Use of LSR, LncRNA-LSR-AS1 or targeted siRNA in prevention and / or treatment of hyperlipidemia or diseases related thereto
By targeting siRNA to inhibit LncRNA-LSR-AS1 expression and promoting LSR expression, the problem of large side effects and poor efficacy of existing drugs in the treatment of hyperlipidemia has been solved, and effective treatment of hyperlipidemia has been achieved.
Patent Information
- Application Number
- CN202511008101.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-22
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2045-07-22
AI Technical Summary
Existing drugs for treating hyperlipidemia have significant side effects and poor efficacy, especially for patients with familial hypercholesterolemia, and there is a lack of drugs that can directly regulate lipoprotein receptors (LSR) to lower lipids.
By targeting siRNA to inhibit the expression of LncRNA-LSR-AS1 and promoting the expression of LSR, serum cholesterol, triglycerides and low-density lipoprotein levels are reduced. Chemically modified siRNAs are used to enhance stability and efficacy, and pharmaceutically acceptable targeting groups are used for delivery to the liver.
It significantly reduces serum total cholesterol, triglycerides, and low-density lipoprotein levels, and reduces lipid deposition in the liver, providing a treatment option for hyperlipidemia with few side effects and effectiveness.
Smart Images

Figure CN120505318B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology and relates to the application of LSR, LncRNA-LSR-AS1 or targeted siRNA in the prevention and / or treatment of hyperlipidemia or related diseases. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Hyperlipidemia, also known as dyslipidemia, typically refers to elevated levels of triglycerides and / or total cholesterol, elevated low-density lipoprotein cholesterol (LDL-C), and decreased high-density lipoprotein cholesterol (HDL-C) in blood plasma. The causes of this condition include gene mutations, various environmental factors such as poor dietary habits, insufficient physical activity, and obesity, as well as other diseases such as diabetes, nephrotic syndrome, and liver disease. These abnormal lipid levels lead to lipid deposition in the arteries, accelerating the process of atherosclerosis and increasing the risk of cardiovascular events such as coronary heart disease, myocardial infarction, and stroke. Therefore, effective treatment of hyperlipidemia is crucial for preventing cardiovascular disease in patients.
[0004] Hyperlipidemia can be classified into primary hyperlipidemia and secondary hyperlipidemia according to its etiology. Familial hypercholesterolemia (FH) is a type of primary hyperlipidemia, a hereditary disease characterized by mutations in specific genes. The most prominent feature of this condition is a significant increase in low-density lipoprotein cholesterol (LDL) levels. It is now clear that the pathogenic mutations in FH mainly occur in the genes for low-density lipoprotein receptor (LDLR), apolipoprotein B (ApoB), proprotein convertase subtilisin 9 (PCSK9), and LDLR adaptor protein 1 (LDLRAP1), with over 80% being LDLR mutations. Drug treatment for hyperlipidemia is crucial for reducing cardiovascular risk and requires individualized medication based on the type of dyslipidemia, the severity of the condition, and tolerance. Statins are first-line drugs that significantly lower LDL by inhibiting cholesterol synthesis and mildly regulate TG and HDL, making them suitable for patients with predominantly elevated LDL. However, they have side effects such as hepatotoxicity, muscle-related adverse reactions (e.g., myalgia, rhabdomyolysis), and potential hyperglycemia. Fibrates activate PPAR-α, significantly lowering triglycerides (TG) and are used for hypertriglyceridemia. Gastrointestinal reactions are common, and caution is needed regarding the risk of myopathy when used in combination with statins. Niacin can increase HDL, and due to side effects such as facial flushing, elevated blood glucose, and increased uric acid, it is not currently the first-line treatment. PCSK9 inhibitors, as potent lipid-lowering drugs, lower LDL by targeting PCSK9 and are suitable for refractory hyperlipidemia; however, they require long-term injections, are costly, and their long-term safety remains to be verified. Furthermore, PCSK9 inhibitors are not effective in treating patients with familial hypercholesterolemia. Therefore, there is an urgent need to develop novel drugs for the treatment of hyperlipidemia to address these shortcomings. Summary of the Invention
[0005] Lipolysis-activated lipoprotein receptors (LSRs) are three-cell tight junction (tTJ) molecules located in most epithelial tissues, belonging to the angulin family, and are newly discovered tTJ molecules. Studies have found that LSRs have a high affinity for triglyceride-rich lipoproteins, chylomicrons (CMs), and low-density lipoproteins (LDLs), helping to clear residual CMs and triglyceride-rich lipoproteins from the blood. In the presence of free fatty acids, LSRs recognize apolipoprotein B and apolipoprotein E (ApoE), leading to lipoprotein particle internalization and degradation. Currently, there are no drugs that exert lipid-lowering effects by directly or indirectly regulating LSRs.
[0006] Further research in this invention shows that overexpression of the LSR gene can promote the uptake and degradation of low-density lipoprotein by hepatocytes. Using high-fat diet mice, LDLR knockout mice, and LDLR heterozygous mouse models, AAV-LSR significantly reduced serum total cholesterol (T-CHO), triglycerides (TG), LDL, and very low-density lipoprotein (vLDL) levels, and reduced hepatic lipid deposition. In particular, its efficacy was significantly better than PCSK9 inhibitors in LDLR-deficient FH mice, indicating that LSR can serve as a target for the prevention and / or treatment of hyperlipidemia or related diseases. Secondly, further research in this invention found that long non-coding RNA (LncRNA, ENST00000685454.2, named LncRNA-LSR-AS1 in this invention) can reduce LSR expression. By inhibiting LncRNA-LSR-AS1 expression, LSR expression can be promoted, thereby achieving the effect of preventing or treating hyperlipidemia or related diseases. Therefore, LncRNA-LSR-AS1 can also serve as a target for the prevention and / or treatment of hyperlipidemia or related diseases. Based on LncRNA-LSR-AS1 as a target, this invention further provides small interfering RNA (siRNA) that can inhibit the expression of LncRNA-LSR-AS1 to promote LSR expression, thereby achieving the prevention and / or treatment of hyperlipidemia or its related diseases.
[0007] Based on the above research findings, the purpose of this invention is to provide the application of LSR, LncRNA-LSR-AS1 or targeted siRNA in the prevention and / or treatment of hyperlipidemia or its related diseases.
[0008] Specifically, the technical solution provided by the present invention is as follows: In a first aspect, a targeting siRNA, wherein the targeting siRNA can induce the degradation of LncRNA-LSR-AS1 or inhibit its expression by specifically binding to LncRNA-LSR-AS1, thereby reducing the level of LncRNA-LSR-AS1, wherein LncRNA-LSR-AS1 is an LncRNA with the sequence shown in SEQ ID NO.20.
[0009] In some implementations, the targeting siRNA is a double-stranded RNA of 17–25 nucleotides, with its sense strand sequence as described in any of the following:
[0010] (a1) has a nucleotide sequence as shown in SEQ ID NO.X, where X is an odd number from 27 to 55;
[0011] (a2) Having a nucleotide sequence that is at least 90% identical to the nucleotide sequence described in (a1) or has at least 15 consecutive nucleotides;
[0012] (a3) A nucleotide sequence having at least 70% identity with the nucleotide sequence described in (a1) and retaining the biological function of the sequence from which it is derived;
[0013] Its antisense chain sequence is as described in any of the following:
[0014] (b1) Has a nucleotide sequence as shown in SEQ ID NO.(X+1), where X is an odd number from 27 to 55;
[0015] (b2) Having a nucleotide sequence that is at least 90% identical to the nucleotide sequence described in (b1) or has at least 15 consecutive nucleotides;
[0016] (b3) A nucleotide sequence having at least 70% identity with the nucleotide sequence described in (b1) and retaining the biological function of the sequence from which it is derived.
[0017] In one or more embodiments, X is 27, 29, 31, 33, 35, 39, 43, 49, or 51. That is, the sense and antisense strands comprise nucleotide sequences selected from the following:
[0018] si-6:
[0019] Chain of Justice: ACGUUCUCCGGCCGGCGGC, as shown in SEQ ID NO.27;
[0020] Antonym: GCCGCCGGCCGGAGAACGUUU, as shown in SEQ ID NO.28;
[0021] si-26:
[0022] Chain of Justice: CGGGCGCGGGCCGGGCCAG, as shown in SEQ ID NO.29;
[0023] Antonym: CUGGCCCGGCCCGCGCCCGUU, as shown in SEQ ID NO.30;
[0024] si-43:
[0025] Chain of Justice: AGGCUGGGUCUCUUCCUCC, as shown in SEQ ID NO.31;
[0026] Antonym chain: GGAGGAAGAGACCCAGCCUUU, as shown in SEQ ID NO.32;
[0027] si-69:
[0028] Chain of Justice: GGACUCCGGUGCCCCCGGG, as shown in SEQ ID NO.33;
[0029] Antonyms: CCCGGGGGCACCGGAGUCCUU, as shown in SEQ ID NO.34;
[0030] si-87:
[0031] Chain of Justice: GACGCGGCGCUUUACAGAC, as shown in SEQ ID NO.35;
[0032] Antonym chain: GUCUGUAAAGCGCCGCGUCUU, as shown in SEQ ID NO.36;
[0033] si-131:
[0034] Chain of Justice: CGCCCCGCGCGGCCGAACA, as shown in SEQ ID NO.39;
[0035] Antonyms: UGUUCGGCCGCGCGGGGCGUU, as shown in SEQ ID NO.40;
[0036] si-151:
[0037] Chain of Justice: AUGGUUCUCUCCAGAGCUU, as shown in SEQ ID NO.43;
[0038] Antonym chain: AAGUCUGGAGAGAACCAUUU, as shown in SEQ ID NO.44;
[0039] si-190:
[0040] Chain of Justice: ACUCGGGAGGGGUAUGGCA, as shown in SEQ ID NO.49;
[0041] Antonym chain: UGCCAUACCCCUCCCGAGUUU, as shown in SEQ ID NO.50;
[0042] si-214:
[0043] Chain of Justice: UCAUCAGUGUUCCUUCAAA, as shown in SEQ ID NO.51;
[0044] Antonym chain: UUUGAAGGAACACUGAUGAUU, as shown in SEQ ID NO.52.
[0045] Wherein, C, G, U, and A represent cytidine-3'-phosphate, guanosine-3'-phosphate, uridine-3'-phosphate, and adenosine-3'-phosphate, respectively.
[0046] In one or more embodiments, the positive strand sequence has a nucleotide sequence as shown in SEQ ID NO.43.
[0047] In one or more embodiments, the antisense strand sequence has a nucleotide sequence as shown in SEQ ID NO.44.
[0048] In a second aspect, a modified siRNA is obtained by chemically modifying the sense and / or antisense strands of the targeting siRNA described in the first aspect of the present invention.
[0049] The purpose of chemically modifying the sense and / or antisense strands of the target siRNA in this invention is to: prevent the target siRNA from being degraded by nucleases while ensuring its activity, so as to ensure RNA interference (RNAi) of the target LncRNA-LSR-AS1; and / or to increase the base interaction with the target LncRNA-LSR-AS1, thereby enhancing RNAi of the target LncRNA-LSR-AS1.
[0050] During the catalytic degradation of siRNA by nucleases, firstly, the main target of nucleases is the phosphodiester backbone; secondly, siRNA is RNA, and its unique 2'-OH group can directly participate in nucleophilic attack under the catalysis of nucleases, such as attacking phosphate groups, breaking the phosphodiester bond and forming a cyclic phosphodiester, which then forms hydrolysis products under the action of a base; thirdly, some nucleases use specific bases as recognition active sites.
[0051] Since nucleases primarily target the phosphodiester backbone, the chemical modifications described in this invention include backbone modifications of the sense and / or antisense strands. The central target of nuclease attacks on the phosphodiester backbone is the phosphorus atom; even slight alterations to this atom can significantly affect the enzyme's degradation activity. Therefore, the most studied backbone modifications are those targeting the phosphorus atom, such as thiomodification (i.e., modifying the phosphodiester bond to a thiophosphate-diester bond (the modified nucleotide is a thiophosphate-modified nucleotide)). This enhances the siRNA's resistance to nucleases and increases its stability. Backbone modifications include, but are not limited to, thiophosphate modification, dithiophosphate modification, methylphosphonate modification, methoxypropyl phosphate modification, boron phosphate modification, fluorophosphate modification, and aminophosphate modification.
[0052] Because the 2'-OH of siRNA undergoes nucleophilic attack under the catalysis of nucleases, triggering subsequent reactions and leading to degradation, the chemical modification described in this invention includes ribose modification. Ribosugar modification primarily involves modification of the chemical group at the 2' position of the ribose. Specifically, modification of the chemical group at the 2' position of the ribose refers to converting the hydroxyl group at the 2' position of the ribose into other chemical groups, such as H (i.e., deoxynucleotide), halogens (fluorine, chlorine, bromine, iodine, etc.), alkyl groups (e.g., methyl, ethyl, propyl, etc., C1-C6 alkyl groups), alkenyl groups (e.g., vinyl, propenyl, allyl, etc., C2-C6 alkenyl groups), substituted alkyl groups (e.g., halogens (fluorine, chlorine, bromine, iodine), hydroxyl, nitro, amino, C1-C6 alkoxy-substituted alkyl groups, wherein the alkyl group can be methyl, ethyl, propyl, etc., C1-C6 alkyl groups), and alkoxy groups (e.g., methoxy, ethoxy, propoxy, etc., C1-C6 alkyl groups). The introduction of other chemical groups at the 2' position of ribose, such as 1-C6 alkoxy groups, substituted alkoxy groups (e.g., halogens (fluorine, chlorine, bromine, iodine), hydroxyl groups, nitro groups, amino groups, C1-C6 alkoxy-substituted alkoxy groups (where alkoxy groups are as described above), amino groups, azide groups, arasyl groups, substituted arasyl groups (arasyl groups containing halogen (fluorine, chlorine, bromine, iodine) and substituted amino groups (e.g., C1-C6 alkyl mono- or di-substituted amino groups), not only affects the nucleophilic attack performance of 2'-OH, but also increases steric hindrance, making siRNA more resistant to nuclease hydrolysis.
[0053] The chemical modifications described in this invention also include base modifications, which enhance the interactions between bases and thus increase the effect on target mRNA. Base modifications include, but are not limited to, methyl, halogen, alkyne, thio, fluorine, azide, and amino modifications. The modified nucleotides can be ablation nucleotides, morpholinonucleotides, locked nucleotides, etc.
[0054] In some implementations, the siRNA modifiers are represented by formula (I):
[0055] Justice Chain: 5'-np-Na-YYY-Nb-nq-3'
[0056] Antonym chain: 3'-np'-Na'-Y'Y'Y'-Nb'-nq'-5' (I)
[0057] in:
[0058] np, np', nq, and nq' are 0 to 2 nucleotides respectively; each nucleotide is linked to an adjacent nucleotide via a phosphate thioester bond.
[0059] Na, Nb, Na', and Nb' each independently represent an oligonucleotide sequence, wherein the oligonucleotide sequence is a sequence containing 0-25 nucleotides and the sequence contains at least two different types of modified nucleotides;
[0060] YYY and Y'Y'Y' each independently represent a motif, which consists of three consecutive nucleotides, each of which undergoes the same chemical group modification. Specifically, the modification is a 2'-O-methyl or a 2'-fluorine modification.
[0061] In some implementations, the YYY motif appears at or near the cut site of the justice chain.
[0062] The siRNA provided by this invention has a motif (i.e., YYY) in which three consecutive nucleotides are modified with the same chemical group (especially 2'-O-methyl modification (methoxy modification at the 2' position of ribose) or 2'-fluorine modification (fluorine modification at the 2' position of ribose)). This motif can effectively increase the resistance of siRNA to nuclease degradation and enhance the binding stability with the target siRNA. For example, in the sense strand of S1 obtained by chemically modifying the sequence shown in SEQ ID NO.43, nucleotides 10-12 are YYY, and all YYY are modified with 2' methoxy groups; in the antisense strand of S1 obtained by chemically modifying the sequence shown in SEQ ID NO.44, nucleotides 11-13 are Y'Y'Y', and all Y'Y'Y' are modified with 2' methoxy groups; in the sense strand of S2 obtained by chemically modifying the sequence shown in SEQ ID NO.43, nucleotides 9-11 are YYY, and all YYY are modified with 2' fluorination; in the antisense strand of S2 obtained by chemically modifying the sequence shown in SEQ ID NO.44, nucleotides 8-11 are Y'Y'Y', and all Y'Y'Y' are modified with 2' fluorination; in the sense strand of S3 obtained by chemically modifying the sequence shown in SEQ ID NO.43, nucleotides 9-11 are YYY, and all YYY are modified with 2' fluorination; in the sense strand of S3 obtained by chemically modifying the sequence shown in SEQ ID NO.43, nucleotides 9-11 are YYY, and all YYY are modified with 2' fluorination; in the sense strand of S1 obtained by chemically modifying the sequence shown in SEQ ID NO.43, nucleotides 9-11 are YYY, and all YYY are modified with 2' fluorination; in the sense strand of S1 obtained by chemically modifying the sequence shown in SEQ ID NO.43, nucleotides 10-12 ... In the antisense strand of S3 obtained after chemical modification of the sequence shown in NO.44, the nucleotides at positions 9-11 are Y'Y'Y', and Y'Y'Y' are all modified with 2'methoxy groups;
[0063] In some embodiments, the chemical modification is a chemically modified nucleotide, which is any one or more of the following: methoxy-modified nucleotide, methoxyethyl-modified nucleotide, aminopropyl-modified nucleotide, dimethylaminoethyl-modified nucleotide, aminopropyl-modified nucleotide, amino-modified nucleotide, azide-modified nucleotide, alkyl-modified nucleotide, F-arasaccharide-modified nucleotide, allyl-modified nucleotide, fluorine-modified nucleotide, deoxynucleotide, hydroxyl-modified nucleotide, phosphate thioester-modified nucleotide, debased nucleotide, morpholinonucleotide, and locked nucleotide. The chemically modified group is a fluorine or non-fluorine group. The non-fluorine group can be an alkyl group (e.g., C1-C6 alkyl groups, such as methyl, ethyl, propyl, etc.), an alkenyl group (e.g., C2-C6 alkenyl groups, such as vinyl, propenyl, allyl, etc.), a substituted alkyl group (e.g., halogens (fluorine, chlorine, bromine, iodine), hydroxyl, nitro, amino, C1-C6 alkoxy-substituted alkyl groups, wherein the alkyl group can be C1-C6 alkyl), an alkoxy group (e.g., C1-C6 alkoxy groups), a substituted alkoxy group (e.g., halogens (fluorine, chlorine, bromine, iodine), hydroxyl, nitro, amino, C1-C6 alkoxy-substituted alkoxy groups, wherein the alkoxy group is as described above), a hydroxyl group, a thiophosphate group, an amino group, an azide group, or a substituted amino group (e.g., C1-C6 alkyl mono- or di-substituted amino groups); or, the chemical modification can form a peptide nucleic acid, a phosphorylated diamine morpholino oligonucleotide, or a locked nucleic acid. Further, the non-fluorine group can be a methoxy group, an ethoxy group, etc. C1 refers to a carbon number of 1, and C6 refers to a carbon number of 6.
[0064] In some embodiments, chemical modifications include ribose modifications, which include one or more of the following: methoxy modification, fluorination modification, methoxyethyl modification, locked nucleic acid modification, deoxy modification, amino modification, morpholino modification, aminopropyl modification, dimethylaminoethyl modification, azide modification, allyl modification, alkyl modification, alkoxy modification, and F-arasugar modification.
[0065] In some embodiments, chemical modifications include skeleton modifications, which include thiophosphate modifications, dithiophosphate modifications, methylphosphonate modifications, methoxypropyl phosphate modifications, boron phosphate modifications, fluorophosphate modifications, or aminophosphate modifications.
[0066] In some implementations, chemical modifications include base modifications, which include methyl modifications, halogenated modifications, alkynyl modifications, thiolated modifications, fluorinated modifications, azide modifications, and amino modifications.
[0067] In one or more embodiments, a chemically modified group links two adjacent nucleotides. This chemically modified group is a thiophosphate group.
[0068] In one or more embodiments, the chemically modified group replaces the hydroxyl group at the 2' position of the ribosome of the nucleotide. The chemically modified group is fluorine, alkyl, substituted alkyl, alkoxy, amino, substituted amino, etc.
[0069] In one or more embodiments, the chemically modified group modifies at least one nucleotide in the targeting siRNA. Further, the chemically modified group modifies one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or all nucleotides of the sense strand of the siRNA. Further, the chemically modified group modifies one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or all nucleotides of the antisense strand of the siRNA.
[0070] In one or more embodiments, the positive strand sequence of the targeting siRNA has a nucleotide sequence as shown in SEQ ID NO.43.
[0071] In one or more embodiments, the antisense strand sequence of the targeting siRNA has a nucleotide sequence as shown in SEQ ID NO.44.
[0072] Thirdly, an siRNA conjugate is obtained by conjugating the targeted siRNA described in the first aspect of the present invention or a modified siRNA described in the second aspect of the present invention with a pharmaceutically acceptable targeting group.
[0073] In some implementations, the pharmaceutically acceptable targeting group may be galactose or N-acetylgalgactosamine (GalNAc), a ligand that binds to the asialoglycoprotein receptor (ASGPR) on the liver surface. ASGPR is an endocytic receptor specifically expressed by hepatocytes. N-acetylgalgactosamine serves as a targeting molecule to deliver small RNA to the liver.
[0074] In some implementations, a pharmaceutically acceptable targeting group is attached to the 3' or 5' end of the positive strand of the targeted siRNA.
[0075] Fourthly, a composition comprising the targeted siRNA of the first aspect of the present invention, a modified siRNA of the second aspect of the present invention, or a conjugate of the siRNA of the third aspect of the present invention, and excipients.
[0076] The excipients described in this invention can be carriers with loading and / or transport functions, such as buffer solutions, physiological saline, lipid nanoparticles (LNPs, generally composed of triglycerides or similar compounds, cholesterol or similar compounds, phospholipids or similar compounds), polymer nanoparticles (such as nanocapsules or nanospheres formed by PEI coating), and inorganic nanoparticles (such as silica nanoparticles or iron oxide nanoparticles); they can also be excipients, such as diluents, fillers, binders, wetting agents, disintegrants, absorption promoters, surfactants, adsorbent carriers, or lubricants.
[0077] The dosage form of the composition described in this invention is tablet, capsule, powder, pill, granule, solution, suspension, syrup, injection, suppository, inhaler or spray.
[0078] In the composition of the present invention, the weight content of the targeted siRNA, siRNA modifier or siRNA conjugate in the composition is 1%-99%.
[0079] Fifthly, the application of any one of the following: a targeted siRNA as described in the first aspect of the present invention, a modified siRNA as described in the second aspect of the present invention, a conjugate of the siRNA as described in the third aspect of the present invention, or a composition as described in the fourth aspect of the present invention:
[0080] (c1) Application in the preparation of formulations that promote LSR expression;
[0081] (c2) Application in the preparation of formulations that enhance the ability of hepatocytes to take up low-density lipoprotein;
[0082] (c3) Preparation for use in the prevention and / or treatment of hyperlipidemia;
[0083] (c4) Preparation for use in the prevention and / or treatment of hyperlipidemia-related diseases.
[0084] The formulations described in this invention can be pharmaceuticals or reagents used in scientific research.
[0085] The treatment described in this invention refers to a method implemented to obtain a beneficial or desired clinical outcome. For the purposes of this invention, a beneficial or desired clinical outcome includes, but is not limited to, alleviating symptoms, reducing the extent of the disease, stabilizing (i.e., no longer worsening) the state of the disease, delaying or slowing the progression of the disease, improving or alleviating the state of the disease, and relieving symptoms (whether partially or completely).
[0086] The prevention described in this invention refers to avoiding, reducing, preventing, or delaying the occurrence of a disease or disease-related symptoms before the relevant drug is administered. "Prevention" does not necessarily require completely preventing the occurrence of the disease or disease-related symptoms. For example, reducing the risk of a subject developing a specific disease or disease-related symptoms after the relevant drug is administered, or weakening the severity of subsequently occurring related symptoms, can be considered as "preventing" the occurrence or development of the disease.
[0087] The hyperlipidemia described in this invention includes primary hyperlipidemia (optionally heterozygous familial hypercholesterolemia or homozygous familial hypercholesterolemia) or secondary hyperlipidemia. Furthermore, hyperlipidemia can be classified into hypercholesterolemia, hypertriglyceridemia, mixed hyperlipidemia, and low high-density lipoprotein cholesterol (HDL-C). The hyperlipidemia-related diseases described in this invention include cardiovascular diseases (e.g., atherosclerosis, coronary heart disease (e.g., angina pectoris, myocardial infarction, hypertension), cerebrovascular diseases (e.g., cerebral infarction, cerebral hemorrhage), acute pancreatitis, peripheral vascular diseases (e.g., lower extremity arteriosclerosis obliterans, retinopathy, renal artery stenosis), non-alcoholic fatty liver disease, hyperfatty acidemia, obesity, and metabolic-related diseases (e.g., diabetes, metabolic syndrome).
[0088] Sixthly, the use of LncRNA-LSR-AS1 as a target in screening products for the prevention and / or treatment of hyperlipidemia or related diseases, wherein the sequence of LncRNA-LSR-AS1 is shown in SEQ ID NO.20.
[0089] The hyperlipidemia or related diseases described in the sixth aspect of the present invention are the same as the hyperlipidemia or related diseases described in the fifth aspect of the present invention.
[0090] In some implementations, LncRNA-LSR-AS1 is used as a target for the prevention and / or treatment of hyperlipidemia. As an antisense long non-coding RNA of the LSR gene, LncRNA-LSR-AS1 inhibits LSR protein expression and affects lipid metabolism by targeting and binding to the 3'UTR region of LSR mRNA. Inhibiting the expression of LncRNA-LSR-AS1 or its binding activity to the 3'UTR of LSR mRNA can relieve the inhibition of LSR expression and promote LSR expression, thereby achieving the effect of reducing blood lipid levels. This can be used to develop products for the prevention and / or treatment of hyperlipidemia and related diseases.
[0091] Seventhly, any of the following applications of the reagent that inhibits LncRNA-LSR-AS1 expression;
[0092] (d1) Use in the preparation of medicines for the prevention and / or treatment of hyperlipidemia or related diseases;
[0093] (d2) Application in the preparation of formulations that promote LSR gene expression;
[0094] (d3) Application in the preparation of formulations that enhance the ability of hepatocytes to take up low-density lipoprotein;
[0095] The sequence of the LncRNA-LSR-AS1 is shown in SEQ ID NO.20.
[0096] The hyperlipidemia or related diseases described in the seventh aspect of the present invention are the same as the hyperlipidemia or related diseases described in the fifth aspect of the present invention.
[0097] The reagent for inhibiting LncRNA-LSR-AS1 expression described in this invention can be an antisense oligonucleotide (ASO), a modified antisense oligonucleotide, a conjugate of an antisense oligonucleotide, a polypeptide, a protein (both proteins and polypeptides are formed by sequentially linking basic amino acid structural units, wherein the molecular weight of the protein is higher than that of the polypeptide), a small molecule inhibitor, siRNA, a modified siRNA, a conjugate of siRNA, or a substance for lentiviral infection or gene knockout. In some embodiments, the reagent for inhibiting LncRNA-LSR-AS1 expression is siRNA, a modified siRNA, or a conjugate of siRNA. The siRNA involved in the reagent for inhibiting LncRNA-LSR-AS1 expression described in this invention is the same as the targeting siRNA described in the first aspect of this invention. That is, the siRNA is a double-stranded RNA, and its positive strand sequence is as described in any of the following:
[0098] (a1) has a nucleotide sequence as shown in SEQ ID NO.X, where X is an odd number from 27 to 55;
[0099] (a2) Having a nucleotide sequence that is at least 90% identical to the nucleotide sequence described in (a1) or has at least 15 consecutive nucleotides;
[0100] (a3) A nucleotide sequence having at least 70% identity with the nucleotide sequence described in (a1) and retaining the biological function of the sequence from which it is derived;
[0101] Its antisense chain sequence is as described in any of the following:
[0102] (b1) Has a nucleotide sequence as shown in SEQ ID NO.(X+1), where X is an odd number from 27 to 55;
[0103] (b2) Having a nucleotide sequence that is at least 90% identical to the nucleotide sequence described in (b1) or has at least 15 consecutive nucleotides;
[0104] (b3) A nucleotide sequence having at least 70% identity with the nucleotide sequence described in (b1) and retaining the biological function of the sequence from which it is derived.
[0105] In one or more embodiments, the positive strand sequence has a nucleotide sequence as shown in SEQ ID NO.43.
[0106] In one or more embodiments, the antisense strand sequence has a nucleotide sequence as shown in SEQ ID NO.44.
[0107] The siRNA modifier involved in the reagent for inhibiting LncRNA-LSR-AS1 expression described in this invention is the same as the siRNA modifier described in the second aspect of this invention. That is, the siRNA modifier is obtained by chemically modifying the sense and / or antisense strands of the siRNA described in the first aspect of this invention.
[0108] In some embodiments, the chemically modified group is a fluorine or non-fluorine group. The non-fluorine group can be an alkyl group (e.g., C1-C6 alkyl groups, such as methyl, ethyl, propyl, etc.), an alkenyl group (e.g., C2-C6 alkenyl groups, such as vinyl, propenyl, allyl, etc.), a substituted alkyl group (e.g., halogen (fluorine, chlorine, bromine, iodine), hydroxyl, nitro, amino-substituted alkyl groups, wherein the alkyl group can be C1-C6 alkyl), an alkoxy group (e.g., C1-C6 alkoxy), a hydroxyl group, a thiophosphate group, an amino group, an azide group, or a substituted amino group (e.g., C1-C6 alkyl mono- or di-substituted amino groups); or, the chemical modification can form a peptide nucleic acid, a phosphorylated dimorpholine oligonucleotide, or a locked nucleic acid. Further, the non-fluorine group can be a methoxy group, an ethoxy group, etc.
[0109] In one or more embodiments, a chemically modified group links two adjacent nucleotides. This chemically modified group is a thiophosphate group.
[0110] In one or more embodiments, the chemically modified group replaces the hydroxyl group at the 2' position of the ribosome of the nucleotide. The chemically modified group is fluorine, alkyl, substituted alkyl, alkoxy, amino, substituted amino, etc.
[0111] In one or more embodiments, the chemically modified group modifies at least one nucleotide in the siRNA. Further, the chemically modified group modifies one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or all nucleotides of the sense strand of the siRNA. Further, the chemically modified group modifies one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or all nucleotides of the antisense strand of the siRNA.
[0112] In one or more embodiments, the positive strand sequence of the siRNA has a nucleotide sequence as shown in SEQ ID NO.43.
[0113] In one or more embodiments, the antisense strand sequence of the siRNA has a nucleotide sequence as shown in SEQ ID NO.44.
[0114] The siRNA conjugates involved in the reagent for inhibiting LncRNA-LSR-AS1 expression described in this invention are the same as those described in the third aspect of this invention. That is, the siRNA conjugates are obtained by conjugating the siRNA described in the first aspect of this invention or a modified version of the siRNA described in the second aspect of this invention with a pharmaceutically acceptable targeting group.
[0115] In some implementations, the pharmaceutically acceptable targeting group may be galactose or N-acetylgalactosamine, an N-acetylgalactosamine ligand that binds to the desialyl glycoprotein receptor on the liver surface, a hepatocyte-specific endocytic receptor, with N-acetylgalactosamine serving as the targeting molecule to deliver small RNA to the liver.
[0116] In some implementations, a pharmaceutically acceptable targeting group is attached to the 3' or 5' end of the siRNA's positive strand.
[0117] Eighthly, the downstream target gene LSR gene and / or protein of LncRNA-LSR-AS1 is used as a target in screening products for the prevention and / or treatment of hyperlipidemia or related diseases, wherein the mRNA sequence of LSR is shown in any of SEQ ID NO.1-19, and LncRNA-LSR-AS1 is an LncRNA with the sequence shown in SEQ ID NO.20.
[0118] The hyperlipidemia or related diseases described in the eighth aspect of the present invention are the same as the hyperlipidemia or related diseases described in the fifth aspect of the present invention.
[0119] In some embodiments, the product is one or more of the following: eukaryotic expression plasmid, adenovirus, adeno-associated virus, lentivirus, retrovirus, LNP liposome, gene editing system element, homologous recombination vector, ASO, ASO modifier, ASO conjugate, small molecule inhibitor, siRNA, siRNA modifier, or siRNA conjugate. The recombinant expression vector contains the LSR gene or a gene fragment with more than 90% homology to the LSR gene, and the polypeptide, protein, antisense oligonucleotide, small molecule inhibitor, siRNA, siRNA modifier, or siRNA conjugate can upregulate the expression of the LSR gene and / or LSR protein.
[0120] In some implementations, promoting the expression of the LSR gene can enhance the ability of hepatocytes to take up low-density lipoprotein; inhibiting the expression of the LSR gene can reduce the ability of hepatocytes to take up low-density lipoprotein, thereby screening for products to prevent and / or treat hyperlipidemia or related diseases.
[0121] Ninth aspect, any of the following applications of LncRNA-LSR-AS1 downstream target molecule LSR or reagents that promote the expression of LncRNA-LSR-AS1 downstream target molecule LSR;
[0122] (e1) Use in the preparation of medicaments for the prevention and / or treatment of hyperlipidemia or related diseases;
[0123] (e2) Application in the preparation of formulations that enhance the ability of hepatocytes to take up low-density lipoprotein;
[0124] (e3) Application in the preparation of formulations that reduce lipid deposition in liver tissue.
[0125] Among them, the mRNA sequence of LSR is shown in any of SEQ ID NO.1-19, and LncRNA-LSR-AS1 is the LncRNA with the sequence shown in SEQ ID NO.20.
[0126] The hyperlipidemia or related diseases described in the ninth aspect of the present invention are the same as the hyperlipidemia or related diseases described in the fifth aspect of the present invention.
[0127] The agents that promote LSR expression include vector-based adenoviruses, lentiviruses, LNP liposomes, gene editing system elements or homologous recombination vectors, and microinjection techniques that specifically target the LSR gene, or agonists of the LSR protein.
[0128] The LSR gene and / or protein described in this invention are widely present in humans and animals and have cross-species characteristics. Therefore, the application of the LSR gene and / or protein described in this invention is not limited to humans, but also includes animals of other species that contain LSR genes and / or proteins, such as cats, dogs, monkeys, and mice.
[0129] The beneficial effects of this invention are as follows:
[0130] 1. This invention, demonstrated through in vitro human liver cell line experiments and in vivo hyperlipidemic mouse model experiments, shows that overexpression of LSR can significantly improve cellular uptake of LDL, significantly reduce the concentrations of T-CHO, TG, LDL, and vLDL in mouse serum, and decrease lipid content in liver tissue. Compared with existing drugs, LSR is a protein expressed by the body itself, resulting in fewer side effects. Especially in patients with familial hypercholesterolemia and LDLR gene deletion, its lipid-lowering effect is significantly superior to existing therapeutic drugs targeting PSCK9 or LDLR.
[0131] 2. This invention has discovered a lncRNA that inhibits LSR expression, which interacts with the 3'UTR region of LSR. When its expression level decreases in cells, LSR expression increases. Therefore, this lncRNA can serve as a target for the prevention and / or treatment of hyperlipidemia or related diseases. Based on this lncRNA as a target, this invention further designed a series of siRNAs and their modifications and conjugates. Experiments show that these siRNAs and their modifications and conjugates can increase the uptake of LDL by Hep3B, HepG2, and HepaRG cells. Among them, siRNA si-151 significantly increases the uptake of LDL by Hep3B, HepG2, and HepaRG cells, and its promoting effect on LDL uptake in LDLR knockout hepatocytes is significantly better than that of the marketed PCSK9-targeting siRNA drug Incisiran. Attached Figure Description
[0132] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0133] Figure 1 This is a graph showing the results of DiI-LDL uptake by hepatocytes in the control group and LSR overexpression group in Example 1 of the present invention;
[0134] Figure 2 The graph shows the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of mice in the high-fat diet control group and the LSR overexpression group in Example 2 of this invention.
[0135] Figure 3 Oil Red staining (A) and quantification (B) of liver tissue from mice in the high-fat diet control group and LSR overexpression group in Example 2 of this invention;
[0136] Figure 4 The graph shows the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of LDLR knockout mice in the high-fat diet control group and the LSR overexpression group in Example 3 of this invention.
[0137] Figure 5 Oil Red staining (A) and quantification (B) of liver tissue from LDLR knockout mice in the high-fat diet control group and LSR overexpression group in Example 3 of this invention;
[0138] Figure 6 The graph shows the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of LDLR knockout mice in the normal diet control group and LSR overexpression group in Example 4 of this invention.
[0139] Figure 7 The graph shows the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of LDLR heterozygous mice in the high-fat diet control group and the LSR overexpression group in Example 5 of this invention.
[0140] Figure 8 Oil Red staining (A) and quantification (B) of liver tissue from LDLR heterozygous mice in the high-fat diet control group and LSR overexpression group in Example 5 of this invention;
[0141] Figure 9 The graph shows the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of LDLR heterozygous mice in the normal diet control group and the LSR overexpression group in Example 6 of this invention.
[0142] Figure 10 The graph shows the concentrations of T-CHO (A), TG (B), and LDL (C) in the serum of aged mice in the control group and LSR overexpression group in Example 7 of this invention.
[0143] Figure 11The graph shows the relative expression levels of LSR mRNA in HepG2 (A), Hep3B (B), and HepaRG (C) cells of different concentration control groups and LncRNA groups in Example 9 of this invention.
[0144] Figure 12 This is a graph showing the relative expression levels of LSR mRNA in the control group and HepG2 (A), Hep3B (B), and HepaRG (C) cells with different siRNA sequence groups in Example 11 of the present invention.
[0145] Figure 13 The graph shows the relative expression levels of LSR mRNA in HepG2 (A), Hep3B (B), and HepaRG (C) cells of different concentration control groups and si-151 groups in Example 12 of this invention.
[0146] Figure 14 The graph shows the relative expression levels of LncRNA-LSR-AS1 in HepG2 (A), Hep3B (B), and HepaRG (C) cells of different concentration control groups and si-151 groups in Example 12 of this invention.
[0147] Figure 15 The graph shows the results of LSR protein expression (A) and quantification (B) in hepatocytes of the control group and si-151 group in Example 13 of the present invention.
[0148] Figure 16 The graph shows the relative expression levels of LSR mRNA in the control group and the si-151 groups with different modifications in Example 15 of this invention.
[0149] Figure 17 The graph shows the relative expression levels of LncRNA-LSR-AS1 in the control group and the si-151 groups with different modifications in Example 15 of this invention.
[0150] Figure 18 The graph shows the relative expression levels of LSR mRNA in HepG2 (A), Hep3B (B), and HepaRG (C) cells of different concentration control groups and S3 group in Example 15 of this invention.
[0151] Figure 19 The graph shows the results of Dil-LDL uptake by HepG2 (A), Hep3B (B), and HepaRG (C) cells in the control group, S3 group, and si-PCSK9 group in Example 17 of the present invention.
[0152] Figure 20This is a graph showing the results of Dil-LDL uptake by liver organoids in the control group, S3 group, and si-PCSK9 group in Example 18 of the present invention;
[0153] Figure 21 The graph shows the results of Dil-LDL uptake by the control group, S3 group and si-PCSK9 group HepG2 cells and LDLR knockout HepG2 (A), Hep3B (B) and HepaRG (C) cells in Example 19 of the present invention.
[0154] Figure 22 The graph shows the concentration of vLDL in the serum of mice in the AAV-CTL group and AAV-LSR group in the C57BL / 6 high-fat mouse model (A), LDLR knockout mice on a high-fat diet (B), and LDLR heterozygous mice on a high-fat diet (C) of Example 20 of this invention. Detailed Implementation
[0155] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0156] Example 1: Overexpression of LSR promotes LDL uptake in human liver cell lines
[0157] Step 1: Construct LSR overexpression plasmid
[0158] LSRs include human LSR 213, human LSR 201, human LSR 202, human LSR 203, human LSR 204, human LSR 205, human LSR 206, human LSR 207, human LSR 208, human LSR 209, human LSR 210, human LSR 211, human LSR 212, human LSR 213, human LSR 214, and rodent LSR 201, rodent LSR 202, rodent LSR 203, rodent LSR 204, and rodent LSR 205.
[0159] The nucleotide sequence (5'-3') of the mRNA of human LSR 213 (ENST00000605618.6) is as follows:
[0160]
[0161] The nucleotide sequence (5'-3') of the human LSR 201 (ENST00000347609.8) mRNA is as follows:
[0162]
[0163] The nucleotide sequence (5'-3') of the mRNA of human LSR 202 (ENST00000354900.7) is as follows:
[0164]
[0165] The nucleotide sequence (5'-3') of the mRNA of human LSR 203 (ENST00000360798.7) is as follows:
[0166]
[0167] The nucleotide sequence (5'-3') of the mRNA of human LSR 204 (ENST00000361790.7) is as follows:
[0168]
[0169] The nucleotide sequence (5'-3') of the mRNA of human LSR 205 (ENST00000427250.5) is as follows:
[0170]
[0171] The nucleotide sequence (5'-3') of the mRNA of human LSR 206 (ENST00000597446.1) is as follows:
[0172] GGAGGATACCCTGGAGACGTTGACAGGAGTAGCTCAGCTGGTGGCCAAGGCTCCTATGTACCCCTGCTTCGGGACACGGACAGCAGTGTGGCCTCTGGTGAGAATCCATCGTCCCGAAGTTGGATGTGCCTGTAAGGGAGAGGGGTGGGCCAGGATCCATCCTCCCAAACCGACCACCACCCCCCTGTCCCTAGAAGTCCGCAGTGGCTACAGGATTCAGGCCAGCCAGCAGGACGACTCCATGCGGGTCCTGTACTACATGGAGAAGGAGCTGGCCAACTTCGACCCTTCTCGACCTGGCCCCCCCAGTGGCCGTGTGGAGCGGGCCATGAGTGAAGTCACCTCCCTCCACGAGGACGACTGGCGATCTCGGCCTTCCCGGGGCCCTGCCCTCACCCCGATCCGGGATGAGGAGTGGGGTGGCCACTCCCCCCGGAGTCCCAGGGGATGGGACCAGGAGCCCGCCAGGGAGCAGGCA, as shown in SEQ ID NO.7.
[0173] The nucleotide sequence (5'-3') of the mRNA of human LSR 207 (ENST00000597933.5) is as follows:
[0174] CCCCAGTGGAAGTGGAGAAGTCAGGCGCCACCAACAAGCCTCTCCCAGCCAGGACTTTGCTTAGACTCGCTCCTCCCGGCAGGGCGCACCTAGGCGGGTCCATCGCCAGCCGGGGAGAGGGGTTTGGGCAGGGAGGGAACAGGTGCGCGGCGGGACCCGCCCTATCTCAACAGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTCTTCCAGCCTGTGACCCTGCCCTGTACCTACCAGATGACCTCGACCCCCACGCAACCCATCGTCATCTGGAAGTACAAGTCTTTCTGCCGGGACCGCATCGCCGATGCCTTCTCCCCGGCCAGCGTCGACAACCAGCTCAATGCCCAGCTGGCAGCCGGGAACCCAGGCTACAACCCCTACGTTGAGTGCCAGGACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGGGAGGACCTCAGGGGTGGCTGAGCTCTTACCTGGTTTTCAGGCGGGGCCCATAGAAGACTGGCTCTTCGTGGTTGTGGTATGCCTGGCTGCCTTCCTCATCTTCCTCCTCCTGGGCATCTGCTGGTGCCAGTGCTGCCCGCACACTTGCTGCTGCTACGTCAGGTGCCCCTGCTGCCCAGACAAGTGCTGCTGCCCCGAGGCCCGTAAGTGTCCCGCTCATGGCCACCCTGGTTT, as shown in SEQ ID NO.8.
[0175] The nucleotide sequence (5'-3') of the mRNA of human LSR 208 (ENST00000599658.1) is:
[0176] GACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGGGAGGACCTCAGGGGTGGCTGAGCTCTTACCTGGTTTTCAGGCGGGGCCCATAGAAGTGTATGCCGCCGGCAAAGCAGCCACCTCAGGTGTTCCCAGCATTTATGCCCCCAGCACCTATGCCCACC, as shown in SEQ ID NO.9.
[0177] The nucleotide sequence (5'-3') of the mRNA of human LSR 209 (ENST00000601623.5) is:
[0178] AGGAAGTGAAACTCCCTGGACGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTCTTCCAGCCTGTGACCCTGCCCTGTACCTACCAGATGACCTCGACCCCCACGCAACCCATCGTCATCTGGAAGTACAAGTCTTTCTGCCGGGACCGCATCGCCGATGCCTTCTCCCCGGCCAGCGTCGACAACCAGCTCAATGCCCAGCTGGCAGCCGGGAACCCAGGCTACAACCCCTACGTTGAGTGCCAGGACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGACTGGCTCTTCGTGGTTGTGGTATGCCTGGCTGCCTTCCTCAT, as shown in SEQ ID NO. 10.
[0179] The nucleotide sequence (5'-3') of the mRNA of human LSR 210 (ENST00000602003.1) is:
[0180] GTGTACCTGGGCCGAACCATTCACCGGAGCGCGCAGCGGGTGGAGTGTGGCTCGGAGGACCGCGGCGGGTCAAGCACCTTTCTCCCCCATATCTGAAAGCATGCCCTTTGTCCACGTCGTTTACGCTCATTAAAACTTCCAGAATGCAACAGGACGGACTTGGAGTAGGGACAAGGAACGGAAGTGGGAAGGGGAGGAGCGTGCACCCCTCCTGGCCTTGGTGCGCGCCGCGCCCCCTAAGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTC, as shown in SEQ ID NO. 11.
[0181] The nucleotide sequence (5'-3') of the mRNA of human LSR 211 (ENST00000602044.2) is as follows:
[0182] GTGTGGCTTCTGCTTAGCACCTGGTGCACAGCTCCTGCCAGGGCCATCCAGGTGACCGTGTCCAACCCCTACCACGTGGTGATCCTCTTCCAGCCTGTGACCCTGCCCTGTACCTACCAGATGACCTCGACCCCCACGCAACCCATCGTCATCTGGAAGTACAAGTCTTTCTGCCGGGACCGCATCGCCGATGCCTTCTCCCCGGCCAGCGTCGACAACCAGCTCAATGCCCAGCTGGCAGCCGGGAACCCAGGCTACAACCCCTACGTTGAGTGCCAGGACAGCGTGCGCACCGTCAGGGTCGTGGCCACCAAGCAGGGCAACGCTGTGACCCTGGGAGATTACTACCAGGGCCGGAGGATTACCATCACCGGAAATGCTGACCTGACCTTTGACCAGACGGCGTGGGGGGACAGTGGTGTGTATTACTGCTCCGTGGTCTCAGCCCAGGACCTCCAGGGGAACAATGAGGCCTACGCAGAGCTCATCGTCCTTGGCAGGGACCACTGGCCCACAGTGCCTCCAATCACCCAAGCCAAACTAAGAGAAGAGTGGAGACAATTGGAGACTCTGCCTTTTCAAAGTCTCATTTTTAAAAAAAATCCAGACTTGGGGTCCGGGTGCGGTAGTTCATGCCTGTAATCCCAGCACTTTGGGA, as shown in SEQ ID NO.12.
[0183] The nucleotide sequence (5'-3') of the mRNA of human LSR 212 (ENST00000602122.5) is as follows:
[0184]
[0185] The nucleotide sequence (5'-3') of the mRNA of human LSR 214 (ENST00000621372.4) is as follows:
[0186]
[0187] The nucleotide sequence (5'-3') of the murine LSR 201 (ENSMUST00000001279.15) mRNA is as follows:
[0188]
[0189] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 202 (ENSMUST00000098553.11) is as follows:
[0190]
[0191] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 203 (ENSMUST00000108116.10) is as follows:
[0192]
[0193] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 204 (ENSMUST00000147431.2) is as follows:
[0194]
[0195] The nucleotide sequence (5'-3') of the mRNA of mouse LSR 205 (ENSMUST00000205961.2) is as follows:
[0196]
[0197] An intracellular LSR overexpression plasmid was constructed using the pQCXIP plasmid. The plasmid contained the nucleotide sequence of human LSR 213 mRNA. A single copy of the LSR mRNA sequence was cloned into the EcoRI / BamHI site of the pQCXIP plasmid to obtain the LSR overexpression plasmid.
[0198] Step 2: Cell Culture and Transfection
[0199] Add 1 μg of LSR overexpression plasmid and 2 μl of P3000 to each well of a 24-well plate. TM 25 μl of Reagent (purchased from Invitrogen, catalog number L3000015) DMEM (Gibco) was added to 25 μl of Lipofectamine 3000 (purchased from Invitrogen, catalog number L3000015) DMEM (purchased from Meilun Biotechnology) at a dosage of 0.75 μl per well. The mixture was then incubated at room temperature (25°C) for 15 minutes. The above mixture was then added to a solution containing 3.5 × 10⁻⁶ DMEM. 5 Complete culture medium was used to culture human hepatocellular carcinoma cells at 37°C for 12 hours. Human hepatocellular carcinoma cell lines Hep3B and HepG2 were cultured in DMEM complete medium (purchased from Meilun Biotechnology), and human primary liver cell line HepaRG was cultured in William's E medium (purchased from Gibco). Cells were harvested after 48 hours.
[0200] Step 3: LDL intake
[0201] 1. Aseptically dilute DiI-LDL to 40 mg / ml in culture medium.
[0202] 2. Add the diluted DiI-LDL to a 24-well plate and incubate at 37°C for 5 hours.
[0203] 3. Remove the culture medium containing DiI-LDL.
[0204] 4. Wash the cells three times with probe-free culture medium.
[0205] 5. For detection using a fluorescent microplate reader, standard rhodamine excitation is used. Recommended excitation wavelength: 554 nm; emission wavelength: 571 nm.
[0206] like Figure 1 As shown, overexpression of LSR significantly increased the uptake of LDL in Hep3B, HepG2 and HepaRG cells.
[0207] Example 2: Overexpression of LSR significantly reduced blood lipid levels in hyperlipidemic mice.
[0208] Step 1: Construction of C57BL / 6 mouse high-fat model
[0209] Feeding C57BL / 6 mice with a high-fat diet is a common method for establishing an animal model of hyperlipidemia. In this example, 6-week-old male C57BL / 6 mice were fed a normal diet for 2 weeks to acclimatize to the rearing environment. They were then fed a high-fat diet for 8 weeks and randomly divided into two groups. One group received a retroorbital vein injection of AAV virus containing LSR mRNA (SEQ ID NO.15) (AAV-LSR) or an empty vector virus (AAV-CTL), with each mouse receiving 100 μl of the virus (2 × 10⁻⁶ mRNA). 11 vg. Blood samples were collected every two weeks via the tail vein to measure total cholesterol (T-CHO), triglycerides (TG), and low-density lipoprotein (LDL). Mice were euthanized after 16 weeks of AAV virus treatment, and plasma and liver tissue were collected for subsequent testing.
[0210] Step 2: Detection of T-CHO, TG and LDL in serum
[0211] The concentrations of T-CHO, TG, and LDL in the serum of mice in each group were detected using commercially available kits according to the instructions. The kits used were: T-CHO assay kit (A111-1-1, Nanjing Jiancheng Biotechnology Institute), TG assay kit (A110-1-1, Nanjing Jiancheng Biotechnology Institute), and LDL assay kit (A113-1-1, Nanjing Jiancheng Biotechnology Institute).
[0212] Step 3: Oil Red Staining of Liver Tissue
[0213] 1. Fix the prepared frozen liver sections in 4% paraformaldehyde for 5 minutes;
[0214] 2. Rinse three times with distilled water;
[0215] 3. Rinse once with 60% isopropanol;
[0216] 4. Immerse in 60% Oil Red O staining solution for 10 minutes;
[0217] 5. Color separation using 60% isopropanol;
[0218] 6. Rinse three times with distilled water;
[0219] 7. Hematoxylin redyeing;
[0220] 8. Wash with PBS buffer for 1 minute;
[0221] 9. Rinse three times with distilled water;
[0222] 10. Mount the slide with glycerin, observe and photograph.
[0223] like Figure 2 As shown in A, B, and C, compared with the AAV-CTL group mice, the serum concentrations of T-CHO, TG, and LDL in the AAV-LSR group mice were significantly reduced. Figure 3 As shown in Figures A and B, compared with the AAV-CTL group mice, the lipid content in the liver tissue of the AAV-LSR group mice was significantly reduced. These results indicate that LSR can effectively improve hyperlipidemia.
[0224] Example 3: Overexpression of LSR significantly reduced blood lipid levels in LDLR knockout mice on a high-fat diet.
[0225] Step 1: Construction of a high-fat diet model in LDLR knockout mice
[0226] This embodiment is based on embodiment 2, retaining steps one to three, and replacing the mice described in step one with the LDLR knockout mice described in embodiment 3.
[0227] like Figure 4 As shown in A, B, and C, compared with the AAV-CTL group mice, the serum concentrations of T-CHO, TG, and LDL in the AAV-LSR group mice were significantly reduced. Figure 5 As shown in Figures A and B, compared with the AAV-CTL group mice, the lipid content in the liver tissue of the AAV-LSR group mice was significantly reduced. These results indicate that LSR can effectively improve familial hypercholesterolemia induced by LDLR deficiency.
[0228] Example 4: Overexpression of LSR significantly reduced blood lipid levels in LDLR knockout mice on a normal diet.
[0229] In this embodiment, 6-week-old male LDLR knockout mice were fed a normal diet for 2 weeks, and then randomly divided into two groups. One group was injected via retroorbital vein with AAV virus containing LSR mRNA (SEQ ID NO.15) (AAV-LSR) or empty vector virus (AAV-CTL). Each mouse received 100 μl of AAV virus, with a viral load of 2 × 10⁻⁶. 11 vg. Blood samples were collected every two weeks via the tail vein of mice to measure total cholesterol, triglycerides, and low-density lipoprotein. Mice were euthanized after 16 weeks of AAV virus treatment, and plasma was collected for subsequent testing. The testing procedure was performed according to step two of Example 3.
[0230] like Figure 6 As shown in A, B, and C, compared with the AAV-CTL group mice, the serum concentrations of T-CHO, TG, and LDL in the AAV-LSR group mice were significantly reduced.
[0231] Example 5: Overexpression of LSR significantly reduced blood lipid levels in LDLR heterozygous mice on a high-fat diet.
[0232] This embodiment is based on embodiment 3, retaining steps one to three, and replacing the LDLR knockout mice in step one with the LDLR heterozygous mice in embodiment 5.
[0233] like Figure 7 As shown in A, B, and C, compared with the AAV-CTL group mice, the serum concentrations of T-CHO, TG, and LDL in the AAV-LSR group mice were significantly reduced. Figure 8 As shown in Figures A and B, compared with the AAV-CTL group mice, the lipid content in the liver tissue of the AAV-LSR group mice was significantly reduced. These results indicate that LSR can effectively improve LDLR heterozygous familial hypercholesterolemia.
[0234] Example 6: Overexpression of LSR significantly reduced blood lipid levels in heterozygous LDLR mice on a normal diet.
[0235] This embodiment is based on embodiment 4, retaining steps one and two, and replacing the LDLR knockout mice in step one with the LDLR heterozygous mice described in embodiment 6.
[0236] like Figure 9 As shown in A, B, and C, compared with the AAV-CTL group mice, the serum concentrations of T-CHO, TG, and LDL in the AAV-LSR group mice were significantly reduced.
[0237] Example 7: Overexpression of LSR significantly reduced blood lipid levels in aged mice.
[0238] In this embodiment, 18-month-old male C57BL / 6 mice fed a normal diet were randomly divided into two groups. One group was injected via retroorbital vein with either AAV virus containing LSR mRNA (SEQ ID NO.15) (AAV-LSR) or empty vector virus (AAV-CTL). Each mouse received 100 μl of AAV virus, with a viral load of 2 × 10⁻⁶. 11 vg. Mice were euthanized after 16 weeks of AAV virus treatment, and plasma was collected for subsequent testing. The testing process was performed according to step two of Example 2.
[0239] like Figure 10 As shown in Figures A, B, and C, compared with the AAV-CTL group mice, the serum concentrations of T-CHO, TG, and LDL in the AAV-LSR group mice were significantly reduced. These results indicate that LSR can effectively improve age-related hyperlipidemia.
[0240] Example 8: A LncRNA for inhibiting LSR expression
[0241] This invention discovered that an approximately 270 nt antisense non-coding transcript, ENST00000685454.2, interacts with the 3'UTR region of the LSR. When its expression level decreases in cells, LSR expression increases. The lncRNA sequence (5'-3') is as follows:
[0242] GGGGCACGTTCTCCGGCCGGCGGCGCGGGCGGGCCGGGCCAGGCTGGGTCTCTTCCTCCCGGCCCCGGACTCCGGTGCCCCCGGGACGGCGGCGCTTTACAGACGCATACGGGAGCAGCCCCGGTCCCCCGCCCG CGCGGCCGAACAAATGGTTCTCTCCAGAGCTTGTGATTATACGTTTTATTAGACTCGGGAGGGGTATGGCAGGGCTTCATCAGTGTTCCTTCAAATTAAAAAAAAAAATACAAAAGCTACGTAGAAAACGTCA, as in SEQ Shown as ID NO.20.
[0243] Example 9: An unmodified lncRNA that inhibits LSR expression
[0244] This embodiment provides an experiment for screening unmodified LncRNAs that inhibit LSR expression in two human hepatocellular carcinoma cell lines, Hep3B and HepG2, as well as the human primary liver cell line HepaRG. The experimental procedure is as follows:
[0245] Step 1: Constructing the LncRNA expression plasmid pLVX
[0246] An intracellular expression plasmid for LncRNA was constructed using the pLVX plasmid. The plasmid contained all the nucleotide sequences of LncRNAENST00000685454.2 (LncRNA-LSR-AS1, SEQ ID NO: 20), thus obtaining the LncRNA expression plasmid.
[0247] Step 2: Cell Culture and Transfection
[0248] In a 12-well plate, add 25 μl of DMEM (purchased from Meilun Biotechnology) containing 1 μg pLVX plasmid and 2 μl P3000reagent per well, and add 25 μl of Lipofectamine 3000 (purchased from Invitrogen, catalog number L3000015) per well. After mixing, incubate at room temperature (25°C) for 15 minutes to obtain a mixture. Add the above mixture to a solution containing 3.5 × 10⁻⁶ DMEM containing 1 μg pLVX plasmid and 2 μl P3000reagent per well. 5Complete culture medium was used to culture human hepatocellular carcinoma cells at 37°C for 12 hours. Human hepatocellular carcinoma cell lines Hep3B and HepG2 were cultured in DMEM complete medium (purchased from Meilun Biotechnology), and human primary liver cell line HepaRG was cultured in William's E medium (purchased from Gibco). Cells were harvested after 48 hours.
[0249] Step 3: RNA extraction
[0250] (1) Add 1 ml of Trizol to each well and homogenize thoroughly using a homogenizer. The homogenizer should be able to aspirate 1 ml of the pipette tip without clogging. After homogenization, aspirate 1 ml and transfer it to a 1.5 ml sterile RNase-free centrifuge tube. Let it stand at room temperature for 10 min to fully lyse the kidney tissue.
[0251] (2) After standing, add 200 μl of chloroform to each centrifuge tube, cover it and shake it vigorously for 15 s. Let it stand at room temperature for about 3 min, then centrifuge at 12000×g for 15 min at 4℃ to separate the three phases. The aqueous phase containing RNA is on the top layer.
[0252] (3) Use a 200 μl pipette to aspirate 500 μl of the aqueous phase after centrifugation, add 500 μl of isopropanol, mix well, and let stand at room temperature for 10 min to precipitate RNA. After standing, centrifuge at 12000×g for 10 min at 4℃ to obtain RNA precipitate.
[0253] (4) Discard the liquid in the centrifuge tube, leaving the RNA precipitate. Add 1 ml of 75% alcohol to wash the RNA precipitate. Shake to make the RNA float to achieve the purpose of thorough washing. Centrifuge at 7500×g for 5 min at 4℃. Repeat this step.
[0254] (5) Discard the 75% alcohol again, centrifuge at 4°C and 7500×g for 5 min to allow the residual liquid on the tube wall to accumulate at the bottom of the tube.
[0255] (6) Carefully aspirate excess liquid with a pipette, avoiding contact with the RNA precipitate. Air dry the RNA at room temperature for about 10 minutes. Observe carefully until the edges of the RNA clumps are clear, indicating that it is dry. Add an appropriate amount of DEPC water (300-500 μl) to dissolve the RNA. Incubate in a water bath at 56°C for 10 minutes to obtain the RNA solution for subsequent experiments.
[0256] Step 4: RNA reverse transcription
[0257] (1) Take 1 μl of the dissolved RNA solution and use a Nano1000 RNA concentration meter to measure the concentration. Adjust the concentration to between 200-300 ng / μl. Take 1 μg of RNA and reverse transcribe it according to the method described in the reverse transcription kit (Aikerui Biotechnology). Perform real-time quantitative PCR on the obtained cDNA, or freeze it at -80℃.
[0258] Step 5: qPCR reaction
[0259] The qPCR reaction system is shown in Table 1.
[0260] Table 1 qPCR reaction system
[0261]
[0262] The qPCR reaction conditions are shown in Table 2.
[0263] Table 2 qPCR reaction conditions
[0264]
[0265] Primers (including Primer F (including LSR -F、 LncRNA-LSR-AS1 -F、 GAPDH -F), Primer R (including LSR -R、 LncRNA-LSR-AS1 -R、 GAPDH The -R) sequence is shown below:
[0266] LSR -F: GACGTTACAGGAGTAGCTCAG, as shown in SEQ ID NO.21;
[0267] LSR -R: CCTTCTCCATGTAGTACAGGACC, as shown in SEQ ID NO.22;
[0268] LncRNA-LSR-AS1 -F: TTACAGACGCATACGGGAGC, as shown in SEQ ID NO.23;
[0269] LncRNA-LSR-AS1 -R:TGATGAAGCCCTGCCATACC, as shown in SEQ ID NO.24;
[0270] GAPDH -F: TGATGACATCAAGAAGGTGGTGAAG, as shown in SEQ ID NO.25;
[0271] GAPDH-R:TCCTTGGAGGCCATGTGGGCCAT, as shown in SEQ ID NO.26.
[0272] The reaction was repeated for 40 cycles. After the reaction, the exported data was saved, and the relative quantification of the target gene LSR in each test group was performed using the Ct difference (ΔCt) method. The calculation method is as follows:
[0273] ΔCt (test group) = Ct (target gene in test group) – Ct (internal reference gene in test group)
[0274] ΔCt (control group) = Ct (target gene in control group) – Ct (internal reference gene in control group)
[0275] Using the control group as a baseline, the expression level of LSR mRNA in the test group was normalized, and the LSR mRNA expression level in the control group was defined as 1.
[0276] The relative expression level of LSR mRNA in the test group was 2. -ΔCt(测试组)
[0277] like Figure 11 As shown in A, B, and C, overexpression of LncRNA-LSR-AS1 in human hepatocellular carcinoma cell lines Hep3B and HepG2, as well as human primary liver cell line HepaRG, resulted in a significant decrease in LSR mRNA expression.
[0278] Example 10: A siRNA for promoting LSR expression
[0279] This embodiment provides an siRNA for promoting LSR expression, the nucleotide sequence of which is designed based on LncRNA-LSR-AS1 (ENST00000685454.2).
[0280] The siRNA sequences are shown in Table 3.
[0281] Table 3 siRNA sequences
[0282]
[0283] Example 11: Screening of unmodified siRNAs for promoting LSR expression
[0284] This embodiment provides an experiment for screening unmodified siRNAs that promote LSR expression in two human hepatocellular carcinoma cell lines, Hep3B and HepG2, as well as the primary human liver cell line HepaRG. To screen for siRNAs that effectively target LncRNA-LSR-AS1, different siRNA sequences were transfected into cells. After 48 hours, the total RNA of the cells was harvested, and the expression levels of LncRNA-LSR-AS1 and LSR mRNA were detected by qRT-PCR. Based on Experiment 9, steps one through five were retained, but the LncRNA-LSR-AS1 described in step one was replaced with the siRNA described in Experiment 11.
[0285] like Figure 12 As shown in A, B, and C, all seven siRNA groups (si-6, si-26, si-43, si-69, si-87, si-131, si-151, si-190, and si-214) promoted the expression of LSR mRNA. Among them, the expression of LSR mRNA was significantly increased in the si-151 group, indicating that si-151 had a more significant promoting effect on LSR expression.
[0286] Example 12: Detection of the on-target activity of unmodified siRNA used to promote LSR
[0287] Example 8 discovered a lncRNA ENST00000685454.2 (LncRNA-LSR-AS1, SEQ ID NO. 20). Inhibiting this lncRNA through siRNA leads to LSR activation. Example 7 discovered an effective siRNA targeting LncRNA-LSR-AS1, si-151. After transfecting cells with different concentrations of si-151 for 48 hours, the total RNA of the cells was harvested, and the expression levels of LncRNA-LSR-AS1 and LSR mRNA were detected by qRT-PCR to determine whether there is a regulatory relationship between si-151 and LSR. Based on Example 9, steps one to five were retained, and the siRNA described in step one was replaced with the siRNA described in Example 11.
[0288] like Figure 13 As shown in A, B, and C, the expression level of LSR mRNA was significantly increased at 1.25 μg / ml among the four concentrations of siRNA si-151; Figure 14 As shown in A, B, and C, among the four concentrations of siRNA si-151, the expression level of LncRNA-LSR-AS1 was significantly reduced in the 1.25 μg / ml group, indicating that 1.25 μg / ml of siRNA si-151 has high inhibitory activity.
[0289] Example 13: siRNA promotes LSR protein expression
[0290] This embodiment provides an experiment to detect whether siRNA promotes LSR expression by inhibiting LncRNA-LSR-AS1 in two human hepatocellular carcinoma cell lines, Hep3B and HepG2, as well as the human primary liver cell line HepaRG. Based on Example 9, steps one through five are retained, but the siRNA described in step one is replaced with the siRNA si-151 described in Example 12. Based on Example 1, steps one and two are retained, and then total cellular protein is collected for Western blot analysis to detect the protein expression level of LSR. The experimental steps are as follows:
[0291] Step 3: Protein extraction and BCA quantification
[0292] After washing the cells with PBS, the residual liquid was aspirated, and an appropriate amount of RIPA lysis buffer and protease inhibitor were added. The cells were fully lysed on ice, centrifuged at 12,000 rpm and 4°C for 10 min, and the supernatant was collected. The protein concentration of the cell lysis buffer was detected using a BCA kit.
[0293] Step 4: Western Blot detection of LSR protein expression
[0294] 50 μg of protein was loaded onto a gel, transferred to a membrane, blocked with 5% skim milk powder at room temperature for 2 hours, incubated overnight at 4°C with LSR and β-actin antibody, washed 3 times with PBS, incubated with rabbit antibody at room temperature for 2 hours, washed 3 times with PBS, and then developed.
[0295] like Figure 15 As shown in A and B, siRNA si-151 significantly increased the expression of LSR protein in human hepatocellular carcinoma cell lines Hep3B and HepG2, as well as human primary liver cell line HepaRG.
[0296] Example 14 Modified siRNA for promoting LSR expression
[0297] The target gene is located in the liver, and siRNA is known to enter the liver; its targeting effect in the liver can be enhanced by adding a GalNac conjugate. Therefore, delivery is relatively simple by injecting siRNA into the bloodstream.
[0298] Example 15 Modified siRNA for promoting LSR expression
[0299] This embodiment provides an experiment for screening modified siRNAs that promote LSR expression in human hepatocellular carcinoma cell lines Hep3B and HepG2, as well as the human primary liver cell line HepaRG. Based on Example 9, steps one to five are retained, but the siRNA described in step one is replaced with the siRNA (S0) and modified siRNA described in Experiment 12. This embodiment provides a modified siRNA for promoting LSR expression. The siRNA modified according to formula (I) includes S1, S2, and S3, where formula (I) is as follows:
[0300] Justice Chain: 5'-np-Na-YYY-Nb-nq-3'
[0301] Antonym chain: 3'-np'-Na'-Y'Y'Y'-Nb'-nq'-5' (I)
[0302] in:
[0303] np, np', nq, and nq' are 0 to 2 nucleotides respectively; each nucleotide is linked to an adjacent nucleotide via a phosphate thioester bond.
[0304] Na, Nb, Na', and Nb' each independently represent an oligonucleotide sequence, which is a sequence containing 0-25 nucleotides, and the sequence contains at least one or a combination of modified nucleotides and unmodified nucleotides, and the sequence contains at least two different types of modified nucleotides.
[0305] YYY and Y'Y'Y' each independently represent a motif, which consists of three consecutive nucleotides, each of which is modified with the same chemical group.
[0306] The sense strand of S1 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43, where np and nq are 0 nucleotides. Following the direction from the 5' end to the 3' end, positions 1-9 are Na, positions 10-12 are YYY, positions 13-19 are Nb, the nucleotides at positions 7, 8, 10, 11, 12, 14, and 17 are nucleotides modified with a 2' methoxy group, and the nucleotides at positions 18 and 19 are linked by a phosphate thioester group. The 3' end is modified with GalNac. The antisense strand of S1 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43. The sequence shown in NO.44 was obtained after chemical modification. np' consists of 2 nucleotides and nq' consists of 0 nucleotides. Following the direction from the 5' end to the 3' end, positions 1-10 are Na', positions 11-13 are Y'Y'Y', and positions 14-21 are Nb'. The nucleotides at positions 18 and 19, 19 and 20, and 20 and 21 are linked by thiophosphate groups. The nucleotides at positions 1, 2, 5, 7, 11, 12, 13, 17, 19, and 20 are nucleotides modified with 2' methoxy groups, and the nucleotide at position 6 is a nucleotide modified with 2' fluoride groups.
[0307] The sense strand of S2 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43. np and nq are 0 nucleotides. Following the direction from the 5' end to the 3' end, positions 1-8 are Na, positions 9-11 are YYY, and positions 12-19 are Nb. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups. The nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, and 19 are nucleotides modified with a 2' methoxy group. The nucleotides at positions 7, 9, 10, and 11 are nucleotides modified with a 2' fluoride group. The 3' end is modified with GalNac. The antisense strand of S2 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43. The sequence shown in NO.44 was obtained after chemical modification. np' consists of 2 nucleotides and nq' consists of 0 nucleotides. Following the direction from the 5' end to the 3' end, positions 1-7 are Na', positions 8-10 are Y'Y'Y', and positions 11-21 are Nb'. The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups. The nucleotides at positions 1, 3, 4, 5, 11, 13, 15, 16, 17, 18, 19, 20, and 21 are nucleotides modified with 2' methoxy groups. The nucleotides at positions 2, 6, 8, 9, 10, 12, and 14 are nucleotides modified with 2' fluoride groups. Position 7 is an ethylene glycol nucleic acid.
[0308] The sense strand of S3 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43. np and nq are 0 nucleotides. Following the direction from the 5' end to the 3' end, positions 1-8 are Na, positions 9-11 are YYY, and positions 12-19 are Nb. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups. The nucleotides at positions 2, 4, 6, 8, 12, 14, 16, and 18 are nucleotides modified with a 2' methoxy group. The nucleotides at positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, and 19 are nucleotides modified with a 2' fluoride group. The 3' end is modified with GalNac. The antisense strand of S3 is obtained by chemically modifying the sequence shown in SEQ ID NO. 43. The sequence shown in NO.44 was obtained after chemical modification. np' consists of 2 nucleotides and nq' consists of 0 nucleotides. Following the direction from the 5' end to the 3' end, positions 1-8 are Na', positions 9-11 are Y'Y'Y', and positions 12-21 are Nb'. The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups. The nucleotides at positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, 20, and 21 are nucleotides modified with 2' methoxy groups, and the nucleotides at positions 2, 4, 6, 8, 12, 14, 16, and 18 are nucleotides modified with 2' fluoride groups.
[0309] like Figure 16 As shown in A, B, and C, GalNac siRNA conjugate S3 significantly increases LSR mRNA expression, such as Figure 17 As shown in A, B, and C, the GalNac siRNA conjugate S3 significantly reduced the expression of LncRNA ENST00000685454.2, indicating that the modified siRNA numbered S3 has high inhibitory activity. Figure 18 As shown in A, B, and C, among the five concentrations of S3, the expression level of LSR mRNA in the 50 nM group was significantly increased, indicating that the 50 nM S3 has high inhibitory activity.
[0310] Example 16: siRNA promotes cellular uptake of LDL
[0311] This embodiment provides a siRNA that targets LncRNA-LSR-AS1 to promote cellular uptake of LDL, wherein the siRNA includes si-151 (SEQ ID NO.43 and SEQ ID NO.44).
[0312] Example 17: siRNA promotes cellular uptake of LDL
[0313] This embodiment provides an experiment for detecting siRNA-induced LDL uptake in cells. Based on Example 13, steps one and two are retained, with a 96-well plate used instead of a 12-well plate in step two. Other experimental steps are as follows:
[0314] Step 3: LDL Intake
[0315] 1. Aseptically dilute DiI-LDL to 40 mg / ml in culture medium.
[0316] 2. Add the diluted DiI-LDL to a 24-well plate and incubate at 37°C for 5 hours.
[0317] 3. Remove the culture medium containing DiI-LDL.
[0318] 4. Wash the cells three times with probe-free culture medium.
[0319] 5. For detection using a fluorescent microplate reader, standard rhodamine excitation is used. Recommended wavelengths: excitation: 554 nm, emission: 571 nm.
[0320] like Figure 19 As shown in A, B, and C, S3 significantly increased the uptake of LDL by Hep3B, HepG2, and HepaRG cells.
[0321] Example 18: siRNA promotes LDL uptake in liver organoids
[0322] This embodiment provides an experimental method for detecting siRNA-induced LDL uptake in liver organoids. The experimental steps are as follows:
[0323] Step 1: Culture of human liver organoids
[0324] The procedure was performed according to the instructions for the HepatiCult™ Organoid Kit (Human) from STEMCELL Technologies. The obtained patient liver tissue was washed, digested, and centrifuged to obtain a cell suspension. The cell suspension was mixed with Matrigel and seeded into 24-well plates. The medium was changed regularly during culture, and organoid growth was observed. On day 13 of culture, the organoids and Matrigel were mechanically separated, and the cells were reseeded into 24-well plates.
[0325] Step 2: LDL Intake
[0326] 1. The LDL uptake capacity of liver organoids was detected after treating them with 50 nM S3 for 48 hours.
[0327] 2. Aseptically dilute DiI-LDL to 40 mg / ml in the culture medium.
[0328] 3. Add the diluted DiI-LDL to a 24-well plate and incubate at 37°C for 5 hours.
[0329] 4. Remove the culture medium containing DiI-LDL.
[0330] 5. Wash the cells three times with probe-free culture medium.
[0331] 6. For detection using a fluorescent microplate reader, use standard rhodamine excitation. Recommended wavelengths: excitation: 554 nm, emission: 571 nm.
[0332] like Figure 20 As shown, S3 significantly increases the uptake of LDL by liver organoids.
[0333] Example 19: siRNA promotes LDL uptake in LDLR knockout cells
[0334] This embodiment provides an experiment to detect siRNA-induced LDL uptake in cells. Based on Example 17, wild-type HepG2, Hep3B, and HepaRG cells with LDLR gene knockout were used instead of wild-type HepG2, Hep3B, and HepaRG cells.
[0335] like Figure 21 As shown in A, B, and C, the uptake of LDL by LDLR knockout cells was significantly increased after S3 treatment, but there was no significant change in the PCSK9 siRNA treatment group compared with the control group.
[0336] in addition, Figure 21 Figures A, B, and C indicate that siRNA si-151 increased LDL uptake in Hep3B, HepG2, and HepaRG cells by 46%, while Incisiran siRNA promoted LDL uptake in all three cell types by 6%. This demonstrates that si-151 significantly promotes LDL uptake in LDLR knockout hepatocytes more effectively than the marketed PCSK9-targeting siRNA drug Incisiran.
[0337] Example 20: LSR significantly reduced the concentration of very low-density lipoprotein (vLDL) in the body's serum.
[0338] This embodiment constructs an animal model according to step one of embodiments 2, 3 and 5.
[0339] Step 2: Detection of T-CHO, TG and LDL in serum
[0340] The concentration of vLDL in the serum of mice in each group was detected using a commercially available kit, following the instructions. (vLDL detection kit: H249-1-2, Nanjing Jiancheng Biotechnology Institute).
[0341] like Figure 22 As shown in A, B, and C, in the C57BL / 6 mouse high-fat model, LDLR knockout mice on a high-fat diet, and LDLR heterozygous mice on a high-fat diet, the concentration of vLDL in the serum of AAV-LSR group mice was significantly lower than that in the AAV-CTL group mice, indicating that LSR can effectively reduce the concentration of vLDL in the body's serum.
[0342] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of LncRNA-LSR-AS1 as a target in screening products for treating hyperlipidemia, wherein the LncRNA-LSR-AS1 is an LncRNA with a sequence as shown in SEQ ID NO.
20. LncRNA-LSR-AS1 is an antisense long non-coding RNA of LSR gene, which inhibits LSR protein expression and affects lipid metabolism by targeting the 3'UTR region of LSR mRNA; inhibiting the expression of LncRNA-LSR-AS1 or its activity of binding with LSR mRNA 3'UTR can relieve the inhibition of LSR expression and promote LSR expression.
2. A target siRNA characterized in that, The targeting siRNA reduces the expression level of LncRNA-LSR-AS1 by specifically binding to LncRNA-LSR-AS1, wherein the LncRNA-LSR-AS1 is an LncRNA with a sequence as shown in SEQ ID NO.
20. The targeting siRNA is a double-stranded RNA, and the siRNA sequence is selected from any one or more of the following groups: the nucleotide sequence of the sense strand is as shown in SEQ ID NO. 27, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO. 28; the nucleotide sequence of the sense strand is as shown in SEQ ID NO. 31, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO. 32; the nucleotide sequence of the sense strand is as shown in SEQ ID NO. 33, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO. 34; the nucleotide sequence of the sense strand is as shown in SEQ ID NO. 39, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO. 40; the nucleotide sequence of the sense strand is as shown in SEQ ID NO. 43, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO. 44; the nucleotide sequence of the sense strand is as shown in SEQ ID NO. 49, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO. 50; the nucleotide sequence of the sense strand is as shown in SEQ ID NO. 51, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.
52.
3. A composition characterized in that, The composition comprises the targeting siRNA of claim 2 and adjuvants.
4. The composition of claim 3, wherein The adjuvants are carriers and / or excipients, the carriers are one or more of buffer solution, physiological saline, lipid nanoparticles, polymer nanoparticles, and inorganic nanoparticles; the excipients are one or more of diluents, binders, humectants, disintegrants, absorption promoters, surfactants, and lubricants.
5. The composition of claim 3, wherein The dosage form of the composition is tablets, capsules, powders, pills, granules, solutions, suspensions, syrups, injections, suppositories, inhalants, or sprays.
6. The composition of claim 3, wherein The weight content of the targeting siRNA in the composition is 1%-99%.
7. Use of the targeting siRNA of claim 2 or the composition of any one of claims 3-6 in the preparation of a medicament for treating hyperlipidemia.
8. Use of an agent for inhibiting expression of LncRNA-LSR-AS1 in the preparation of a drug for treating hyperlipidemia. wherein The LncRNA-LSR-AS1 is an LncRNA with a sequence as shown in SEQ ID NO. 20; and the agent for inhibiting expression of LncRNA-LSR-AS1 is a targeted siRNA as claimed in claim 2.