Application of TaCTR1 protein or gene for coding TaCTR1 protein in regulation and control of powdery mildew resistance of plants
By regulating the TaCTR1 protein or the gene encoding the TaCTR1 protein, and using gene silencing or overexpression technology, the problem that traditional breeding is difficult to improve the resistance of powdery mildew in plants is solved, efficient powdery mildew resistance breeding and identification is achieved, and new breeding resources are provided.
Patent Information
- Application Number
- CN202510639944.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-08-19
AI Technical Summary
In the prior art, traditional breeding methods are difficult to effectively improve the resistance of plants to powdery mildew, and there is a lack of effective powdery mildew resistance-related genes in molecular breeding, which leads to a long breeding cycle and is difficult, and hinders the development of molecular breeding.
By regulating the TaCTR1 protein or the gene encoding the TaCTR1 protein, gene silencing or overexpression technology is used to intervene in the expression of TaCTR1 protein in plants, reduce the number of spores and spore biomass of powdery leucorrhea, and improve the resistance of plants to powdery leucorrhea.
The TaCTR1 gene silencing wheat significantly enhanced its resistance to powdery mildew, while overexpressing wheat became more sensitive, proving that the TaCTR1 protein plays a negative regulatory role in regulating resistance to powdery mildew in plants, providing new resources and identification methods for breeding.
Smart Images

Figure CN120505328A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular biotechnology, and particularly relates to the application of TaCTR1 protein or a gene encoding TaCTR1 protein in regulating plant resistance to powdery mildew. Background Art
[0002] Powdery mildew, an obligate parasitic fungal disease caused by Blumeria graminis f.sp. tritici (Bgt), is a widespread, frequent, and highly explosive disease affecting crops worldwide, posing a serious threat to crop production. Currently, the area affected by powdery mildew is gradually expanding. Vigorously cultivating and applying disease-resistant varieties is the most economical, effective, and long-term safe method for controlling powdery mildew, and is also a key goal of current and future plant breeding. Traditional breeding cycles are long, difficult, and require significant human and material resources. In recent years, molecular biology techniques have been widely used in biobreeding. Transgenic breeding allows for targeted improvement of plants and shortens breeding cycles. However, limited research has been conducted on genes associated with powdery mildew resistance, severely hindering the development of molecular breeding. Summary of the Invention
[0003] The purpose of the present invention is to provide a TaCTR1 protein or a gene encoding the TaCTR1 protein for use in at least one of regulating plant resistance to powdery mildew, creating powdery mildew-resistant transgenic plants, breeding powdery mildew-resistant plant varieties, and identifying or assisting in the identification of powdery mildew-resistant plant varieties, thereby providing resources for transgenic breeding of powdery mildew-resistant plant varieties.
[0004] In order to achieve the above object, the present invention provides the following technical solutions:
[0005] The present invention provides an application of a TaCTR1 protein or a gene encoding the TaCTR1 protein in at least one of regulating plant resistance to powdery mildew, creating powdery mildew-resistant transgenic plants, breeding powdery mildew-resistant plant varieties, and identifying or assisting in identifying powdery mildew-resistant plant varieties.
[0006] Preferably, the TaCTR1 protein or the gene encoding the TaCTR1 protein improves the plant's resistance to powdery mildew through negative regulation.
[0007] Preferably, said improving the resistance of a plant to powdery mildew comprises reducing the number and / or spore biomass of powdery mildew spores infected in the plant.
[0008] Preferably, the plants include plants of the family Poaceae.
[0009] The present invention provides an agent for intervening in the expression of the TaCTR1 protein or the gene, including a silencing segment targeting the gene or a gene-derived product containing the silencing segment;
[0010] The nucleotide sequence of the silencing fragment is shown in SEQ ID NO: 3.
[0011] The present invention provides an application of the reagent in at least one of the following tasks: improving plant resistance to powdery mildew, creating powdery mildew-resistant transgenic plants, breeding powdery mildew-resistant plant varieties, and identifying or assisting in identifying powdery mildew-resistant plant varieties.
[0012] The present invention provides a method for regulating plant resistance to powdery mildew, wherein a gene encoding TaCTR1 protein is overexpressed in a plant to reduce the plant's resistance to powdery mildew;
[0013] Alternatively, the biological function of the TaCTR1 protein or the expression level of the gene encoding the TaCTR1 protein can be inhibited to improve the plant's resistance to powdery mildew.
[0014] The present invention provides a method for identifying plant resistance to powdery mildew, which comprises detecting the expression level of the TaCTR1 protein or a gene encoding the TaCTR1 protein in the plant, and judging the plant's resistance to powdery mildew based on the expression level: the expression level of the TaCTR1 protein or the gene encoding the TaCTR1 protein is negatively correlated with the plant's resistance to powdery mildew.
[0015] Preferably, the reagent for detecting the expression level of the gene includes a forward primer shown in SEQ ID NO: 4 and a reverse primer shown in SEQ ID NO: 5.
[0016] Preferably, the plants include plants of the family Poaceae.
[0017] Beneficial effects:
[0018] The present invention provides a use of a TaCTR1 protein or a gene encoding the TaCTR1 protein for at least one of regulating plant resistance to powdery mildew, creating powdery mildew-resistant transgenic plants, breeding powdery mildew-resistant plant varieties, and identifying or assisting in the identification of powdery mildew-resistant plant varieties. The TaCTR1 protein or a derivative of the gene encoding the TaCTR1 protein can negatively regulate wheat powdery mildew resistance. The present invention used TaCTR1 gene-silenced wheat and TaCTR1 gene-overexpressing wheat as research subjects, respectively, and examined the phenotypes after inoculation with powdery mildew. The results showed that compared with the control, the TaCTR1 gene-silenced strain had a significantly reduced number of microcolonies three days after inoculation, and significantly enhanced resistance to wheat powdery mildew. These experimental results indicate that the TaCTR1 gene plays a negative regulatory role in wheat's resistance to powdery mildew. Compared with the wild-type control, the TaCTR1 overexpressing transgenic strain had a significantly increased number of microcolonies three days after inoculation. Therefore, TaCTR1 gene silencing can improve the powdery mildew resistance of plants, and TaCTR1 protein and its encoding gene will play an important role in breeding disease-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 Figure 1 is a graph showing the test results of the powdery mildew resistance of wheat TaCTR1 gene-silenced lines and wild-type control materials; A is a graph showing the changes in gene expression in the TaCTR1 gene-silenced lines, B is a statistical graph showing the powdery mildew microcolony index of the TaCTR1 mutant materials and the wild-type control materials 3 days after inoculation with powdery mildew, and C is a graph showing the microcolony phenotype of the leaves of the TaCTR1 gene-silenced lines and the wild-type control materials 3 days after inoculation with powdery mildew.
[0020] Figure 2 Figure 3 is a graph showing the test results of the powdery mildew resistance of wheat TaCTR1 overexpressing transgenic lines compared with the wild-type control plants; A is a graph showing the expression level of the TaCTR1 gene in the TaCTR1 overexpressing transgenic lines, B is a statistical graph showing the powdery mildew microcolony index of the TaCTR1 overexpressing transgenic lines and the wild-type control materials 3 days after inoculation with powdery mildew, and C is a graph showing the microcolony phenotype of the leaves of the TaCTR1 overexpressing transgenic lines and the wild-type control materials 3 days after inoculation with powdery mildew. DETAILED DESCRIPTION
[0021] The present invention provides an application of a TaCTR1 protein or a gene encoding the TaCTR1 protein in at least one of improving plant resistance to powdery mildew, cultivating powdery mildew-resistant transgenic plants, and breeding powdery mildew-resistant plant varieties.
[0022] In the present invention, the TaCTR1 protein is preferably at least one of the following proteins;
[0023] 1) amino acid sequence as SEQ ID NO: 1(
[0024] ) shown in the protein;
[0025] 2) A fusion protein formed by the protein described in item 1) and a tag sequence;
[0026] 3) A protein with unchanged biological function obtained by replacing, deleting or inserting one or more amino acid residues based on the protein described in item 1).
[0027] In the present invention, the TaCTR1 protein preferably includes a protein that has 98% or more identity with the protein described in item 1) and is associated with wheat disease resistance. The identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using BLASTP as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and searching for the identity of a pair of amino acid sequences, the calculation is performed, and then the identity value (%) can be obtained.
[0028] In the present invention, the tag sequence described in item 2) refers to a polypeptide or protein that is fused with the target protein to facilitate expression, detection, tracing, and / or purification during in vitro DNA recombination techniques. The tag sequence preferably includes at least one of the following: a FLAG tag, a polyhistidine tag, an MBP tag, a hemagglutinin tag, a Myc tag, a GST tag, and a SUMO tag. The tag sequence is preferably linked to the 5' or 3' end of the gene encoding the TaCTR1 protein.
[0029]
[0030] In the present invention, the TaCTR1 protein or the encoding gene preferably improves the plant's resistance to powdery mildew through negative regulation.
[0031] In the present invention, improving a plant's resistance to powdery mildew preferably includes reducing the number and / or spore biomass of powdery mildew spores infecting the plant. The plant preferably comprises a grass, more preferably at least one of the following: corn, rice, oats, sugarcane, and wheat, most preferably wheat. The present invention does not specifically limit the wheat variety or the physiological race of the powdery mildew pathogen. In this embodiment, the wheat variety is the wild-type hexaploid wheat Kenong 199, and the powdery mildew pathogen is race E09.
[0032] In this example, wheat plants with TaCTR1 gene silenced and TaCTR1 gene overexpressed were used as research subjects to examine the phenotypes after inoculation with powdery mildew. The results showed that compared to wild-type control plants, TaCTR1-silenced wheat exhibited higher resistance, while TaCTR1-overexpressing wheat was more susceptible to the powdery mildew pathogen. Therefore, the TaCTR1 protein or the gene encoding it can regulate powdery mildew resistance in plants.
[0033] The present invention provides an agent for intervening in the expression of the TaCTR1 protein or the encoding gene, comprising a silencing segment targeting the encoding gene or a gene-derived product containing the silencing segment. The nucleotide sequence of the silencing segment is shown in SEQ ID NO: 3 (TCGTGGGGTGACAAGATCGCGCACGGGTTCTACAACATCATGGGCATCGACCCGCACCTGTGGGCGATGTGCAACGCCGA). The gene-derived product preferably comprises a recombinant silencing vector. The present invention does not specifically limit the construction method of the recombinant silencing vector; methods commonly used by those skilled in the art for constructing recombinant silencing vectors for plant gene silencing can be employed. In an embodiment of the present invention, pCaBS-γ (a γ vector, the γ portion of the BSMV viral vector) was used as a backbone vector, and the silencing segment was inserted between the PacI and NotI residues of pCaBS-γ to obtain the recombinant silencing vector pCaBS-γ:TaCTR1as. This recombinant silencing vector can efficiently silence the target gene and improve plant resistance to powdery mildew.
[0034] The present invention provides an application of the reagent in at least one of the following tasks: improving plant resistance to powdery mildew, identifying or assisting in identifying powdery mildew-resistant plant varieties, creating powdery mildew-resistant transgenic plant varieties, and breeding powdery mildew-resistant plant varieties.
[0035] In the present invention, the method for breeding powdery mildew-resistant plant varieties preferably comprises intervening with the TaCTR1 protein expression or the encoding gene expression using the reagent, and then detecting the expression level of the TaCTR1 protein or the encoding gene in the plant genome: selecting plants with high expression levels of the TaCTR1 protein or the encoding gene as breeding materials for breeding resistant plant varieties. The reagent for detecting the expression level of the encoding gene includes the forward primer set forth in SEQ ID NO: 4 and the reverse primer set forth in SEQ ID NO: 5.
[0036] The present invention provides a method for regulating plant resistance to powdery mildew, wherein a gene encoding TaCTR1 protein is overexpressed in a plant to reduce the plant's resistance to powdery mildew;
[0037] Alternatively, the biological function of TaCTR1 protein or the expression level of the gene encoding TaCTR1 protein can be inhibited to improve the plant's resistance to powdery mildew.
[0038] In the present invention, the method for overexpression in plants is preferably to transfect a host bacterium with a recombinant expression vector containing the gene encoding the TaCTR1 protein, and to infect a host plant with the resulting recombinant bacterium to obtain a plant that overexpresses the TaCTR1 gene or TaCTR1 protein. The backbone vector types of the recombinant expression vector preferably include at least one of the following: plasmid, cosmid, and bacteriophage. In an embodiment of the present invention, the pUbi-HA vector is used as the backbone vector, and the cloning site is SacI. The pUbi-HA vector was provided by Wang Daowen's research group at Henan Agricultural University (New Phytologist (2020) 225: 2526-2541 doi: 10.1111 / nph.16305). The method for constructing the recombinant expression vector is preferably to seamlessly clone the gene encoding the TaCTR1 protein into the backbone vector to obtain a recombinant expression vector. The host bacteria types of the recombinant bacteria preferably include bacteria and / or fungi. The bacteria preferably include Agrobacterium or Escherichia coli. In an embodiment of the present invention, the host bacteria is Agrobacterium. The strain of Agrobacterium is C58C1, purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd., with the product number ZC1504. The method for constructing the recombinant bacteria is preferably to transfect the recombinant vector into the host bacteria. The transfection method is preferably the freeze-thaw method. After obtaining the recombinant bacteria, the host plant is infected with the recombinant bacteria to obtain a plant that overexpresses the TaCTR1 gene or TaCTR1 protein. The infection method is preferably infection by the embryo stripping method. The reagents for detecting the expression of the TaCTR1 gene include a forward primer with a nucleotide sequence as shown in SEQ ID NO: 4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 5. In the embodiment of the present invention, transgenic wheat plants overexpressing the TaCTR1 gene are obtained by the method. Compared with wild-type wheat, transgenic wheat plants overexpressing the TaCTR1 gene are more sensitive to powdery mildew pathogens.
[0039] In the present invention, the method of inhibiting the biological function of the TaCTR1 protein or inhibiting the expression of the gene encoding the TaCTR1 protein preferably includes silencing the TaCTR1 protein and its encoding gene in the plant using the BSMV-VIGS technology. In the present invention, the method of the BSMV-VIGS technology preferably linearizes the recombinant silencing vector using the restriction endonuclease MluI, linearizes pCaBS-α using the restriction endonuclease MluI, and linearizes pCaBS-β using the restriction endonuclease SpeI. After linearization, in vitro transcription is performed, and the obtained pCaBS-α, pCaBS-β and the transcription product of the recombinant silencing vector are prepared into a mixed solution and the plant is inoculated with the virus to obtain a plant in which the TaCTR1 protein or its encoding gene is silenced. The pCaBS-α, pCaBS-β and γ vectors are from Wang Daowen Laboratory of Henan Agricultural University (see prior art: New Phytologist (2020) 225: 2526-2541 doi: 10.1111 / nph.16305). The reagent for detecting the expression of the TaCTR1 gene is the same as the reagent for detecting the expression of the TaCTR1 gene described above. In the embodiment of the present invention, wheat plants with TaCTR1 gene silenced by the method showed higher resistance. Compared with wild-type wheat, wheat plants with TaCTR1 gene silenced showed higher resistance.
[0040] In the present invention, the species of the plant and powdery mildew pathogen are preferably the same as those in the above-mentioned application technology solution and are not further described here. The reagent used to detect the expression level of the encoding gene is preferably the same as that used in the above-mentioned method for breeding powdery mildew-resistant plant varieties and is not further described here.
[0041] The present invention provides a method for identifying plant resistance to powdery mildew, which comprises detecting the expression level of the TaCTR1 protein or the encoding gene in the plant, and judging the plant's resistance to powdery mildew based on the expression level: the expression level of the TaCTR1 protein or the encoding gene is negatively correlated with the plant's resistance to powdery mildew.
[0042] In the present invention, the reagents used to detect the expression level of the coding gene are preferably the same as those used in the above-mentioned method for breeding powdery mildew-resistant plant varieties, and are not described in detail here. The types of the plants and powdery mildew pathogens are preferably the same as those in the above-mentioned application technology solution, and are not described in detail here.
[0043] In any of the aforementioned uses or methods, plants that silence or overexpress the TaCTR1 protein include not only first-generation transgenic plants obtained by transforming the target plant with the gene encoding the TaCTR1 protein, but also their progeny. Transgenic plants can be propagated within the species or transferred using conventional breeding techniques into other varieties of the same species, particularly commercial varieties. Such transgenic plants include seeds, callus tissue, whole plants, and cells.
[0044] In order to further illustrate the present invention, the embodiments provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be understood as limiting the scope of protection of the present invention.
[0045] Example 1
[0046] Obtaining and testing TaCTR1 gene silenced plants
[0047] 1. Obtaining TaCTR1 gene-silenced plants
[0048] Using cDNA from leaves of the common wheat variety Kenong 199 as a template, primers BSMV-VIGS-TaCTR1-f (SEQ ID NO: 8GATTCTTCTTCCGTTGCTAGCTCGTGGGGTGACAAGATCG) and BSMV-VIGS-TaCTR1-r (SEQ ID NO: 9TTTTTTTTTTTTTTAGCTAGCTCGGCGTTGCACATCGCCCAC) were used to amplify the silencing sequence. The PCR reaction system consisted of 5.0 μL of 10× Buffer, 5.0 μL of dNTPs, 1.5 μL of each upstream and downstream primer (10 μM concentration), 1.0 μL of cDNA (reverse transcribed from 2 μg of RNA), and 1.0 μL of Taq enzyme (1.0 U). The volume was then made up to 50.0 μL with water. PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 68°C for 36 s, 35 cycles; extension at 68°C for 10 min; and finally, incubation at 16°C for 2 min.
[0049] The silencing sequence was inserted between the restriction sites PacI and NotI of the γ vector (the γ part of the BSMV viral vector) by enzyme digestion and ligation to obtain the recombinant plasmid pCaBS-γ: TaCTR1as.
[0050] The nucleotide sequence of the sequencing primer pair used to verify the recombinant plasmid pCaBS-γ: TaCTR1as is as follows:
[0051] pCa-γ-seq-f CACAGTTGTGGAATGCCATGCTC (SEQ ID NO: 10)
[0052] pCa-γ-seq-r CGAGCTCCTGCAGGACAGTC (SEQ ID NO: 11).
[0053] pCaBS-α, pCaBS-β and recombinant plasmid pCaBS-γ:TaCTR1as were further linearized using restriction endonucleases MluI, SpeI and MluI, respectively, and the linearized fragments were transcribed in vitro to obtain the transcription products of pCaBS-α, pCaBS-β and pCaBS-γ:TaCTR1as.
[0054] The transcription products were then prepared into infection premix for virus inoculation. When wheat grew to the 2-leaf stage, the second leaf was inoculated using the friction inoculation method, with pCaBS-γ empty vector inoculation as a control.
[0055] 2. Detection of TaCTR1 gene-silenced plants
[0056] 14 days after virus inoculation, wheat plants grew to the 4-leaf stage and the relative expression of the TaCTR1 gene was detected. The nucleotide sequence of the primer pair for detecting the relative expression of TaCTR1 is as follows:
[0057] qF: ATGGATGGCGCCAGAGTTTC (SEQ ID NO: 4)
[0058] qR: TGTGCTGGGCCTAGGCCGC (SEQ ID NO: 5).
[0059] The reaction system for detection is:
[0060] 2×ChamQ Universal SYBR qPCR MasterMix (Novozymes, Q711) 10.0 μL Primer 1 (10 μM) 0.4 μL
[0061] Primer 2 (10 μM) 0.4 μL
[0062] Template cDNA 1μL
[0063] ddH2O 8.2μL.
[0064] The reaction procedure is
[0065] Rep:1 95℃ 5min
[0066] Reps:40 95℃ 10s 60℃ 30s*.
[0067] Use the instrument's default melting curve acquisition program* for fluorescence signal acquisition
[0068] The results showed that the expression of TaCTR1 gene was significantly down-regulated in BSMV:TaCTR1as-1 and BSMV:TaCTR1as-2 compared with BSMV:EVC ( Figure 1 This indicates that after virus inoculation, the expression of the TaCTR1 gene in the TaCTR1 gene-silenced plants BSMV:TaCTR1as-1 and BSMV:TaCTR1as-2 was silenced.
[0069] Example 2
[0070] Acquisition of TaCTR1 overexpressing materials and detection of gene expression
[0071] 1) Construction of the recombinant vector pUbi::TaCTR1-HA
[0072] The TaCTR1 gene shown in SEQ ID NO: 2 was ligated into the SacI site of the pUbi-HA vector using the infusion method to obtain the recombinant vector pUbi::TaCTR1-HA, which was then sequenced and verified.
[0073] The primer pair used for sequencing was pUbi-Seq-f: ATCCCCGGGTACCGAGCTC (SEQ ID NO: 12) and pUbi-Seq-r: GTCAGGGTGCAGAGCAGGCA (SEQ ID NO: 13).
[0074] Sequencing showed that there was no mutation in the TaCTR1 gene in the recombinant vector.
[0075] 2) Obtaining recombinant bacteria
[0076] The recombinant vector pUbi::TaCTR1-HA was transformed into Agrobacterium tumefaciens C58C1 to generate the recombinant strain pUbi::TaCTR1-HA / C58C1. The primer pair used to detect the recombinant strain was pUbi-Seq-f and pUbi-Seq-r.
[0077] The specific conversion method is as follows:
[0078] Take competent Agrobacterium C58C1 stored at -70°C and place it in room temperature or ice water bath for a while until it partially thaws. When it is in the ice-water mixing state, insert it into the ice bath; add 1 μg plasmid DNA per 100 μL competent culture, stir the bottom of the tube by hand to mix, and then stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes.
[0079] After an ice bath, add 800 μL of TY liquid culture medium and culture at 28°C with shaking for 3 h; collect the bacteria by centrifugation at 5000 rpm for 1 min, retain about 100 μL of supernatant, gently blow to resuspend the bacteria, spread it on a TY plate containing the corresponding antibiotics, and place it upside down in a 28°C incubator for culture for 3 days.
[0080] 3) Obtaining pUbi::TaCTR1-HA transgenic wheat
[0081] The recombinant bacteria pUbi::TaCTR1-HA / C58C1 was used to infect the wild-type hexaploid wheat Kenong 199 with good growth status. Genetic transformation was carried out by embryo stripping method. After callus differentiation, the transgenic wheat lines carrying TaCTR1 were obtained by screening.
[0082] The specific methods for wheat genetic transformation are as follows:
[0083] Remove the seeds with embryos as small as 2 mm and store at 4°C. Wash the seeds with 75% alcohol for 1 minute, shake them in 15% NaClO solution for about 10 minutes, wash them with sterile water four times, and then peel the embryos. Place the peeled embryos in WLS culture medium and centrifuge them at 7500 rpm at 4°C for 10 minutes. Remove the supernatant and add WLS to clean them.
[0084] Infection: The recombinant bacteria were inoculated into 4 mL of TY medium and shaken overnight at 28°C. The bacteria were collected and resuspended in WLS. The resuspended bacteria were added to the embryos, allowed to stand for 5 minutes, and the suspension was removed. The embryos were placed on sterile filter paper. After blotting, the suspension was placed with the scutellum facing down on AS medium and grown in the dark at 23°C for 48 hours. After tip cutting, the embryos were placed on recovery medium with the cut end facing down for 5 days. The embryos were then transferred to a first sieve plate. After 14 days, the calli were cut in half and transferred to a second sieve plate. After 20 days, the calli were observed for differentiation. After bud formation, the calli were transferred to differentiation medium. After 14 days, the plants were transferred to 1 / 2 MS medium and allowed to root. Rooting resulted in the TaCTR1-overexpressing transgenic lines TaCTR1-OE1 and TaCTR1-OE2.
[0085] 4) Detection of target gene expression
[0086] The relative expression levels of the gene in the TaCTR1 overexpressing transgenic plants and the control were detected. The primer pair for detecting the relative expression level of TaCTR1 was qF and qR.
[0087] The reaction system for detection is:
[0088] 2×ChamQ Universal SYBR qPCR MasterMix (Novozymes, Q711) 10.0 μL Primer 1 (10 μM) 0.4 μL
[0089] Primer 2 (10 μM) 0.4 μL
[0090] Template cDNA 1μL
[0091] ddH2O 8.2μL
[0092] The reaction procedure is:
[0093] Rep:1 95℃ 5min
[0094] Reps:40 95℃ 10s 60℃ 30s*.
[0095] Fluorescence signal acquisition was performed using the instrument's default melting curve acquisition program*.
[0096] The results showed that the expression of TaCTR1 gene in the overexpressing transgenic plants was significantly increased compared with the control (wild-type hexaploid wheat Kenong 199). Figure 2 ). This indicates that the overexpressing transgenic lines TaCTR1-OE1 and TaCTR1-OE2 are transgenic-positive lines.
[0097] Example 3
[0098] Disease resistance testing
[0099] The TaCTR1 gene-silenced strain in Example 1, the TaCTR1 overexpressing transgenic strain in Example 2, and the wild-type control (wild-type hexaploid wheat Kenong 199) were subjected to phenotypic identification of powdery mildew resistance. The specific procedures are as follows:
[0100] (1) Wheat powdery mildew inoculation
[0101] Each group of wheat seeds was cultured in a light incubator with a photoperiod of 16 hours light / 8 hours dark and a temperature of 20°C. Wheat seedlings grown to the one-leaf stage were used for inoculation. Leaves were first sprayed with water mist and then thoroughly and evenly inoculated with E09 spore-bearing seedlings according to experimental requirements.
[0102] (2) Phenotypic identification of wheat powdery mildew after inoculation
[0103] Three days after inoculation, the leaves were cut into 5 cm segments and stained for microcolonies using 0.6% Coomassie Brilliant Blue. For each inoculation, 10-15 leaf segments from at least 10 seedlings were collected for microcolony counting. The microcolony index was calculated using Equation 1.
[0104] Microcolony index = spores that developed microcolonies / total number of spores detected × 100%.
[0105] For the specific steps of disease resistance detection, please refer to the existing technology (Zheng, Hongyuan; Dong, Lingli; Han, Xinyun; Jin, Huaibing; Yin, Cuicui; Han, Yali; Li, Bei; Qin, Huanju; Zhang, Jinsong; Shen, Qianhua; Zhang, Kunpu; Wang, Daowen. The TuMYB46L-TuACO3module regulates ethylene biosynthesis in einkorn wheat defense to powdery mildew. New Phytologist (2020) 225: 2526-2541 doi: 10.1111 / nph.16305).
[0106] The results showed that the number of microcolonies in the TaCTR1 gene silenced strain was significantly reduced compared with the wild-type control 3 days after inoculation ( Figure 1 In Figures B and C), wheat's resistance to powdery mildew was significantly enhanced. This experimental result indicates that the TaCTR1 gene plays a negative regulatory role in wheat's resistance to powdery mildew.
[0107] Compared with the wild-type control, the number of microcolonies in the TaCTR1 overexpressing transgenic strain increased significantly 3 days after inoculation ( Figure 2 The results of this experiment further confirmed that the TaCTR1 gene inhibits wheat powdery mildew resistance.
[0108] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. Use of a TaCTR1 protein or a gene encoding a TaCTR1 protein in at least one of regulating plant resistance to powdery mildew, creating powdery mildew-resistant transgenic plants, breeding powdery mildew-resistant plant varieties, and identifying or assisting in identifying powdery mildew-resistant plant varieties.
2. The application according to claim 1, characterized in that The TaCTR1 protein or the gene encoding the TaCTR1 protein improves the plant's resistance to powdery mildew through negative regulation.
3. The application according to claim 1, characterized in that The improving the resistance of plants to powdery mildew includes reducing the number and / or biomass of powdery mildew spores infecting the plants.
4. The use according to any one of claims 1 to 3, characterized in that: The plants include plants of the grass family.
5. An agent for intervening in the expression of the TaCTR1 protein or the gene according to claim 1, characterized in that: A method comprising targeting a silencing fragment of the gene of claim 1 or a gene-derived product comprising the silencing fragment; The nucleotide sequence of the silencing fragment is shown in SEQ ID NO:
3.
6. Use of the reagent according to claim 5 in at least one of the following tasks: improving plant resistance to powdery mildew, creating powdery mildew-resistant transgenic plants, breeding powdery mildew-resistant plant varieties, and identifying or assisting in the identification of powdery mildew-resistant plant varieties.
7. A method for regulating plant resistance to powdery mildew, characterized in that: Overexpression of the gene encoding TaCTR1 protein in plants can reduce the resistance of plants to powdery mildew; Alternatively, the biological function of the TaCTR1 protein or the expression level of the gene encoding the TaCTR1 protein can be inhibited to improve the plant's resistance to powdery mildew.
8. A method for identifying resistance of a plant to powdery mildew, characterized in that: Detecting the expression level of the TaCTR1 protein or the gene encoding the TaCTR1 protein according to claim 1 in the plant, and judging the plant's resistance to powdery mildew based on the expression level: the expression level of the TaCTR1 protein or the gene is negatively correlated with the plant's resistance to powdery mildew.
9. The method according to claim 8, characterized in that The reagent for detecting the expression level of the gene includes a forward primer shown in SEQ ID NO: 4 and a reverse primer shown in SEQ ID NO:
5.
10. The method according to any one of claims 7 to 9, characterized in that: The plants include plants of the grass family.