-2-aminoadenosine-3′-thiophosphate, see Table 6 (invAb) = reverse debasing deoxyribonucleotide, see Table 6. (invAb)s = reverse debased deoxyribonucleotide-5'-thiophosphate ester, see Table 6 cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 6) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-thiophosphate (see Table 6) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 6) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-thiophosphate (see Table 6).

[0115] As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., via phosphate thioester bonds "s"), when present in oligonucleotides, nucleotide monomers are linked to each other via 5'-3'-phosphodiester bonds. As will be clearly understood by those skilled in the art, as shown in the modified nucleotide sequences disclosed herein, phosphate thioester bonds replace the phosphodiester bonds typically present in oligonucleotides. Further, it will be readily understood by those skilled in the art that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl group (-OH) rather than an isolated phosphate moiety at the corresponding 3' position of the given monomer. Additionally, for the embodiments disclosed herein, when observing the corresponding chain 5'→3', a reverse debasement residue is inserted such that the 3' position of the deoxyribose is linked at the 3' end of the previous monomer on the corresponding chain (see, for example, Table 6). Furthermore, as will be readily understood and appreciated by those skilled in the art, although the thiophosphate chemical structures depicted herein typically show an anion on the sulfur atom, the present invention disclosed herein covers all thiophosphate tautomers and resonance structures (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly stated herein, this understanding is used when describing the PCSK9 RNAi reagents and PCSK9 RNAi reagent compositions disclosed herein.

[0116] Table 6 below provides some examples of targeting ligands, targeting groups, and linker groups that can be used with the PCSK9 RNAi reagents disclosed herein. More specifically, the targeting groups and linker groups (which together can form a targeting ligand) include (NAG37) and (NAG37)s, the chemical structures of which are provided in Table 6 below. Each sense strand and / or antisense strand may have any of the targeting ligands, targeting groups, or linker groups listed herein, as well as other groups, conjugated to the 5' and / or 3' ends of the sequence.

[0117] Table 3. Antisense strand sequence of PCSK9 RNAi reagent (A 2N ) = 2-aminoadenosine nucleotide.

[0118] Table 4. Sense sequences of the PCSK9 RNAi reagent (A 2N ) = 2-aminoadenosine nucleotide; I = inosine nucleotide.

[0119] The PCSK9 RNAi reagent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing a sequence listed in Tables 2, 4, 5C, 7B, or 8 can hybridize with any antisense strand containing a sequence listed in Tables 2, 3, 5C, 7A, or 8, provided that the two sequences have at least 85% complementarity in adjacent 15, 16, 17, 18, 19, 20, or 21 nucleotide sequences.

[0120] In some embodiments, the antisense strand of the PCSK9 RNAi reagent disclosed herein differs from any antisense strand sequence in Table 3 or Table 5C by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the PCSK9 RNAi reagent disclosed herein differs from any sense strand sequence in Table 4 or Table 5C by 0, 1, 2, or 3 nucleotides.

[0121] In some embodiments, the antisense strand of the PCSK9 RNAi reagent comprises the nucleotide sequence of any sequence in Table 2, Table 3, or Table 5C. In some embodiments, the antisense strand of the PCSK9 RNAi reagent comprises the nucleotide (5' end) of any sequence in Table 2, Table 3, or Table 5C. (3' end) Sequences of 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21. In some embodiments, the antisense strand of the PCSK9 RNAi reagent contains, or is composed of, any of the modified sequences in Table 3 or Table 5C.

[0122] In some embodiments, the sense strand of the PCSK9 RNAi reagent comprises the nucleotide sequence of any sequence in Tables 2, 4, or 5C. In some embodiments, the sense strand of the PCSK9 RNAi reagent comprises the nucleotide (5' end) of any sequence in Tables 2, 4, or 5C. The 3' end) contains sequences of 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21. In some embodiments, the sense strand of the PCSK9RNAi reagent contains, or is composed of, any of the modified sequences in Table 4 or Table 5C.

[0123] For the PCSK9 RNAi reagent disclosed in this paper, at the antisense strand (5' end) The nucleotide at position 1 (3' end) can be completely complementary to the PCSK9 gene, or it can be non-complementary to the PCSK9 gene. In some embodiments, at position 1 (5' end) of the antisense strand... The nucleotide at position 1 (3' end) is U, A, or dT (or a modified form thereof). In some embodiments, at the antisense strand (5' end) The nucleotide at position 1 (3' end) forms an A:U or U:A base pair with the sense strand.

[0124] A sense strand containing sequences listed in Tables 2, 4, 5C, 7B, or 8 may hybridize with any antisense strand containing sequences listed in Tables 2, 3, 5C, 7A, or 8, provided that the two sequences have at least 85% complementarity in adjacent 15, 16, 17, 18, 19, 20, or 21 nucleotide sequences. In some embodiments, the PCSK9 RNAi reagent has a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4 or 5C, and an antisense strand consisting of a modified sequence of any of the modified sequences in Tables 3 or 5C. Some representative sequence pairings are illustrated by the duplex ID Nos shown in Tables 5A, 5B, 5C, and 8.

[0125] In some embodiments, the PCSK9 RNAi reagent comprises, consists of, or is substantially composed of a double-stranded structure, indicated by any of the double-stranded ID Nos presented herein. In some embodiments, the PCSK9 RNAi reagent comprises the sense and antisense nucleotide sequences of any double-stranded structure indicated by any of the double-stranded ID Nos presented herein. In some embodiments, the PCSK9 RNAi reagent comprises the sense and antisense nucleotide sequences of any double-stranded structure indicated by any of the double-stranded ID Nos presented herein, and a targeting group and / or a linking group, wherein the targeting group and / or linking group is covalently linked (i.e., conjugated) to the sense or antisense strand. In some embodiments, the PCSK9 RNAi reagent comprises modified nucleotide sequences of the sense and antisense strands of any of the double-stranded ID Nos presented herein. In some embodiments, the PCSK9 RNAi reagent comprises a modified nucleotide sequence of the sense and antisense strands of any duplex ID No. presented herein, as well as a targeting group and / or a linker group, wherein the targeting group and / or linker group is covalently linked to the sense or antisense strand.

[0126] In some embodiments, the PCSK9 RNAi reagent comprises an antisense strand and a sense strand having the nucleotide sequence of any antisense / sense duplex from Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting group or targeting ligand.

[0127] Targeting groups, with or without a connector, may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2, 3, 4, or 5C. Connectors, with or without a targeting group, may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2, 3, 4, and 5C.

[0128] In some embodiments, the PCSK9 RNAi reagent comprises an antisense strand and a sense strand having the nucleotide sequence of any antisense / sense duplex from Table 2 or Tables 5A, 5B and 5C, and further comprises a targeting ligand selected from (NAG37) and (NAG37)s, each as defined in Table 6.

[0129] In some implementations, the PCSK9 RNAi reagent comprises an antisense strand and a sense strand, which are modified nucleotide sequences having any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.

[0130] In some embodiments, the PCSK9 RNAi reagent comprises an antisense strand and a sense strand, which are modified nucleotide sequences having any antisense strand and / or sense strand nucleotide sequences of any duplex in Tables 5A, 5B, and 5C, and further comprises a desialylate glycoprotein receptor ligand targeting group.

[0131] In some implementations, the PCSK9 RNAi reagent comprises, is composed of, or is substantially composed of any of the duplexes in Tables 5A, 5B, and 5C.

[0132] Table 5A. Double strands of PCSK9 RNAi reagent with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0133] Table 5B. PCSK9 RNAi reagent duplexes targeting the PCSK9 gene (SEQ ID NO:1), with corresponding sense and antisense strand ID numbers. Double-chain ID antiskewing ID Youyi Chain ID Targeting the PCSK9 gene location (SEQ ID NO:1) AD07404 AM10205-AS AM10204-SS 614 AD07418 AM10232-AS AM10231-SS 3468 AD07419 AM10234-AS AM10233-SS 3501 AD07420 AM10236-AS AM10235-SS 3502 AD07421 AM10238-AS AM10237-SS 3531 AD07422 AM10240-AS AM10239-SS 3532 AD07423 AM10242-AS AM10241-SS 3536 AD07690 AM10702-AS AM10701-SS 604 AD07691 AM10704-AS AM10703-SS 605 AD07692 AM10706-AS AM10705-SS 612 AD07710 AM10728-AS AM10727-SS 3301 AD07711 AM10730-AS AM10729-SS 3466 AD07712 AM10732-AS AM10731-SS 3466 AD07713 AM10734-AS AM10733-SS 3500 AD07714 AM10736-AS AM10735-SS 3534 AD07802 AM10877-AS AM10876-SS 3540 AD07911 AM11034-AS AM11033-SS 3536 AD07912 AM10242-AS AM11035-SS 3536 AD07913 AM11036-AS AM10241-SS 3536 AD07914 AM11037-AS AM10241-SS 3536 AD07915 AM10242-AS AM11038-SS 3536 AD07916 AM10242-AS AM11039-SS 3536 AD07917 AM10242-AS AM11040-SS 3536 AD07918 AM11041-AS AM10241-SS 3536 AD07919 AM11042-AS AM10241-SS 3536 AD08105 AM10242-AS AM11294-SS 3536 AD08106 AM11041-AS AM11035-SS 3536 AD08107 AM11041-AS AM11294-SS 3536 AD08108 AM11295-AS AM11294-SS 3536 AD08109 AM11296-AS AM11294-SS 3536 AD08110 AM11297-AS AM11294-SS 3536 AD08574 AM11987-AS AM11035-SS 3536 AD08575 AM11987-AS AM11988-SS 3536 AD08576 AM11987-AS AM11989-SS 3536 AD08577 AM11991-AS AM11990-SS 3536 AD08578 AM11992-AS AM11990-SS 3536 AD08579 AM11993-AS AM11990-SS 3536 AD08580 AM11994-AS AM11990-SS 3536 AD08581 AM11995-AS AM11990-SS 3536 AD08631 AM12085-AS AM12084-SS 3501 AD08796 AM12365-AS AM12364-SS 1393 AD08834 AM12437-AS AM12436-SS 3474 AD08835 AM12439-AS AM12438-SS 3486 AD08836 AM12441-AS AM12440-SS 3546 AD08837 AM12443-AS AM12442-SS 3547 AD08838 AM12445-AS AM12444-SS 1859 AD08839 AM12447-AS AM12446-SS 3482 AD08840 AM12449-AS AM12448-SS 3465 AD08841 AM12451-AS AM12450-SS 887 AD08842 AM12453-AS AM12452-SS 3523 AD08843 AM12455-AS AM12454-SS 1543 AD08844 AM12457-AS AM12456-SS 1090 AD08845 AM12459-AS AM12458-SS 3548 AD08878 AM11995-AS AM12506-SS 3536 AD08879 AM11995-AS AM12507-SS 3536 AD08880 AM11995-AS AM12508-SS 3536 AD09027 AM12085-AS AM10233-SS 3501 AD09028 AM12718-AS AM10233-SS 3501 AD09029 AM12719-AS AM10233-SS 3501 AD09030 AM12720-AS AM10233-SS 3501 AD09031 AM12720-AS AM12721-SS 3501 AD09032 AM12719-AS AM12721-SS 3501 AD09033 AM12722-AS AM12721-SS 3501 AD09034 AM12722-AS AM12723-SS 3501 AD09038 AM12732-AS AM12442-SS 3547 AD09039 AM12734-AS AM12733-SS 3547 AD09040 AM12735-AS AM12733-SS 3547 AD09041 AM12735-AS AM12736-SS 3547 AD09042 AM12737-AS AM12438-SS 3486 AD09043 AM12739-AS AM12738-SS 3486 AD09059 AM12759-AS AM12452-SS 3523 AD09131 AM11295-AS AM10241-SS 3536 AD09132 AM12878-AS AM10241-SS 3536 AD09327 AM11297-AS AM11040-SS 3536 AD09851 AM14058-AS AM11040-SS 3536 AD09852 AM14059-AS AM11040-SS 3536 AD09853 AM14060-AS AM11040-SS 3536 AD09854 AM14061-AS AM11040-SS 3536 AD09855 AM14062-AS AM11040-SS 3536

[0134] Table 5C. Double strands of the PCSK9 RNAi reagent showing the chemically modified antisense and sense strand sequences.

[0135] In some embodiments, the PCSK9 RNAi reagent is prepared or provided as a salt, a mixed salt, or a free acid. Upon delivery to cells expressing the PCSK9 gene, the RNAi reagent described herein inhibits or knocks down the expression of one or more PCSK9 genes in vivo and / or in vitro.

[0136] Targeting ligands or groups, linking groups, and delivery mediators In some embodiments, the PCSK9 RNAi reagent is conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linker groups, targeting ligands, delivery polymers, or delivery mediators. Non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi reagent. Examples of targeting groups and linker groups are provided in Table 6. Non-nucleotide groups can be covalently linked to the 3' and / or 5' ends of the sense and / or antisense strands. In some embodiments, the PCSK9 RNAi reagent contains non-nucleotide groups linked to the 3' and / or 5' ends of the sense strand. In some embodiments, non-nucleotide groups are linked to the 5' end of the sense strand of the PCSK9 RNAi reagent. Non-nucleotide groups can be directly or indirectly linked to the RNAi reagent via adapters / linker groups. In some embodiments, non-nucleotide groups are linked to the RNAi reagent via unstable, cleavable, or reversible bonds or adapters.

[0137] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi reagent or conjugate to which it is attached, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the RNAi reagent or conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi reagent.

[0138] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi reagents to which they are attached, thereby improving the cell-specific (and in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi reagents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher potency for their target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics (which have affinity for cell surface molecules).

[0139] In some embodiments, a linker, such as a PEG linker, or one, two, or three debased and / or ribitol (debased ribose) residues (which can act as linkers in some cases), is used to connect the targeting group to the RNAi reagent. In some embodiments, the targeting ligand comprises a cluster of galactose derivatives.

[0140] The PCSK9 RNAi reagent described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends. These reactive groups can then be used to attach the target moiety using methods conventional in the art.

[0141] In some embodiments, the targeting group comprises a desialyl glycoprotein receptor ligand. As used herein, a desialyl glycoprotein receptor ligand is a ligand containing a portion having an affinity for the desialyl glycoprotein receptor. As noted herein, the desialyl glycoprotein receptor is highly expressed on hepatocytes. In some embodiments, the desialyl glycoprotein receptor ligand comprises or is composed of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and galactose derivatives having an affinity for the desialyl glycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, and N-isobutyrylgalactosamine (see, for example, ST. Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives that can be used to target oligonucleotides and other molecules to the liver in vivo are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0142] Galactose derivatives have been used to target molecules to hepatocytes in vivo by binding to desialyl glycoprotein receptors expressed on the surface of hepatocytes. Binding of the desialyl glycoprotein receptor ligand to the receptor facilitates cell-specific targeting to hepatocytes and endocytosis of the molecules within the hepatocytes. The desialyl glycoprotein receptor ligand can be monomeric (e.g., having a single galactose derivative, also known as monovalent or monodentate) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or clusters of galactose derivatives can be attached to the 3′ or 5′ end of the sense or antisense strand of an RNAi reagent using methods known in the art.

[0143] The preparation of targeted ligands, such as galactose derivative clusters, is described, for example, in Arrowhead Pharmaceuticals, Inc. International Patent Application Publication No. WO 2018 / 044350 and Arrowhead Pharmaceuticals, Inc. International Patent Application Publication No. WO 2017 / 156012, the contents of which are incorporated herein by reference in their entirety.

[0144] As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. The terminal galactose derivatives are attached to the molecule via their C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also known as a trianthal galactose derivative or trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine moiety. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also known as a tetraanthal galactose derivative or tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamine moieties.

[0145] As used herein, a galactose derivative trimer contains three galactose derivatives, each attached to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each attached to a central branch point. The galactose derivatives can attach to the central branch point via the C-1 carbon of the sugar. In some embodiments, the galactose derivatives are attached to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al., J. Med. Chem. 1995, Vol. 39, pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows attachment of the three galactose derivatives and further allows attachment of the branch point to an RNAi reagent. Examples of branch point groups are dilysine or diglutamate. Attachment of the branch point to the RNAi reagent can occur via a linker or spacer. In some embodiments, the connector or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, PEG spacers. In some embodiments, the connector comprises a rigid connector, such as a cyclic group. In some embodiments, the galactose derivative comprises or is composed of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is composed of a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

[0146] Embodiments of this disclosure include pharmaceutical compositions for delivering PCSK9 RNAi reagents to hepatocytes in vivo. Such pharmaceutical compositions may include, for example, PCSK9 RNAi reagents conjugated to a cluster of galactose derivatives. In some embodiments, the cluster of galactose derivatives consists of a galactose derivative trimer, which may be, for example, an N-acetyl-galactosamine trimer, or a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

[0147] The targeting ligand or targeting group can be attached to the 3′ or 5′ end of the sense or antisense strand of the PCSK9 RNAi reagent disclosed herein.

[0148] Targeting ligands include, but are not limited to, (NAG37) and (NAG37)s as defined in Table 6. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0149] In some embodiments, a linker group is conjugated to the RNAi reagent. The linker group facilitates the covalent connection of the reagent to a targeting group, delivery polymer, or delivery medium. The linker group may be attached to the 3' and / or 5' end of the sense or antisense strand of the RNAi reagent. In some embodiments, the linker group is attached to the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5' or 3' end of the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5' end of the sense strand of the RNAi reagent. Examples of linker groups may include, but are not limited to: reactive groups, such as primary amines and alkynes, alkyl groups, debased nucleotides, ribitols (debased ribose), and / or PEG groups.

[0150] In some embodiments, the targeting group is internally linked to nucleotides on the sense and / or antisense strands of the RNAi reagent. In some embodiments, the targeting group is linked to the RNAi reagent via a linker.

[0151] A linker or connecting group is a connection between two atoms that links a chemical group (e.g., an RNAi reagent) or target segment to another chemical group (e.g., a targeting group or delivery polymer) or target segment via one or more covalent bonds. Unstable bonds contain unstable bonds. Bonding may optionally include spacers that increase the distance between the two linked atoms. Spacers may further increase the flexibility and / or length of the bond. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, and arynyl groups; each may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the preceding list is not intended to limit the scope of this specification.

[0152] In some embodiments, when two or more RNAi reagents are included in a single composition, each RNAi reagent may be linked to the same target group or two different target groups (i.e., target groups with different chemical structures). In some embodiments, the target group is linked to the PCSK9 RNAi reagent disclosed herein without the use of an additional adapter. In some embodiments, the target group itself is designed to have adapters or other sites to facilitate readily available conjugation. In some embodiments, when two or more RNAi reagents are included in a single molecule, each RNAi reagent may utilize the same adapter or different adapters (i.e., adapters with different chemical structures).

[0153] The nucleotide sequence of any PCSK9 RNAi reagent listed in Tables 2, 3, 4, 5C, 7A, 7B, or 8, whether modified or unmodified, may contain a 3' and / or 5' targeting group or linker group. Any PCSK9 RNAi reagent sequence containing a 3' or 5' targeting group or linker group, listed in Tables 3 or 4, or described elsewhere herein, may alternatively not contain a 3' or 5' targeting group or linker group, or may contain different 3' or 5' targeting groups or linker groups, including but not limited to those depicted in Table 6. Any PCSK9 RNAi reagent duplex listed in Tables 5A, 5B, 5C, and 8, whether modified or unmodified, may further contain a targeting group or linker group, including but not limited to those described in Table 6, and the targeting group or linker group may be attached to the 3' or 5' end of the sense or antisense strand of the PCSK9 RNAi reagent duplex.

[0154] Table 6 provides examples of targeting groups and linking groups (which, when combined, can form targeting ligands). Tables 4, 5C, and 8 provide certain embodiments of the sense strand of the PCSK9 RNAi reagent, said sense strand having a targeting group or linking group attached to the 5′ or 3′ end.

[0155] Table 6. Structures representing various modified nucleotides, targeting ligands or targeting groups, capped residues, and linker groups.

[0156] In each of the structures described above in Table 6, the NAG comprises N-acetyl-galactosamine. In some embodiments, the NAG as depicted in Table 6 above may comprise another galactose derivative with affinity for the desialylate glycoprotein receptor present on hepatocytes, as understood by those skilled in the art to be attached, taking into account the structures above and the description provided herein. Other linking groups known in the art may be used.

[0157] In some embodiments, a delivery medium can be used to deliver RNAi reagents to cells or tissues. The delivery medium is a compound that improves the delivery of RNAi reagents to cells or tissues. Delivery media may include, but are not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, the RNAi reagent may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi reagents can also be chemically conjugated to target groups, lipids (including but not limited to cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein carriers, or other delivery systems known and available in the art suitable for nucleic acid or oligonucleotide delivery.

[0158] Pharmaceutical Composition The PCSK9 RNAi reagents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "pharmaceuticals"). In some embodiments, the pharmaceutical compositions include at least one PCSK9 RNAi reagent. These pharmaceutical compositions can be specifically used to inhibit the expression of target mRNAs in target cells, cell populations, tissues, or organisms (e.g., humans).

[0159] The pharmaceutical composition can be used to treat a subject or patient suffering from a disease, condition, or symptom that would benefit from reduced levels of PCSK9 mRNA and / or the PCSK9 protein translated therefrom. The pharmaceutical composition can also be used to treat a subject at risk of developing a disease, condition, symptom, or symptom that would benefit from reduced levels of target mRNA or inhibition of target gene expression. In one embodiment, the method includes administering a PCSK9 RNAi reagent, as described herein and linked to a target ligand, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including mediators, carriers, diluents, and / or delivery polymers) are incorporated into the pharmaceutical composition comprising the PCSK9 RNAi reagent to form a pharmaceutical formulation or agent suitable for in vivo delivery to a subject, including a human.

[0160] The pharmaceutical compositions and methods disclosed herein, including PCSK9 RNAi reagents, reduce the level of target mRNA in cells, cell populations, tissues, organs, or subjects, comprising inhibiting PCSK9 mRNA expression or translation in the subject by administering a therapeutically effective amount of the PCSK9 RNAi reagent described herein. In some embodiments, the subject has previously been identified as having pathogenic upregulation of the target gene in hepatocytes. In some embodiments, the subject has previously been identified or diagnosed with hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypoβ-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases. In some embodiments, the subject has symptoms associated with hypercholesterolemia. In some embodiments, the subject will benefit from reduced PCSK9 gene expression in the subject's liver.

[0161] In some embodiments, the pharmaceutical composition including the PCSK9 RNAi reagent is used to treat or manage clinical manifestations including: hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobetalipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases. Other diseases or conditions for which the PCSK9 RNAi reagent may be useful include coronary artery disease, polygenic dyslipidemia, or heart disease. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more pharmaceutical compositions is administered to a subject requiring such treatment. In some embodiments, administration of any disclosed PCSK9 RNAi reagent may be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0162] The pharmaceutical composition comprising a PCSK9 RNAi reagent can be used to treat at least one symptom in a subject suffering from a disease or condition that would benefit from reduced or inhibited PCSK9 mRNA expression and / or reduced PCSK9 protein levels. Measurement of PCSK9 levels can be performed according to methods known in the art. The embodiments disclosed herein provide... In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising a PCSK9 RNAi reagent is administered to a subject to treat symptoms. In other embodiments, a preventatively effective amount of one or more PCSK9 RNAi reagents is administered to a subject to prevent or suppress at least one symptom.

[0163] The route of administration is the path by which the PCSK9 RNAi reagent comes into contact with the body. Generally, methods of administering drugs, as well as oligonucleotides and nucleic acids, for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The PCSK9 RNAi reagent disclosed herein can be administered via any suitable route in formulations appropriately tailored to a particular route. Therefore, the pharmaceutical compositions described herein can be administered, for example, by intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal injection. In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0164] Pharmaceutical compositions comprising the PCSK9 RNAi reagent described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery technologies known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be made via local administration (e.g., direct injection, implantation, or local application), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, percutaneous, airway (aerosol), nasal, oral, rectal, or local (including buccal and sublingual) administration. In some embodiments, the composition is administered via subcutaneous or intravenous infusion or injection.

[0165] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0166] As used herein, a pharmaceutical composition or agent comprises a pharmacologically effective amount of at least one of the therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients are substances other than the active pharmaceutical ingredient (API, therapeutic product, such as the PCSK9 RNAi reagent) that are intentionally included in a drug delivery system. Excipients do not exert or are not intended to exert therapeutic effects at the intended dosage. Excipients may act to: a) facilitate the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) enhance any other property of the overall safety and effectiveness of API delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.

[0167] Excipients include, but are not limited to: absorption enhancers, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, pigments, delivery enhancers, delivery polymers, detergents, dextran, glucose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, wetting agents, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, stretching agents, mediators, waterproofing agents, and wetting agents.

[0168] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (when water-soluble) or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, Cremophor® ELTM (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under manufacturing and storage conditions and should be preservative against contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using coatings such as lecithin, maintaining the desired particle size in the case of dispersions, and using surfactants. In many cases, it is preferable to include isotonic agents in the composition, such as sugars, polyols such as mannitol, sorbitol, and sodium chloride. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.

[0169] A sterile injectable solution can be prepared by incorporating the desired amount of the active compound with one or a combination of the ingredients listed above as required into a suitable solvent, followed by filtration and sterilization. Generally, a dispersion is prepared by incorporating the active compound into a sterile medium containing a base dispersion medium and other desired ingredients from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which yields a powder of the active ingredient plus any other desired ingredients from its previously sterile filtered solution.

[0170] In some embodiments, a pharmaceutical formulation suitable for subcutaneous administration, comprising the PCSK9 RNAi reagent disclosed herein, can be prepared in an aqueous sodium phosphate buffer. This formulation includes, for example, a PCSK9 RNAi reagent prepared in an aqueous solution of 0.5 mM sodium dihydrogen phosphate and 0.5 mM disodium hydrogen phosphate. In some embodiments, a pharmaceutical formulation suitable for subcutaneous administration, comprising the PCSK9 RNAi reagent disclosed herein, can be prepared in water for injection (sterile water). The PCSK9 RNAi reagent disclosed herein, suitable for subcutaneous administration, can also be prepared in isotonic saline (0.9%).

[0171] Formulations suitable for intra-articular administration can be in the form of sterile aqueous formulations of the drug, which can be in microcrystalline form, such as aqueous microcrystalline suspensions. Liposome formulations or biodegradable polymer systems can also be used to deliver drugs for intra-articular and intraocular administration.

[0172] Formulations suitable for oral administration of the PCSK9 RNAi reagent disclosed herein can also be prepared. In some embodiments, the PCSK9 RNAi reagent disclosed herein is administered orally. In some embodiments, the PCSK9 RNAi reagent disclosed herein is formulated in capsules for oral administration.

[0173] The active compound can be prepared together with a carrier that protects the compound from rapid elimination from the body, such as in controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be readily apparent to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0174] PCSK9 RNAi reagents can be formulated in the composition in dose units for ease of administration and uniform dosage. A dose unit refers to physically discrete units suitable as a unit dose for a subject to be treated; each unit contains a predetermined amount of the active compound, calculated to produce the desired therapeutic effect when bound to a desired drug carrier. Specifications of the dose unit form of this disclosure are specified and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the field of formulating such active compounds for individualized treatment.

[0175] Pharmaceutical compositions may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). Cells, tissues, or isolated organs expressing or containing RNAi reagents as defined herein are also envisioned as potential candidates for use as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount” refers to the amount of RNAi reagent that produces a pharmacological, therapeutic, or preventative outcome.

[0176] In some embodiments, in addition to applying the RNAi reagent disclosed herein, the methods disclosed herein further include the step of applying a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another PCSK9 RNAi reagent (e.g., a PCSK9 RNAi reagent targeting a different sequence within the PCSK9 target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0177] In some embodiments, the PCSK9 RNAi reagent is optionally combined with one or more additional therapeutic agents. The PCSK9 RNAi reagent and the additional therapeutic agents may be administered in a single composition or they may be administered separately. In some embodiments, one or more additional therapeutic agents are administered separately in dosage forms from the RNAi reagent (e.g., the PCSK9 RNAi reagent is administered subcutaneously, while the additional therapeutic agent involved in the treatment dosing regimen is administered orally). In some embodiments, the PCSK9 RNAi reagent is administered subcutaneously to the subject in need, and one or more optional additional therapeutic agents are administered orally, together providing a treatment regimen for diseases and conditions including: hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypoβ-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases. In some embodiments, the PCSK9 RNAi reagent is administered to the recipient via subcutaneous injection, and one or more optional additional therapeutic agents are administered via separate subcutaneous injections. In some embodiments, the PCSK9 RNAi reagent and one or more additional therapeutic agents are combined into a single dosage form (e.g., a "cocktail" of a single composition for subcutaneous injection). The PCSK9 RNAi reagent, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form a pharmaceutical composition.

[0178] Generally, the effective amount of the PCSK9 RNAi reagent is in the range of about 0.1 to about 100 mg / kg body weight per dose, for example, about 1.0 to about 50 mg / kg body weight per dose. In some embodiments, the effective amount of the active compound is in the range of about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, the effective amount of the active ingredient is in the range of about 0.5 to about 4 mg / kg body weight per dose. In some embodiments, the effective amount of the PCSK9 RNAi reagent may be a fixed dose. In some embodiments, the fixed dose is in the range of about 5 mg to about 1,000 mg of PCSK9 RNAi reagent. In some embodiments, the fixed dose is in the range of 50 to 400 mg of PCSK9 RNAi reagent. Dosing may be once weekly, once every two weeks, once monthly, once quarterly, or at any other interval, depending on the dose of the PCSK9 RNAi reagent administered, the activity level of the specific PCSK9 RNAi reagent, and the desired level of inhibition for the specific subject. The examples herein illustrate suitable levels of inhibition in certain animal species. The dosage will depend on variables such as the patient's or subject's overall health condition, the relative biological efficacy of the delivered compound, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. Additionally, it should be understood that the initial dose may be increased beyond the aforementioned upper limits to rapidly achieve the desired blood or tissue levels, or the initial dose may be less than the optimal dose.

[0179] For the purpose of treating a disease or for the formation of a pharmaceutical agent or composition for treating a disease, the pharmaceutical composition comprising the PCSK9 RNAi reagent described herein may be combined with an excipient or a second therapeutic agent or treatment, the second therapeutic agent or treatment including but not limited to: a second or other RNAi reagent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0180] When incorporated into pharmaceutically acceptable excipients or adjuvants, the PCSK9 RNAi reagent can be packaged into kits, containers, packages, or dispensers. The pharmaceutical compositions described herein can be packaged into pre-filled syringes, pen syringes, auto-injectors, infusion bags / devices, or vials.

[0181] PCSK9 RNAi reagent raw materials and formulations In some embodiments, the PCSK9 RNAi reagent disclosed herein has the nucleotide sequences of the PCSK9 RNAi active pharmaceutical ingredient shown in Table 8 below. The nucleotide sequences of the PCSK9 RNAi reagent found in the PCSK9 RNAi active pharmaceutical ingredient include the antisense strand nucleotide sequences shown in Table 7A below, and the sense strand nucleotide sequences shown in Table 7B below.

[0182] Table 7A. Antisense strand sequence of PCSK9 RNAi reagent

[0183] Table 7B. Sense nucleotide sequences of PCSK9 RNAi reagents (shown as modified forms without reverse debasing residues or NAG targeting groups present in the PCSK9 RNAi active pharmaceutical ingredient).

[0184] As used in Tables 7A, 7B, and 8 of this document, the following symbols are used to indicate modified nucleotides, targeting groups, and linking groups: A, C, G, and U represent adenosine, cytidine, guanosine, and uridine, respectively; a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; s represents a phosphate thioester bond; (invAb) represents a reverse debasing deoxyribose residue (see Table 6); and (NAG37)s represents the following structure (described as both a sodium salt and a free acid): (shown as sodium salt), or (Shown as free acid).

[0185] Each sense strand and / or antisense strand may have any of the target groups or linking groups listed above that are conjugated to the 5' and / or 3' ends of the sequence, as well as other target or linking groups.

[0186] The antisense strand sequence of the PCSK9 RNAi reagent is designed to target the mRNA transcript of the PCSK9 gene from human subjects, thereby silencing the translation of the PCSK9 protein in human subjects with PCSK9 using an RNA interference mechanism.

[0187] In some implementations, the methods disclosed herein use the PCSK9 RNAi active pharmaceutical ingredient listed in Table 8 below: Table 8. PCSK9 RNAi API

[0188] In some embodiments, the PCSK9 RNAi active pharmaceutical ingredient is prepared or provided as a salt, a mixture of salts, or a free acid. In some embodiments, it is in the form of a sodium salt.

[0189] In some embodiments, the PCSK9 RNAi active pharmaceutical ingredient, as provided in Table 8, is formulated with one or more pharmaceutically acceptable excipients to form a pharmaceutical composition suitable for administration to human subjects. In some embodiments, the PCSK9 RNAi active pharmaceutical ingredient described in Table 8 is formulated at 200 mg / mL in an aqueous solution of sodium phosphate buffer (0.5 mM sodium dihydrogen phosphate, 0.5 mM disodium hydrogen phosphate) suitable for subcutaneous administration in humans.

[0190] Treatment and suppression of expression methods The PCSK9 RNAi reagent disclosed herein can be used to treat subjects (e.g., humans or other mammals) with a disease or condition that will benefit from the administration of the RNAi reagent. In some embodiments, the RNAi reagent disclosed herein can be used to treat subjects (e.g., humans) who will benefit from a reduction and / or inhibition of PCSK9 mRNA expression and / or PCSK9 protein levels, for example, subjects diagnosed with or suffering from symptoms including: hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobeta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases.

[0191] In some embodiments, a therapeutically effective amount of any one or more PCSK9 RNAi reagents is administered to the subject. Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more PCSK9 RNAi reagents described herein is administered to the subject. The subject may be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein may be for human or animal use.

[0192] The PCSK9 RNAi reagents described herein can be used to treat at least one symptom in a subject who suffers from a PCSK9-related disease or condition, or a disease or condition at least partially mediated by PCSK9 gene expression. In some embodiments, the PCSK9 RNAi reagents are used to treat or manage the clinical presentation of a subject suffering from a disease or condition that would benefit from or be at least partially mediated by a reduction in PCSK9 mRNA or PCSK9 protein levels. A therapeutically effective amount of one or more of the PCSK9 RNAi reagents described herein, or a composition containing a PCSK9 RNAi reagent, is administered to the subject. In some embodiments, the methods disclosed herein include administering a composition containing a PCSK9 RNAi reagent described herein to a subject to be treated. In some embodiments, a preventatively effective amount of any one or more of the PCSK9 RNAi reagents is administered to the subject, thereby treating the subject by preventing or suppressing at least one symptom.

[0193] In some embodiments, this disclosure provides methods for treating diseases, symptoms, conditions, or pathological states mediated at least in part by PCSK9 gene expression in patients in need, said methods comprising administering any of the PCSK9 RNAi reagents described herein to the patient.

[0194] In some embodiments, compared to subjects who had not received the PCSK9 RNAi reagent or before, the gene expression level and / or mRNA level of the PCSK9 gene was reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% in subjects who had received the PCSK9 RNAi reagent. The PCSK9 mRNA level in the subjects may be reduced in the subjects' cells, cell populations, and / or tissues. In some embodiments, compared to subjects who had not received the PCSK9 RNAi reagent or before, the expression of the PCSK9 gene in hepatocytes was inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or greater than 65%.

[0195] In some embodiments, compared to subjects who had received the PCSK9 RNAi reagent or subjects who had not received the PCSK9 RNAi reagent, the PCSK9 protein level was reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. The protein level in the subject may be reduced in the subject's cells, cell populations, tissues, blood, and / or other fluids.

[0196] The reduction in PCSK9 mRNA and PCSK9 protein levels can be evaluated using any method known in the art. As used herein, a reduction or decrease in PCSK9 mRNA and / or protein levels is collectively referred to herein as a reduction or decrease in PCSK9 or inhibition or reduction of PCSK9 gene expression. The examples described herein illustrate known methods for evaluating PCSK9 gene expression inhibition. Those skilled in the art will further recognize suitable methods for evaluating PCSK9 gene expression inhibition in vivo and / or in vitro. 。

[0197] In some embodiments, this document discloses methods for treating (including prophylactic or preventative treatment) diseases, conditions, or symptoms caused by: hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobeta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases, wherein said method comprises administering a therapeutically effective amount of a PCSK9 RNAi reagent to a subject in need, comprising an antisense strand at least partially complementary to a portion of a PCSK9 mRNA having the sequences in Table 1. In some embodiments, this document discloses methods for treating (including prophylactic or preventative treatment) diseases or symptoms caused by: hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobeta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases, wherein said method comprises administering a therapeutically effective amount of a PCSK9 RNAi reagent to a subject in need, comprising an antisense strand containing any sequence from Tables 2, 3, 5C, 7A, or 8, and a sense strand containing any sequence from Tables 2, 4, 5C, 7B, or 8 that is at least partially complementary to the antisense strand. In some embodiments, this document discloses methods for treating (including prophylactic or preventative treatment) diseases or symptoms caused by: hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobeta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases, wherein said method comprises administering a therapeutically effective amount of a PCSK9 RNAi reagent to a subject in need, comprising a sense strand containing any sequence from Tables 2, 4, 5C, 7B, or 8, and an antisense strand containing a sequence at least partially complementary to the sense strand from Tables 2, 3, 5C, 7A, or 8.

[0198] In some embodiments, this document discloses a method for inhibiting PCSK9 gene expression in cells, wherein the method includes administering a PCSK9 RNAi reagent to cells comprising an antisense strand at least partially complementary to a portion of PCSK9 mRNA having sequences in Table 1. In some embodiments, this document discloses a method for inhibiting PCSK9 gene expression in cells, wherein the method includes administering a PCSK9 RNAi reagent to cells comprising an antisense strand comprising a sequence comprising any sequence in Tables 2, 3, 5C, 7A, or 8, and a sense strand comprising any sequence in Tables 2, 4, 5C, 7B, or 8 that is at least partially complementary to the antisense strand. In some embodiments, this document discloses a method for inhibiting PCSK9 gene expression in cells, wherein the method includes administering a PCSK9 RNAi reagent comprising a sense strand comprising any sequence in Tables 2, 4, 5C, 7B, or 8, and an antisense strand comprising a sequence comprising any sequence in Tables 2, 3, 5C, 7A, or 8 that is at least partially complementary to the sense strand.

[0199] The use of PCSK9 RNAi reagents provides a method for the therapeutic (including preventative) treatment of diseases / conditions including: hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobeta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases. The PCSK9 RNAi reagents mediate RNA interference to inhibit the expression of one or more genes essential for the production of PCSK9 protein. PCSK9 RNAi reagents can also be used to treat or prevent various diseases, conditions, or illnesses, including hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypobeta-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases. Furthermore, compositions for the in vivo delivery of PCSK9 RNAi reagents to liver cells, particularly hepatocytes, are described.

[0200] Cells, tissues, organs and non-human objects Cells, tissues, organs, and non-human objects, including at least one PCSK9 RNAi reagent described herein, are considered. Cells, tissues, organs, or non-human objects are prepared by delivering RNAi reagents to the cells, tissues, organs, or non-human objects.

[0201] Other illustrative implementation schemes Certain additional illustrative embodiments of the present invention are provided herein. These embodiments are illustrative only and do not limit the scope of this disclosure or the claims appended thereto.

[0202] Implementation Scheme 1. An RNAi reagent for inhibiting PCSK9 gene expression, comprising: Antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of the antisense strand sequences in Tables 2, 3, 5C, 7A, or 8; and A sense strand contains a nucleotide sequence that is at least partially complementary to the antisense strand. The antisense strand and / or sense strand contain all or substantially all modified nucleotides, and the RNAi reagent is linked to a targeting ligand containing N-acetyl-galactosamine.

[0203] Implementation Scheme 2. An RNAi reagent for inhibiting PCSK9 gene expression, wherein the sense strand comprises a nucleotide sequence of at least 15 adjacent nucleotides that differs from the 15 adjacent nucleotides of any sense strand sequence in Tables 2, 4, 5C, 7B, or 8 by 0 or 1 nucleotide, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand on at least 15 adjacent nucleotides.

[0204] Implementation Scheme 3. An RNAi reagent of any one of Implementation Schemes 1-2, wherein at least one nucleotide of the RNAi reagent comprises a modified internucleotide bond.

[0205] Implementation Scheme 4. An RNAi reagent of any one of Implementation Schemes 1-3, wherein the modified nucleotide is independently selected from: 2′-O-methyl nucleotide, 2′-fluoronucleotide, 2′-deoxynucleotide, 2′,3′-open-ring nucleotide mimic, locked nucleotide, 2′-F-arabinonucleotide, 2′-methoxyethyl nucleotide, debased nucleotide, ribitol, reverse nucleotide, reverse 2′-O-methyl nucleotide, reverse 2′-deoxynucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholinonucleotide, vinylphosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3′-O-methyl nucleotide.

[0206] Implementation Scheme 5. The RNAi reagent of Implementation Scheme 4, wherein all or substantially all modified nucleotides are 2′-O-methylnucleotides, 2′-fluoronucleotides, or combinations thereof.

[0207] Implementation Scheme 6. An RNAi reagent of any one of Implementation Schemes 1-5, wherein the antisense strand consists of or is substantially composed of the nucleotide sequence of any of the modified antisense strand sequences in Tables 3, 5C, 7A, or 8.

[0208] Implementation Scheme 7. An RNAi reagent of any one of Implementation Schemes 1-6, wherein the sense strand consists of, is substantially composed of or contains, a nucleotide sequence of any modified sense strand sequence from Table 4, Table 5C, Table 7B or Table 8.

[0209] Implementation Scheme 8. The RNAi reagent of Implementation Scheme 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences in Table 3, Table 5C, Table 7A or Table 8, and the sense strand comprises a nucleotide sequence of any one of the modified sequences in Table 4, Table 5C, Table 7B or Table 8.

[0210] Implementation Scheme 9. An RNAi reagent of any one of Implementation Schemes 1-8, wherein the targeting ligand comprises: ,or .

[0211] Implementation Scheme 10. An RNAi reagent of any one of Implementation Schemes 1-9, wherein the targeting ligand is linked to a sense strand.

[0212] Implementation Scheme 11. The RNAi reagent of Implementation Scheme 10, wherein the targeting ligand is attached to the 5' end of the sense strand.

[0213] Implementation Scheme 12. An RNAi reagent of any one of Implementation Schemes 1-11, wherein the sense strand is 15 to 30 nucleotides in length and the antisense strand is 21 to 30 nucleotides in length.

[0214] Implementation Scheme 13. The RNAi reagent of Implementation Scheme 12, wherein the sense strand and antisense strand are each 21 to 27 nucleotides in length.

[0215] Implementation Scheme 14. The RNAi reagent of Implementation Scheme 13, wherein the sense strand and antisense strand are each 21 to 24 nucleotides in length.

[0216] Implementation Scheme 15. The RNAi reagent of Implementation Scheme 14, wherein the sense strand and antisense strand are each 21 nucleotides in length.

[0217] Implementation Scheme 16. An RNAi reagent of any one of Implementation Schemes 1-15, wherein the RNAi reagent has two blunt ends.

[0218] Implementation Scheme 17. An RNAi reagent of any one of Implementation Schemes 1-16, wherein the sense strand comprises one or two end caps.

[0219] Implementation Scheme 18. An RNAi reagent of any one of Implementation Schemes 1-17, wherein the sense strand contains one or two reverse debasement residues.

[0220] Implementation Scheme 19. The RNAi reagent of Implementation Scheme 1, wherein the RNAi reagent comprises a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded sequence of any double-stranded sequence listed in Tables 5A, 5B, 5C or 8.

[0221] Implementation Scheme 20. An RNAi reagent of any one of Implementation Schemes 1-19, wherein the RNAi reagent is a pharmaceutically acceptable salt.

[0222] Implementation Scheme 21. The RNAi reagent of Implementation Scheme 20, wherein the RNAi reagent is a sodium salt.

[0223] Implementation Scheme 22. A composition comprising an RNAi reagent of any one of Implementation Schemes 1-21, wherein the composition comprises a pharmaceutically acceptable excipient.

[0224] Implementation Scheme 23. The composition of Implementation Scheme 22, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

[0225] Implementation Scheme 24. The composition of Implementation Scheme 22, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

[0226] Implementation Scheme 25. A method for inhibiting PCSK9 gene expression in hepatocytes, the method comprising introducing an effective amount of the RNAi reagent of any one of Implementation Schemes 1-21 or the composition of any one of Implementation Schemes 22-24 into the cell.

[0227] Implementation Scheme 26. The method of Implementation Scheme 25, wherein the subject is a human subject.

[0228] Implementation Scheme 27. The method of any one of Implementation Schemes 25-26, wherein the PCSK9 mRNA level is reduced by at least about 50% in hepatocytes or in the subject.

[0229] Implementation Scheme 28. The method of any one of Implementation Schemes 25-27, wherein the PCSK9 protein level is reduced by at least about 50% in hepatocytes or in the subject.

[0230] Implementation Scheme 29. A method for treating PCSK9-related diseases, conditions, or symptoms, said method comprising administering to a human subject in need a therapeutically effective amount of any one of the compositions of Implementation Schemes 22-24.

[0231] Implementation Scheme 30. The method of Implementation Scheme 29, wherein the disease includes hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypoβ-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD) and / or other PCSK9-related diseases.

[0232] Implementation Scheme 31. The method of any one of Implementation Schemes 25-30, wherein the level of serum PCSK9 protein is reduced in the subject.

[0233] Implementation Scheme 32. The method of any one of Implementation Schemes 25-31, wherein the RNAi reagent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

[0234] Implementation Scheme 33. The use of any RNAi reagent of any of Implementation Schemes 1-21 or any composition of any of Implementation Schemes 22-24 for the treatment of at least part of a disease, condition or symptom mediated by reduced expression of the PCSK9 gene.

[0235] Implementation Scheme 34. According to the use of Implementation Scheme 33, the diseases mentioned include hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial hypoβ-lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD) and / or other PCSK9-related diseases.

[0236] Implementation Scheme 35. Use of any RNAi reagent of any of Implementation Schemes 1-21 or any composition of any of Implementation Schemes 22-24 for the preparation of a pharmaceutical composition for the treatment of at least part of a disease, condition or symptom mediated by reduced expression of the PCSK9 gene.

[0237] Implementation Scheme 36. According to any one of Implementation Schemes 33 to 35, the RNAi reagent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

[0238] The implementation schemes and projects provided above will now be illustrated by the following non-limiting examples. Example

[0239] Example 1. Synthesis of PCSK9 RNAi reagent.

[0240] The PCSK9 RNAi reagent duplexes shown in Tables 5A, 5B, 5C, and 8 above were synthesized according to the following general procedure: A. synthesis .

[0241] The sense and antisense strands of the RNAi reagent are synthesized using a solid-phase phosphoramidite technique employed in oligonucleotide synthesis. This standard synthesis is generally known in the art. Depending on scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) are used. Synthesis is performed on a solid support made of controlled-porosity glass (CPG, 500 Å or 600 Å, from Prime Synthesis, Aston, PA, USA). Monomers positioned at the 3' end of the respective strand are attached to the solid support as a starting point for synthesis. All RNA and 2'-modified RNA phosphoramidites are purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). The 2'-O-methylphosphoramidite comprises: (5'-O-dimethoxytriphenylmethyl-N... 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5'-O-dimethoxy-triphenylmethyl-N 4 -(acetyl)-2'-O-methylcytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphamide, (5'-O-dimethoxytriphenylmethyl-N 2-(isobutyryl)-2'-O-methylguanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, and 5'-O-dimethoxytriphenylmethyl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2'-Deoxy-2'-fluorophosphamide carries the same protecting group as 2'-O-methylamidite. 5'-(4,4'-dimethoxytriphenylmethyl)-2',3'-open-ring-uridine and 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide were also available from ThermoFisher Scientific or Hongene Biotech. 5'-Dimethoxytriphenylmethyl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen Research (Virginia) or Hongene Biotech. Cyclopropylphosphonate phosphoramide was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). Reverse debasing (3'-O-dimethoxytriphenylmethyl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5'-O-dimethoxytriphenylmethyl-N 2 N 6 -(phenoxyacetic acid ester)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was obtained from ChemGenes or Hongene Biotech.

[0242] Phosphite containing the targeting ligand was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other phosphites were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and a molecular sieve (3 Å) were added. Activating solutions were 5-benzylthio-1H-tetrazole (BTT, 250 mM acetonitrile solution), 5-ethylthio-1H-tetrazole (ETT, 250 mM acetonitrile solution), or 4,5-dicyanimidazolium (DCI). Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 s (2'OMe), and 60 s (2'F). To introduce thiophosphate bonding, a 100 mM solution of 3-phenyl-1,2,4-dithiozolin-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Each PCSK9 RNAi reagent duplex synthesized and tested in the following examples utilized N-acetyl-galactosamine, designated as “NAG” in the targeting ligand chemical structure shown in Table 6. The (NAG37) and (NAG37)s targeting ligand phosphoramidide compounds could be synthesized according to International Patent Application Publication No. WO 2018 / 044350 of Arrowhead Pharmaceuticals, Inc.

[0243] B. Cutting and deprotection of support-bonded oligomers.

[0244] After solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40% wt% aqueous methylamine and 28% ammonium hydroxide (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0245] C. Purification.

[0246] Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13µm column and a Shimadzu LC-8 system. Buffer A consisted of 20 mM Tris, 5 mM EDTA, pH 9.0, and 20% acetonitrile, while buffer B was identical to buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were combined and then run on size-resistance HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G25 powder, with either filtered DI water or a run buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0247] D. Annealing.

[0248] The RNAi reagent was prepared by mixing complementary strands (sense and antisense) in equimolar amounts of RNA solution in 1× phosphate-buffered saline (Corning, Cellgro). Some of the RNAi reagent was lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1× phosphate-buffered saline on a UV-Vis spectrometer. The duplex concentration was then determined by multiplying the absorbance at 260 nm by a conversion factor and a dilution factor. The conversion factor used was 0.050 mg / (mL∙cm) or calculated based on the experimentally determined extinction coefficient.

[0249] Example 2. hPCSK9 AAV mouse model.

[0250] To evaluate certain PCSK9 RNAi agents, a human PCSK9 (hPCSK9) AAV (adeno-associated virus) mouse model was used. Six- to eight-week-old male C57BL / 6 mice were transduced with hPCSK9 AAV serotype 8, administered at least 14 days prior to administration of the PCSK9 RNAi agent or control. The hPCSK9 AAV genome contains the 291-3637 region (ORF plus 3'-UTR region) of the human PCSK9 cDNA sequence (GenBank NM_174936.4 (SEQ ID NO:1)), which is driven by a liver-specific promoter. hPCSK9 AAV mouse models were generated by intravenous injection of 4E12 to 1E13 GC / kg of virus in PBS at a total volume of 10 mL / kg animal body weight. Inhibition of hPCSK9 expression in the liver by the PCSK9 RNAi agent resulted in a decrease in the measured serum levels of hPCSK9 protein. Serum hPCSK9 protein levels were measured using the Human Proprotein Convertase 9 / PCSK9 Quantikine ELISA Kit (Biotechne) before treatment (between day -7 and day 1 before dose), and mice were grouped according to mean hPCSK9 protein levels.

[0251] Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C. The serum was collected and measured using the HumanProprotein Convertase 9 / PCSK9 Quantikine ELISA Kit according to the manufacturer's instructions. Serum hPCSK9 levels for each animal were normalized against a control group of mice injected with the vector control to account for treatment-independent hPCSK9 expression shifts in this model. To achieve this, firstly, the hPCSK9 level for each animal at a given time point was divided by that animal's pre-treatment expression level (Day 1) to determine the "normalized against pre-treatment" expression ratio. Then, the expression at a specific time point was normalized against the control group by dividing the individual animal's "normalized against pre-treatment" ratio by the average "normalized against pre-treatment" ratio of all mice in the normal vector control group. Alternatively, serum hPCSK9 levels for each animal can be evaluated simply by standardizing against pre-treatment levels.

[0252] Example 3. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0253] The hPCSK9 AAV mouse model described in Example 2 above, containing the 291-3637 region of the human PCSK9 cDNA sequence, was used. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight containing 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 9 below: Table 9. Target location and administration group in Example 3. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 614 1.0 mg / kg AD07404 A single injection on day 1 3 604 1.0 mg / kg AD07690 A single injection on day 1 4 605 1.0 mg / kg AD07691 A single injection on day 1 5 612 1.0 mg / kg AD07692 A single injection on day 1 6 3468 1.0 mg / kg AD07418 A single injection on day 1 7 3501 1.0 mg / kg AD07419 A single injection on day 1 8 3502 1.0 mg / kg AD07420 A single injection on day 1 9 3531 1.0 mg / kg AD07421 A single injection on day 1 10 3532 1.0 mg / kg AD07422 A single injection on day 1 11 3536 1.0 mg / kg AD07423 A single injection on day 1 12 3301 1.0 mg / kg AD07710 A single injection on day 1

[0254] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD07404 (Group 2) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 614; PCSK9 RNAi reagent AD07690 (Group 3) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 604; PCSK9 RNAi reagent AD07691 (Group 4) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 605; PCSK9 RNAi reagent AD07692 (Group 5) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 612; PCSK9 RNAi reagent AD07418 (Group 6) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3468; PCSK9 RNAi reagent AD07419 (Group 7) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3501; PCSK9 RNAi reagent AD07420 Group 8 includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3502 of the gene; PCSK9 RNAi reagent AD07421 (Group 9) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3531 of the gene; PCSK9 RNAi reagent AD07422 (Group 10) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3532 of the gene; PCSK9 RNAi reagent AD07423 (Group 11) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene; PCSK9 RNAi reagent AD07710 (Group 12) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3301 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0255] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, day 22, and day 29, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 10 below: Table 10. Mean serum PCSK9 protein levels normalized to pre-treatment and control levels in hPCSK9 AAV mice from Example 3.

[0256] As shown in Table 10, while a few of the tested PCSK9 RNAi reagents showed low to no inhibitory activity compared to the saline control, some PCSK9 RNAi reagents stably silenced PCSK9 gene expression. In particular, a single dose of 1.0 mg / kg of AD07423 (targeting PCSK9 gene position 3536) showed a reduction of approximately 59% (0.411) of PCSK9 protein on day 15.

[0257] Example 4. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0258] The hPCSK9 AAV mouse model described in Example 2 above uses hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight containing 1.5 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 11 below.

[0259] Table 11. Target locations and administration groups in Example 4. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 1.5 mg / kg AD07423 A single injection on day 1 3 3466 1.5 mg / kg AD07711 A single injection on day 1 4 3490 1.5 mg / kg AD07712 A single injection on day 1 5 3500 1.5 mg / kg AD07713 A single injection on day 1 6 3534 1.5 mg / kg AD07714 A single injection on day 1

[0260] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD07423 (Group 2) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene; PCSK9 RNAi reagent AD07711 (Group 3) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3466 of the gene; PCSK9 RNAi reagent AD07712 (Group 4) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3490 of the gene; PCSK9 RNAi reagent AD07713 (Group 5) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3500 of the gene; PCSK9 RNAi reagent AD07714 (Group 6) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3534 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0261] Injections were performed in loose skin in the neck and shoulder areas between the skin and muscle (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, and day 15, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 12 below: Table 12. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 4.

[0262] As shown in Table 12, each PCSK9 RNAi reagent tested demonstrated silencing of PCSK9 protein expression in the hPCSK9 AAV mouse model. In particular, a single dose of the 1.5 mg / kg PCSK9 RNAi reagent AD07423 showed approximately 72% (0.281) inhibition on day 15.

[0263] Example 5. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0264] The hPCSK9 AAV mouse model described in Example 2 above uses hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight containing 1.5 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 13 below.

[0265] Table 13. Target locations and dosing groups in Example 5. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 1.5 mg / kg AD07423 A single injection on day 1 3 3536 1.5 mg / kg AD07911 A single injection on day 1 4 3536 1.5 mg / kg AD07912 A single injection on day 1 5 3536 1.5 mg / kg AD07913 A single injection on day 1 6 3536 1.5 mg / kg AD07914 A single injection on day 1 7 3536 1.5 mg / kg AD07915 A single injection on day 1 8 3536 1.5 mg / kg AD07916 A single injection on day 1 9 3536 1.5 mg / kg AD07917 A single injection on day 1 10 3536 1.5 mg / kg AD07918 A single injection on day 1 11 3536 1.5 mg / kg AD07919 A single injection on day 1 12 3540 1.5 mg / kg AD07802 A single injection on day 1

[0266] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents comprising (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). Each of the PCSK9 RNAi reagents in groups 2 through 11 comprises a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene; PCSK9 RNAi reagent AD07802 (group 12) comprises a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3540 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0267] Injections were performed in loose skin in the neck and shoulder areas between the skin and muscle (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, and day 15, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 14 below: Table 14. Mean serum PCSK9 protein levels normalized to pre-treatment and control levels in hPCSK9 AAV mice from Example 5.

[0268] As shown in Table 14, each PCSK9 RNAi agent stably silenced PCSK9 gene expression. Each PCSK9 RNAi agent targeting PCSK9 gene position 3536 (i.e., groups 2–11) outperformed group 12 (AD07802), which targets position 3540. Groups 2–11 each showed a 70%–80% reduction in PCSK9 protein at day 15, compared to pre-treatment and control normalization.

[0269] Example 6. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0270] The hPCSK9 AAV mouse model described in Example 2 above uses hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight containing 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 15 below.

[0271] Table 15. Target locations and dosing groups in Example 6. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 1.0 mg / kg AD07912 A single injection on day 1 3 3536 1.0 mg / kg AD08105 A single injection on day 1 4 3536 1.0 mg / kg AD08106 A single injection on day 1 5 3536 1.0 mg / kg AD08107 A single injection on day 1 6 3536 1.0 mg / kg AD08108 A single injection on day 1 7 3536 1.0 mg / kg AD08109 A single injection on day 1 8 3536 1.0 mg / kg AD08110 A single injection on day 1 9 3536 1.0 mg / kg AD07423 A single injection on day 1

[0272] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents including the (NAG37)s ligand, see Tables 3, 4, 5A, 5B, 5C, and 6). All PCSK9 RNAi reagents tested comprised a nucleotide sequence designed to repress PCSK9 gene expression at position 3536 of the gene (for the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0273] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice (n=4) were tested in each of groups 1–8, and three (3) mice (n=3) were tested in group 9. Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 16 below: Table 16. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 6.

[0274] As shown in Table 16, each PCSK9 RNAi reagent silences PCSK9 gene expression.

[0275] Example 7. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0276] The hPCSK9 AAV mouse model described in Example 2 above uses hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight containing 0.3 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent), according to Table 17 below.

[0277] Table 17. Target locations and dosing groups in Example 7. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 0.3 mg / kg AD08110 A single injection on day 1 3 3536 0.3 mg / kg AD08574 A single injection on day 1 4 3536 0.3 mg / kg AD08575 A single injection on day 1 5 3536 0.3 mg / kg AD08576 A single injection on day 1 6 3536 0.3 mg / kg AD08577 A single injection on day 1 7 3536 0.3 mg / kg AD08578 A single injection on day 1 8 3536 0.3 mg / kg AD08579 A single injection on day 1 9 3536 0.3 mg / kg AD08580 A single injection on day 1 10 3536 0.3 mg / kg AD08581 A single injection on day 1 11 3536 0.3 mg / kg AD08106 A single injection on day 1

[0278] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents including the (NAG37)s ligand, see Tables 3, 4, 5A, 5B, 5C, and 6). Each PCSK9 RNAi reagent tested includes a nucleotide sequence designed to repress PCSK9 gene expression at position 3536 of the gene (for the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0279] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice (n=4) were tested in each of groups 1-10, and three (3) mice (n=3) were tested in group 11. Serum was collected on days 1 (before treatment), 8, 15, 22, 29, and 36, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 18 below: Table 18. Mean serum PCSK9 protein levels normalized to pre-treatment and control levels in hPCSK9 AAV mice from Example 7.

[0280] As shown in Table 18, each PCSK9 RNAi reagent silenced PCSK9 gene expression, with the reduction in PCSK9 protein compared to the control lasting until day 36.

[0281] Example 8. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0282] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 19 below, containing 0.3 mg / kg or 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 19. Target location and administration group of Example 8. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 0.3 mg / kg AD08110 A single injection on day 1 3 3536 0.3 mg / kg AD08575 A single injection on day 1 4 3536 0.3 mg / kg AD08581 A single injection on day 1 5 3536 0.3 mg / kg AD08878 A single injection on day 1 6 3536 0.3 mg / kg AD08879 A single injection on day 1 7 3536 0.3 mg / kg AD08880 A single injection on day 1 8 3531 1.0 mg / kg AD07421 A single injection on day 1 9 3474 1.0 mg / kg AD08834 A single injection on day 1 10 3486 1.0 mg / kg AD08835 A single injection on day 1 11 3546 1.0 mg / kg AD08836 A single injection on day 1 12 3547 1.0 mg / kg AD08837 A single injection on day 1

[0283] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD08110 (Group 2) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536; PCSK9 RNAi reagent AD08575 (Group 3) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536; PCSK9 RNAi reagent AD08581 (Group 4) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536; PCSK9 RNAi reagent AD08878 (Group 5) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536; PCSK9 RNAi reagent AD08879 (Group 6) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536; PCSK9 RNAi reagent AD08880 (Group 7) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536; PCSK9 RNAi reagent AD07421 Group 8 includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3531 of the gene; Group 9 includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3474 of the gene; Group 10 includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3486 of the gene; Group 11 includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3546 of the gene; and Group 12 includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3547 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0284] Injections were performed in loose skin in the neck and shoulder areas between the skin and muscle (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 20 below: Table 20. Mean serum PCSK9 protein levels normalized to pre-treatment and control levels in hPCSK9 AAV mice from Example 8.

[0285] As shown in Table 20, groups 2–7 performed best on day 22, each containing a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536. As noted above, groups 2–7 were administered only 0.3 mg / kg, while groups 8–12 were administered 1.0 mg / kg, indicating that the PCSK9 RNAi reagents in groups 2–7 were substantially more potent in inhibiting PCSK9 gene expression compared to those in groups 8–12.

[0286] Example 9. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0287] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 21 below, containing 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 21. Target locations and administration groups in Example 9. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3531 1.0 mg / kg AD07421 A single injection on day 1 3 1393 1.0 mg / kg AD08796 A single injection on day 1 4 1859 1.0 mg / kg AD08838 A single injection on day 1 5 3482 1.0 mg / kg AD08839 A single injection on day 1 6 3465 1.0 mg / kg AD08840 A single injection on day 1 7 887 1.0 mg / kg AD08841 A single injection on day 1 8 3523 1.0 mg / kg AD08842 A single injection on day 1 9 1543 1.0 mg / kg AD08843 A single injection on day 1 10 1090 1.0 mg / kg AD08844 A single injection on day 1 11 3548 1.0 mg / kg AD08845 A single injection on day 1

[0288] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD07421 (Group 2) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3531; PCSK9 RNAi reagent AD08796 (Group 3) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 1393; PCSK9 RNAi reagent AD08838 (Group 4) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 1859; PCSK9 RNAi reagent AD08839 (Group 5) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3482; PCSK9 RNAi reagent AD08840 (Group 6) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3465; PCSK9 RNAi reagent AD08841 (Group 7) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 887; PCSK9 RNAi reagent AD08842 Group 8 includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3523 of the gene; PCSK9 RNAi reagent AD08843 (Group 9) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 1543 of the gene; PCSK9 RNAi reagent AD08844 (Group 10) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 1090 of the gene; PCSK9 RNAi reagent AD08845 (Group 11) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3548 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0289] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 22 below: Table 22. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 9.

[0290] Example 10. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0291] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 23 below, containing 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 23. Target locations and administration groups in Example 10. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3531 1.0 mg / kg AD07421 A single injection on day 1 3 3501 1.0 mg / kg AD08631 A single injection on day 1 4 3501 1.0 mg / kg AD09027 A single injection on day 1 5 3501 1.0 mg / kg AD09028 A single injection on day 1 6 3501 1.0 mg / kg AD09029 A single injection on day 1 7 3501 1.0 mg / kg AD09030 A single injection on day 1 8 3501 1.0 mg / kg AD09031 A single injection on day 1 9 3501 1.0 mg / kg AD09032 A single injection on day 1 10 3501 1.0 mg / kg AD09033 A single injection on day 1 11 3501 1.0 mg / kg AD09034 A single injection on day 1

[0292] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD07421 (Group 2) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3531; PCSK9 RNAi reagent AD08631 (Group 3) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3501; PCSK9 RNAi reagent AD09027 (Group 4) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3501; PCSK9 RNAi reagent AD09028 (Group 5) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3501; PCSK9 RNAi reagent AD09029 (Group 6) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3501; PCSK9 RNAi reagent AD09030 (Group 7) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3501; PCSK9 RNAi reagent AD09031 Group 8 includes a nucleotide sequence designed to inhibit PCKS9 gene expression at position 3501 of the gene; PCSK9 RNAi reagent AD09032 (Group 9) includes a nucleotide sequence designed to inhibit PCKS9 gene expression at position 3501 of the gene; PCSK9 RNAi reagent AD09033 (Group 10) includes a nucleotide sequence designed to inhibit PCKS9 gene expression at position 3501 of the gene; PCSK9 RNAi reagent AD09034 (Group 11) includes a nucleotide sequence designed to inhibit PCKS9 gene expression at position 3501 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0293] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 24 below: Table 24. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 10.

[0294] Example 11. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0295] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 25 below, containing 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 25. Target locations and administration groups in Example 11. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3531 1.0 mg / kg AD07421 A single injection on day 1 3 3547 1.0 mg / kg AD08837 A single injection on day 1 4 3547 1.0 mg / kg AD09038 A single injection on day 1 5 3547 1.0 mg / kg AD09039 A single injection on day 1 6 3547 1.0 mg / kg AD09040 A single injection on day 1 7 3547 1.0 mg / kg AD09041 A single injection on day 1 8 3486 1.0 mg / kg AD08835 A single injection on day 1 9 3486 1.0 mg / kg AD09042 A single injection on day 1 10 3486 1.0 mg / kg AD09043 A single injection on day 1

[0296] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD07421 (Group 2) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3531; PCSK9 RNAi reagent AD08837 (Group 3) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3547; PCSK9 RNAi reagent AD09038 (Group 4) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3547; PCSK9 RNAi reagent AD09039 (Group 5) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3547; PCSK9 RNAi reagent AD09040 (Group 6) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3547; PCSK9 RNAi reagent AD09041 (Group 7) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3547; PCSK9 RNAi reagent AD08835 Group 8 includes a nucleotide sequence designed to inhibit PCKS9 gene expression at position 3486 of the gene; PCSK9 RNAi reagent AD09042 (Group 9) includes a nucleotide sequence designed to inhibit PCKS9 gene expression at position 3486 of the gene; PCSK9 RNAi reagent AD09043 (Group 10) includes a nucleotide sequence designed to inhibit PCKS9 gene expression at position 3486 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0297] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 26 below: Table 26. Mean serum PCSK9 protein levels normalized to pre-treatment and control levels in hPCSK9 AAV mice from Example 11.

[0298] Example 12. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0299] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 27 below, containing 0.3 mg / kg or 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 27. Target locations and administration groups in Example 12. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 0.3 mg / kg AD08106 A single injection on day 1 3 3536 0.3 mg / kg AD07918 A single injection on day 1 4 3536 0.3 mg / kg AD09131 A single injection on day 1 5 3536 0.3 mg / kg AD09132 A single injection on day 1 6 3536 0.3 mg / kg AD08879 A single injection on day 1 7 3536 1.0 mg / kg AD08106 A single injection on day 1 8 3536 1.0 mg / kg AD07918 A single injection on day 1 9 3536 1.0 mg / kg AD09131 A single injection on day 1 10 3536 1.0 mg / kg AD09132 A single injection on day 1 11 3536 1.0 mg / kg AD08879 A single injection on day 1

[0300] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD08106 (Groups 2 and 7) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene; PCSK9 RNAi reagent AD07918 (Groups 3 and 8) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene; PCSK9 RNAi reagent AD09131 (Groups 4 and 9) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene; PCSK9 RNAi reagent AD09132 (Groups 5 and 10) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene; PCSK9 RNAi reagent AD08879 (Groups 6 and 11) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0301] Injections were performed in loose skin in the neck and shoulder areas between the skin and muscle (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 28 below: Table 28. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 12.

[0302] As shown in Table 28, each PCSK9 RNAi reagent silenced PCSK9 gene expression. In particular, on day 22, PCSK9 RNAi reagent AD08870 was the most potent PCSK9 RNAi reagent tested, exhibiting a dose-response effect with approximately 63% (0.369) reduction in PCSK9 protein when administered as a single dose of 0.3 mg / kg and approximately 80% (0.199) reduction in PCSK9 protein when administered as a single dose of 1.0 mg / kg.

[0303] Example 13. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0304] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 29 below, containing 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 29. Target locations and dosing groups in Example 13. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3523 0.3 mg / kg AD09059 A single injection on day 1 3 3523 1.0 mg / kg AD09059 A single injection on day 1 4 3523 3.0 mg / kg AD09059 A single injection on day 1 5 3486 0.3 mg / kg AD09042 A single injection on day 1 6 3486 1.0 mg / kg AD09042 A single injection on day 1 7 3486 3.0 mg / kg AD09042 A single injection on day 1 8 3531 0.3 mg / kg AD07421 A single injection on day 1 9 3531 1.0 mg / kg AD07421 A single injection on day 1 10 3531 3.0 mg / kg AD07421 A single injection on day 1 11 3523 0.3 mg / kg AD08842 A single injection on day 1 12 3523 1.0 mg / kg AD08842 A single injection on day 1

[0305] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD09059 (Groups 2, 3, and 4) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3523 of the gene; PCSK9 RNAi reagent AD09042 (Groups 5, 6, and 7) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3486 of the gene; PCSK9 RNAi reagent AD09131 (Groups 8, 9, and 10) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3531 of the gene; PCSK9 RNAi reagent AD08842 (Groups 11 and 12) includes a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3523 of the gene. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO: 1 and Table 2).

[0306] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice (n=4) were tested in each of groups 1–11, and three (3) mice (n=3) were tested in group 12. Serum was collected on day 1 (before treatment), day 9, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 30 below: Table 30. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 13.

[0307] Example 14. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0308] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 31 below, containing 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 31. Target locations and administration groups in Example 14. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 0.3 mg / kg AD08110 A single injection on day 1 3 3536 1.0 mg / kg AD08110 A single injection on day 1 4 3536 3.0 mg / kg AD08110 A single injection on day 1 5 3535 0.3 mg / kg AD09549 A single injection on day 1 6 3535 1.0 mg / kg AD09549 A single injection on day 1 7 3535 3.0 mg / kg AD09549 A single injection on day 1 8 3535 0.3 mg / kg AC001566 A single injection on day 1 9 3535 1.0 mg / kg AC001566 A single injection on day 1 10 3535 3.0 mg / kg AC001566 A single injection on day 1

[0309] PCSK9 RNAi reagent AD08110 comprises modified nucleotides conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the duplex structure herein. (For specific modification and structural information including the (NAG37)s ligand, see Tables 3, 4, 5A, 5B, 5C, and 6). PCSK9 RNAi reagent AD08110 (Groups 2, 3, and 4) comprises nucleotide sequences designed to inhibit PCSK9 gene expression at position 3536 of the gene; duplex AD09549 (Groups 5, 6, and 7) comprises nucleotide sequences designed to inhibit PCSK9 gene expression at position 3535 of the gene; duplex AC001566 (Groups 8, 9, and 10) comprises nucleotide sequences designed to inhibit PCSK9 gene expression at position 3535 of the gene. (For information on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0310] The double-stranded form AD09549 includes the following modified nucleotide sequences: antisense chain (5') 3'): asGfsuuaCfaaaagcaAfaAfcagsgsu (SEQ ID NO: 466) There is a semantic chain (5') 3'): (NAG37)csusguuuUfGfCfuuuuguaacu (SEQ ID NO: 467) (See Table 6 for the structure of the (NAG37) target ligand).

[0311] The double-stranded AC001566 includes the following modified nucleotide sequences: antisense chain (5') 3'): asGfsuuaCfaaaagcaAfaAfcagsgsu (SEQ ID NO: 468) There is a semantic chain (5') 3'): csusguuuUfGfCfuuuuguaacu(C6-NH)-Tri-NAG-PEG4 (SEQ ID NO: 469). A sense chain with a commercially available C6-amino linker at the 3' end was synthesized to facilitate bonding with a trivalent N-acetyl-galactosamine targeting ligand formulated with a terminal azide, resulting in a molecule with the following structure: (Tri-NAG-PEG4).

[0312] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 32 below: Table 32. Mean serum PCSK9 protein levels normalized to pre-treatment and control levels in hPCSK9 AAV mice from Example 14.

[0313] As shown in Table 32 above, the PCSK9 RNAi agent AD8110, targeting position 3536 of the PCSK9 gene, demonstrated superiority over AD09549 and AC001566 in inhibiting PCSK9 gene expression at all dose levels. For example, a 3.0 mg / kg dose of AD08110 reduced PCSK9 protein expression by more than 90% on day 8 (~91% reduction), day 15 (~93% reduction), and day 22 (~93% reduction).

[0314] Example 15. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0315] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 33 below, containing 0.3 mg / kg or 1.0 mg / kg (mpk) of PCSK9 RNAi reagent prepared in isotonic saline, or a mediator control (isotonic saline without RNAi reagent): Table 33. Target locations and dosing groups in Example 15. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 0.3 mg / kg AD09327 A single injection on day 1 3 3536 0.3 mg / kg AD09851 A single injection on day 1 4 3536 0.3 mg / kg AD09852 A single injection on day 1 5 3536 0.3 mg / kg AD09853 A single injection on day 1 6 3536 0.3 mg / kg AD09854 A single injection on day 1 7 3536 0.3 mg / kg AD09855 A single injection on day 1 8 3536 1.0 mg / kg AD09327 A single injection on day 1 9 3536 1.0 mg / kg AD09851 A single injection on day 1 10 3536 1.0 mg / kg AD09852 A single injection on day 1 11 3536 1.0 mg / kg AD09853 A single injection on day 1 12 3536 1.0 mg / kg AD09854 A single injection on day 1

[0316] Each PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents that include (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). Each PCSK9 RNAi reagent tested in this embodiment comprises a nucleotide sequence designed to inhibit PCSK9 gene expression at position 3536 of the gene, and was tested by a single injection at 0.3 mg / kg or 1.0 mg / kg (AD09327 (groups 2 and 8); AD09851 (groups 3 and 9); AD09852 (groups 4 and 10); AD09853 (groups 5 and 11); AD09854 (groups 6 and 12), except for group 7, AD09855, which was administered only at 0.3 mg / kg. (For reference on the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2).

[0317] Injections were performed in loose skin in the neck and shoulder areas between the skin and muscle (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 34 below: Table 34. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 15.

[0318] As shown in Table 34, each PCSK9 RNAi reagent silences PCSK9 gene expression, with AD09327 showing the largest reduction in PCSK9 protein at the lowest dose level (0.3 mg / kg).

[0319] Example 16. In vivo testing of PCSK9 RNAi reagent in hPCSK9 AAV mice.

[0320] The hPCSK9 AAV mouse model described in Example 2 above used hPCSK9 AAV containing the 291-3637 region of the human PCSK9 cDNA sequence. On day 1, each mouse was given a single subcutaneous administration of 250 μl / 25 g animal weight, according to Table 35 below, containing 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg (mpk) of PCSK9 RNAi reagent, Leqvio® (Novartis Pharmaceuticals Corporation), or a mediator control (isotonic saline without RNAi reagent): Table 35. Target locations and dosing groups in Example 16. Group Target gene location (within SEQ ID NO:1) RNAi reagents and dosage Dosing regimen 1 N / A Saline solution (without RNAi reagent) A single injection on day 1 2 3536 0.3 mg / kg AD09327-ETT A single injection on day 1 3 3536 1.0 mg / kg AD09327-ETT A single injection on day 1 4 3536 3.0 mg / kg AD09327-ETT A single injection on day 1 5 3536 0.3 mg / kg AD09327-DCI A single injection on day 1 6 3536 1.0 mg / kg AD09327-DCI A single injection on day 1 7 3536 3.0 mg / kg AD09327-DCI A single injection on day 1 8 0.3 mg / kg Leqvio® A single injection on day 1 9 1.0 mg / kg Leqvio® A single injection on day 1 10 3.0 mg / kg Leqvio® A single injection on day 1 11 3536 0.3 mg / kg AD08879 A single injection on day 1 12 3536 1.0 mg / kg AD08879 A single injection on day 1

[0321] Leqvio® is commercially available. Leqvio®, or inclisiran, is a long-acting RNA interference (RNAi) therapeutic agent that inhibits the synthesis of PCSK9, which is a target for lowering low-density lipoprotein (LDL) cholesterol (Fitzgerald et al., A Highly Durable RNAi Therapeutic Inhibitor of PCSK9, N EnglJ Med. 2017 Jan 5; 376(1): 41–51).

[0322] Each PCSK9 RNAi reagent tested comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents including (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, and 6). Both PCSK9 RNAi reagents AD09327 (groups 2–7) and AD08879 (groups 11 and 12) comprise a nucleotide sequence designed to repress PCSK9 gene expression at position 3536 of the gene. (For the PCSK9 gene mentioned, see, for example, SEQ ID NO:1 and Table 2). Groups designated with “ETT” and “DCI” indicate PCSK9 RNAi reagents synthesized using the respective ETT and DCI activator reagents.

[0323] Injections were performed between the skin and muscle in the loose skin of the neck and shoulder areas (i.e., subcutaneous injections). Four (4) mice in each group were tested (n=4). Serum was collected on day 1 (before treatment), day 8, day 15, and day 22, and PCSK9 expression levels were determined according to the procedure described in Example 2 above. Data from the experiments are shown in Table 36 below: Table 36. Mean serum PCSK9 protein levels normalized to pre-treatment and control in hPCSK9 AAV mice from Example 16.

[0324] As shown in Table 36, in the hPCSK9 AAV mouse model used in this specific study, the PCSK9 RNAi reagent AD09327 (whether -ETT or -DCI) showed improved PCSK9 inhibition across all dose levels compared to commercially available Leqvio® products.

[0325] Example 17. In vivo testing of the PCSK9 RNAi reagent in cynomolgus monkeys.

[0326] PCSK9 RNAi reagents AD07918 and AD09327 were evaluated in cynomolgus monkeys (cynos). On day 1, three female cynomolgus monkeys (n=3) in each group were administered a subcutaneous injection of 0.3 mL / kg of PCSK9 RNAi reagent prepared in isotonic saline. The subcutaneous dose was administered via syringe and needle into the mid-scapular region.

[0327] Table 37. Target locations and dosing groups in Example 17. Group Target gene location (within SEQ ID NO: 1) RNAi reagents and dosage Dosing regimen (on day 1) 1 3536 3.0 mg / kg AD07918 Single subcutaneous injection 2 3536 3.0 mg / kg AD09327 Single subcutaneous injection

[0328] The PCSK9 RNAi reagent comprises a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to the PCSK9 RNAi reagent including the (NAG37)s ligand, see Tables 3, 4, 5A, 5B, 5C, 6, 7A, 7B, and 8). The PCSK9 RNAi reagent comprises a nucleotide sequence designed to repress human PCSK9 gene expression at position 3536. (See, for example, SEQ ID NO:1).

[0329] The cynomolgus monkeys were fasted overnight before each blood collection. Blood (approximately 5 mL) from each animal was collected from the femoral vein (or other vein) into a non-anticoagulant tube (serum separation tube) at -14 days (before dose), -7 days (before dose), 1 day (before dose), 8 days, 15 days, 22 days, 29 days, 43 days, 57 days, 71 days, and 85 days. An alternative vein not used for administration could be used as an alternative blood collection site. Pre-dose blood samples were collected from any additional animals available.

[0330] Serum samples collected from cynomolgus monkeys were quantified for human PCSK9 protein levels via ELISA using the Human Proprotein Convertase 9 / PCSK9 Quantikine Elisa Kit (catalog #DPC900, R&D Systems, Inc.). PCSK9 expression levels were normalized to mean PCSK9 levels prior to dose, as shown in Table 38 below.

[0331] Table 38. Mean serum PCSK9 expression levels before treatment in cynomolgus monkeys from Example 17.

[0332] The levels of low-density lipoprotein (LDL) and non-high-density lipoprotein (HDL) cholesterol were quantified and standardized against pre-dose average levels. This data is shown in Table 39 below.

[0333] Table 39. Normalized mean serum LDL and non-HDL cholesterol PCSK9 levels in cynomolgus monkeys from Example 17, before treatment and in control.

[0334] As shown in Table 38, both PCSK9 RNAi agents stably silenced PCSK9 protein expression, with AD09327 being more potent and showing approximately 82% inhibition by a single 3.0 mg / kg dose on day 22, and further showing a significant reduction of nearly 50% on day 85 post-dose administration. Furthermore, as shown in Table 39, both PCSK9 RNAi agents stably reduced LDL and non-HDL cholesterol levels, again with AD09327 being more robust and showing approximately 61% (0.387) reduction in LDL on day 29 and approximately 60% (0.398) reduction in non-HDL cholesterol on day 22.

[0335] Example 18. In vivo testing of the PCSK9 RNAi reagent in cynomolgus monkeys.

[0336] PCSK9 RNAi reagents AD08879 and AD09327, Leqvio®, and AC001566 were evaluated in cynomolgus monkeys (cynos). On days 1 and 29, three male cynomolgus monkeys (n=3) in each group were administered a subcutaneous injection of 0.2 mL / kg of PCSK9 RNAi reagent prepared in isotonic saline. The subcutaneous dose was administered via syringe and needle into the mid-scapular region.

[0337] Table 40. Target location and administration group of Example 18. Group Target gene location (within SEQ ID NO: 1) RNAi reagents and dosage Dosing regimen (on day 1 and day 29) 1 3536 2.0 mg / kg AD08879 Two subcutaneous injections 2 3536 2.0 mg / kg AD09327 Two subcutaneous injections 3 2.0 mg / kg Leqvio® Two subcutaneous injections 4 3535 2.0 mg / kg AC001566 Two subcutaneous injections

[0338] PCSK9 RNAi reagents comprise modified nucleotides conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) comprising three N-acetyl-galactosamine groups, having the modified sequence shown in the double-stranded structure herein. (For specific modification and structural information relating to PCSK9 RNAi reagents comprising (NAG37)s ligands, see Tables 3, 4, 5A, 5B, 5C, 6, 7A, 7B, and 8). PCSK9 RNAi reagents AD08879 and AD09327 comprise nucleotide sequences designed to repress human PCSK9 gene expression at position 3536. (See, for example, SEQ ID NO:1).

[0339] AC001566 includes the structure described in Example 14 above.

[0340] The cynomolgus monkeys were fasted overnight before each blood collection. Blood (approximately 5 mL) from each animal was collected from the femoral vein (or other vein) into a non-anticoagulant tube (serum separator) on day -8 (before dose), day 1 (before dose), day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57, day 71, day 85, day 99, and day 113. Another vein not used for administration could be used as an alternative blood collection site. Pre-dose blood samples were collected from any additional animals available.

[0341] Serum samples collected from cynomolgus monkeys were quantified for human PCSK9 protein levels via ELISA using the Human Proprotein Convertase 9 / PCSK9 Quantikine Elisa Kit (catalog #DPC900, R&D Systems, Inc.). PCSK9 expression levels were normalized to mean PCSK9 levels prior to dose, as shown in Table 41 below.

[0342] Table 41. Mean serum PCSK9 expression levels before treatment in cynomolgus monkeys from Example 18.

[0343] The levels of low-density lipoprotein (LDL) and non-high-density lipoprotein (HDL) cholesterol were quantified and standardized against pre-dose average levels. This data is shown in Table 42 below.

[0344] Table 42. Normalized mean serum LDL and non-HDL cholesterol PCSK9 levels in cynomolgus monkeys from Example 18, before treatment and in control.

[0345] Other implementation plans It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing specification is intended to illustrate, and not limit, the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

Claims

1. An RNAi agent for inhibiting expression of a PCSK9 gene, comprising: an antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of an antisense strand sequence of Table 2, Table 3, Table 5C, Table 7A, or Table 8; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides of the antisense strand and / or sense strand are modified nucleotides, and the RNAi agent is linked to a targeting ligand comprising N-acetyl-galactosamine.

2. The RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides that differs by 0 or 1 nucleotides from the 15 contiguous nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5C, Table 7B, or Table 8, and wherein the sense strand has a region of at least 85% complementarity to the antisense strand over at least 15 contiguous nucleotides.

3. The RNAi agent of any one of claims 1-2, wherein at least one nucleotide of the RNAi agent comprises a modified internucleoside linkage.

4. The RNAi agent of any one of claims 1-3, wherein the modified nucleotides are independently selected from the group consisting of: 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F- arabinose nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribo-ols, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate containing nucleotides, cyclopropyl phosphonate containing nucleotides, and 3'-O-methyl nucleotides.

5. The RNAi agent of claim 4, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

6. The RNAi agent of any one of claims 1-5, wherein the antisense strand consists or consists essentially of the nucleotide sequence of any one of the modified antisense strand sequences of Table 3, Table 5C, Table 7A, or Table 8.

7. The RNAi agent of any one of claims 1-6, wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences of Table 4, Table 5C, Table 7B, or Table 8.

8. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences of Table 3, Table 5C, Table 7A, or Table 8, and the sense strand comprises the nucleotide sequence of any one of the modified sequences of Table 4, Table 5C, Table 7B, or Table 8.

9. The RNAi agent of any one of claims 1-8, wherein the targeting ligand comprises the following structure: , or , or a pharmaceutically acceptable salt thereof.

10. The RNAi agent of any one of claims 1-9, wherein the targeting ligand is linked to the sense strand.

11. The RNAi agent of claim 10, wherein the targeting ligand is linked to the 5’ terminal end of the sense strand.

12. The RNAi agent of any one of claims 1-11, wherein the sense strand is 15 to 30 nucleotides in length and the antisense strand is 21 to 30 nucleotides in length.

13. The RNAi agent of claim 12, wherein the sense and antisense strands are each 21 to 27 nucleotides in length.

14. The RNAi agent of claim 13, wherein the sense and antisense strands are each 21 to 24 nucleotides in length.

15. The RNAi agent of claim 14, wherein the sense and antisense strands are each 21 nucleotides in length.

16. The RNAi agent of any one of claims 1-15, wherein the RNAi agent has two blunt ends.

17. The RNAi agent of any one of claims 1-16, wherein the sense strand comprises one or two terminal caps.

18. The RNAi agent of any one of claims 1-17, wherein the sense strand comprises one or two inverted abasic residues.

19. The RNAi agent of claim 1, wherein the RNAi agent consists of a sense strand and an antisense strand that form the duplex sequence of any duplex listed in Table 5A, 5B, 5C, or 8.

20. The RNAi agent of any one of claims 1-19, wherein the RNAi agent is a pharmaceutically acceptable salt.

21. The RNAi agent of claim 20, wherein the RNAi agent is a sodium salt.

22. The RNAi agent of any one of claims 1-21, wherein the RNAi agent comprises an antisense strand comprising or consisting of the nucleotide sequence of SEQ ID NO: 401 and a sense strand comprising or consisting of the nucleotide sequence of SEQ ID NO:

430.

23. The RNAi agent of claim 22, wherein the RNAi agent comprises a modified antisense strand comprising or consisting of the nucleotide sequence of SEQ ID NO: 309 and a modified sense strand comprising or consisting of the nucleotide sequence of SEQ ID NO:

368.

24. A composition comprising the RNAi agent of any one of claims 1-23, wherein the composition comprises a pharmaceutically acceptable excipient.

25. The composition of claim 24, wherein the pharmaceutically acceptable excipient is a sodium phosphate buffer.

26. The composition of claim 25, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

27. A method for inhibiting PCSK9 gene expression in a liver cell, the method comprising introducing into the cell an effective amount of the RNAi agent of any one of claims 1-23 or the composition of any one of claims 24-26.

28. The method of claim 27, wherein the subject is a human subject.

29. The method of any one of claims 27-28, wherein the PCSK9 mRNA level is reduced in the liver cell or subject by at least about 50%.

30. The method of any one of claims 27-29, wherein the PCSK9 protein level is reduced in the liver cell or subject by at least about 50%.

31. A method of treating a PCSK9-related disease, disorder, or symptom, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 24-26.

32. The method of claim 31, wherein the disease is hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial low beta lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD).

33. The method of any one of claims 27-32, wherein the level of serum PCSK9 protein is reduced in the subject.

34. The method of any one of claims 27-33, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of body weight of the human subject.

35. Use of the RNAi agent of any one of claims 1-23 or the composition of any one of claims 24-26 for the treatment of a disease, disorder, or symptom mediated at least in part by a reduction in PCSK9 gene expression.

36. The use of claim 35, wherein the disease is hypercholesterolemia, familial hypercholesterolemia including heterozygous familial hypercholesterolemia (HeFH) and homozygous familial hypercholesterolemia (HoFH), familial low beta lipoproteinemia, hyperlipidemia, coronary artery disease, polygenic dyslipidemia, heart disease, cardiovascular disease (CVD) including clinical atherosclerotic cardiovascular disease (ASCVD), and / or other PCSK9-related diseases.

37. Use of the RNAi agent of any one of claims 1-23 or the composition of any one of claims 24-26 for the manufacture of a pharmaceutical composition for the treatment of a disease, disorder, or symptom mediated at least in part by a reduction in PCSK9 gene expression.

38. The use of any one of claims 35-37, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of the human subject’s body weight.

Images