Atcepd2 gene for reducing cadmium absorption of plants and application thereof

By overexpressing the AtCEPD2 gene in plants, constructing an overexpression vector, and expressing it in the root bark, the problem of cadmium transporter proteins affecting nutrient ion absorption in existing technologies was solved, achieving the effects of reducing cadmium absorption and enhancing cadmium resistance. This method is applicable to a variety of plants.

CN120505331BActive Publication Date: 2025-11-18SHANDONG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510664667.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-22
Publication Date
2025-11-18
Estimated Expiration
2045-05-22

AI Technical Summary

Technical Problem

In existing technologies, knocking out cadmium transport proteins reduces the absorption of cadmium ions by plants, but it also affects the absorption of other nutrient ions, thus impacting plant growth and development. Furthermore, existing cadmium transport proteins require ATP.

Method used

The AtCEPD2 gene was overexpressed, an overexpression vector was constructed and introduced into recipient plants to enhance cadmium resistance, reduce cadmium absorption, and express the gene in the root bark to prevent cadmium ions from entering the plant and avoid ATP consumption.

Benefits of technology

It significantly improves the cadmium resistance of plants, reduces cadmium absorption and accumulation, and does not affect the absorption of other nutrient ions by plants. It is applicable to a variety of plants and provides a theoretical basis for cadmium-tolerant and high-yielding crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005414810040000011
    Figure HDA0005414810040000011
  • Figure HDA0005414810040000012
    Figure HDA0005414810040000012
  • Figure HDA0005414810040000021
    Figure HDA0005414810040000021
Patent Text Reader

Abstract

The present application relates to a kind of AtCEPD2 gene for reducing plant cadmium absorption and its application.A kind of AtCEPD2 gene for reducing plant cadmium absorption and its application, its nucleotide sequence is as shown in SEQ ID NO.1.The present application also provides the application of the gene in enhancing the cadmium resistance of plant.The present application is obtained by gene engineering technology to AtCEPD2 gene is overexpressed, then obtains overexpression vector, the vector is transformed into strain, is obtained AtCEPD2 gene overexpression homozygous strain after screening, and the ability of plant cadmium resistance is significantly improved.The present application confirms for the first time by experiment that Arabidopsis AtCEPD2 gene can improve the cadmium resistance of plant, in view of AtCEPD2 gene function verification result, it can be considered that the gene has potential application value to reduce plant cadmium absorption, enhance the cadmium resistance of plant, meanwhile, the present application also lays good theoretical and application foundation for cultivating cadmium-resistant, high-yield crop variety using AtCEPD2 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an AtCEPD2 gene that reduces cadmium absorption in plants and its application, belonging to the field of bioengineering technology. Background Technology

[0002] In recent decades, due to increased industrial pollution and the irrational use of pesticides and fertilizers in agricultural production, the amount of heavy metal pollutants accumulated in the soil has been increasing year by year, posing a serious threat to green agricultural production and public health. Among the many heavy metal elements, cadmium is one of the most representative. At the same time, cadmium is also a major element in soil heavy metal pollution, with a national exceedance rate of 7.0%, far higher than other tested inorganic pollutants (National Soil Pollution Status Survey Bulletin, 2014). In nature, cadmium exists mostly in ionic form, and most cadmium compounds are easily soluble in water and readily absorbed by plants, thus seriously affecting the health of animals and humans through the food chain.

[0003] Using molecular biology techniques to improve plants is an effective way to address cadmium pollution. In the past decade or so, botanists and crop scientists have screened many cadmium transport proteins in various plants and applied them to plant and crop improvement processes. However, most of these proteins transport cadmium ions to vacuoles or other parts of the plant, isolating them. This poses a risk of cadmium pollution to the food chain. While knocking out these proteins reduces the absorption of cadmium ions, it also affects the plant's absorption of other nutrient ions, thus impacting its growth and development.

[0004] Therefore, it is very important to explore and study genes that can reduce cadmium absorption and enhance cadmium resistance in plants, as these genes have important applications in plant improvement. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides an AtCEPD2 gene that reduces cadmium absorption in plants and its applications.

[0006] The technical solution of the present invention is as follows:

[0007] An AtCEPD2 gene that reduces cadmium uptake in plants, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The application of the AtCEPD2 gene in reducing cadmium uptake and enhancing cadmium resistance in plants is described above. The nucleotide sequence of the AtCEPD2 gene is shown in SEQ ID NO.1.

[0009] According to a preferred embodiment of the present invention, the application refers to the following: overexpression of the AtCEPD2 gene can enhance cadmium resistance in plants and reduce the absorption and accumulation of cadmium by plants.

[0010] According to a preferred embodiment of the present invention, the plant is Arabidopsis thaliana.

[0011] According to a preferred embodiment of the present invention, the application includes: inserting the AtCEPD2 gene into a plasmid vector to construct an overexpression vector of the AtCEPD2 gene, then introducing the overexpression vector of the AtCEPD2 gene into a recipient plant, and screening to obtain functional transgenic plants.

[0012] More preferably, the plasmid vector used in the overexpression vector of the AtCEPD2 gene is pMD20-T, and the promoter is pPYK10.

[0013] The beneficial effects of this invention are:

[0014] 1. This invention utilizes genetic engineering technology to overexpress the AtCEPD2 gene, obtains an overexpression vector, transforms this vector into plant lines, and screens to obtain homozygous AtCEPD2 gene overexpression lines, thereby significantly improving the plant's cadmium resistance. This invention is the first experimental confirmation that the Arabidopsis AtCEPD2 gene can reduce cadmium uptake and enhance cadmium resistance in plants. Based on the functional verification results of the AtCEPD2 gene, it can be considered that this gene has potential application value in reducing cadmium uptake and enhancing cadmium resistance in plants. Furthermore, this invention lays a solid theoretical and applied foundation for using the AtCEPD2 gene to cultivate cadmium-tolerant, high-yielding crop varieties.

[0015] 2. The AtCEPD2 gene disclosed in this invention is expressed only in the root epidermis, effectively preventing cadmium ions from entering the plant. Furthermore, compared to the existing cadmium transporter PDR8 gene, the AtCEPD2 gene requires virtually no ATP consumption. Roots are the primary source of water absorption for plants and also the main pathway for heavy metal contamination in plants; therefore, the characteristics of the AtCEPD2 gene are applicable to almost all plant species, showing broad application prospects in the creation of low-cadmium plants. Attached Figure Description

[0016] Figure 1 This is an agarose gel electrophoresis image of the AtCEPD2 gene in Example 1.

[0017] Figure 2 Optical photographs of the seedling phenotypes of Arabidopsis thaliana seeds transgenic with the AtCEPD2 gene, after germination for 3 days on normal 1 / 2 MS medium and then transfer to 1 / 2 MS medium containing 50 μM dCl2 for 7 days.

[0018] In the figure: WT: control group; OE1: experimental group 1; OE2: experimental group 2.

[0019] Figure 3The root length of Arabidopsis thaliana transgenic with the AtCEPD2 gene in this invention is statistically analyzed. Each root length value is the average root length of five randomly selected seedlings. The error bar represents the mean ± standard deviation (SD) of three independent replicate experiments. *P < 0.05.

[0020] In the figure: the horizontal axis represents the group, and the vertical axis represents the root length (cm); WT: control group; OE1: experimental group 1; OE2: experimental group 2.

[0021] Figure 4 Results of the effect of the AtCEPD2 gene on the cadmium accumulation capacity of Arabidopsis seedlings

[0022] In the figure: the horizontal axis represents the group, and the vertical axis represents the cadmium content; WT: control group; OE1: experimental group 1; OE2: experimental group 2. Detailed Implementation

[0023] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof. The present invention provides a general and / or specific description of the materials and test methods used in the experiments. Although many materials and operating methods used to achieve the objectives of the present invention are well known in the art, the present invention is still described in as much detail as possible herein.

[0024] The example provides the encoding nucleotide sequence (CDS sequence) of the Arabidopsis thaliana AtCEPD2 gene as shown in SEQ ID NO.1.

[0025] The sequence information is as follows:

[0026] ATGGACAAAGTGATGAGAATGTCTTCAGAGAAAGGAGTGGTGATCTTCACGAAGAGCTCATGTTGTCTCTGCTACCGCCGTTCAAATCCTGTTCCGTGACCTTAGGGTTCAACCAACCATCCACGAGATCGACAACGACCCGGACTGCCGTGAGAT CGAGAAGGCCTTCTCCGGCTCGGCTGTTCCACGGCGGTTCCAGCTGTCTTTGTCGGAGGCAAGCTTGTTGGCTCCACCAATGAAGTCATGTCCCTTCACCTTAGTGGCTCTCTTGTCCCATTGATCAAACCCTATCAGTCCATCCTTTACTAG.

[0027] Example 1: Cloning of the Arabidopsis thaliana AtCEPD2 gene

[0028] 1. Extraction of Arabidopsis thaliana genomic DNA using the CTAB method

[0029] CTAB extraction solution: 4g CTAB, 16.364g NaCl, 20mL 1M Tris-HCl (pH 8.0), 8mL 0.5M EDTA, and double-distilled water to a final volume of 200mL, then sterilized.

[0030] Grind a small amount of Arabidopsis thaliana leaves and add CTAB extraction buffer (0.2% mercaptoethanol); dispense into several 1.5 mL centrifuge tubes and incubate at 65°C for 30 min; centrifuge at 12000 rpm for 12 min, then pour the supernatant into several other 1.5 mL centrifuge tubes; add an equal volume of chloroform, mix well, centrifuge at 12000 rpm for 5 min, and collect the supernatant; add 2 volumes of anhydrous ethanol, precipitate for 5-10 min, and centrifuge at 12000 rpm for 12 min; wash three times with 70% ethanol, and air dry for 5-10 min to obtain Arabidopsis thaliana genomic DNA; add 40 μL of TE buffer to the Arabidopsis thaliana DNA to dissolve the DNA, thus obtaining the Arabidopsis thaliana genomic DNA solution.

[0031] 2. Using Arabidopsis thaliana genomic DNA as a template, primers AtCEPD2-ORF-F / R were designed based on the nucleotide sequence of the AtCEPD2 gene for PCR amplification. The PCR amplification products were subjected to 1wt% agarose gel electrophoresis, and the amplified DNA fragments were recovered according to the instructions of the DNA recovery kit (catalog number: DP209) from Tiangen Biotech (Beijing) Co., Ltd.

[0032] The sequence of primer AtCEPD2-ORF-F / R is as follows:

[0033] AtCEPD2-ORF-F: 5'-ATGGGAATCATTGGTAAGAGTG-3';

[0034] AtCEPD2-ORF-R: 5'-TCATTTGGGGCAGGTAGGT-3'.

[0035] The PCR amplification system (50 μL) is as follows: 0.5 μL Pfu DNA polymerase, 10 μL 5× Trans Start Fast Pfu buffer, 4 μL d NTP mixture, 2 μL primer AtCEPD2-ORF-F, 2 μL primer AtCEPD2-ORF-R, 2 μL genomic DNA, and 29.5 μL sterile distilled water.

[0036] PCR amplification program: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 1 minute (35 cycles); 72℃ extension for 5-10 minutes; and finally, incubation at 4℃.

[0037] 10 μL of the PCR product was analyzed by 1% agarose gel electrophoresis. The results are as follows: Figure 1 As shown.

[0038] Depend on Figure 1 As can be seen, the AtCEPD2 gene was successfully obtained by PCR amplification in this embodiment. The PCR product was sent to Sangon Biotech for sequencing, and the sequencing results are shown in SEQ ID NO.1, with a length of 309 bp, confirming that the target fragment cloned was the Arabidopsis AtCEPD2 gene.

[0039] Example 2: Construction of AtCEPD2 gene overexpression vector and preparation of transgenic plants

[0040] 1. Construction of the AtCEPD2 gene overexpression vector

[0041] The first 2000 bp of the CDS sequence of the black myrosinase (PYK10) gene was obtained from the Arabidopsis thaliana Information Resource Database (TAIR), and the nucleotide sequence is shown in SEQ ID NO.2.

[0042] Using Arabidopsis thaliana genomic DNA extracted in Example 1 as a template, primers pPYK10-F / R were designed based on the first 2000 bp nucleotide sequence of the black myrosinase (PYK10) gene for PCR amplification. The PCR amplification product was subjected to 1 wt% agarose gel electrophoresis, and the amplified DNA fragment was recovered according to the instructions of the DNA recovery kit (catalog number: DP209) from Tiangen Biotech (Beijing) Co., Ltd., and sequenced to verify that the amplified product was the promoter of the AtCEPD2 gene.

[0043] The primer sequences are as follows:

[0044] pPYK10-F: 5'-GTGCGAGTTCCACATCAG-3';

[0045] pPYK10-R: 5'-GGGCAACAGGTCCATCT-3'.

[0046] The PCR amplification system and PCR amplification procedure are the same as in Example 1.

[0047] The AtCEPD2 gene obtained in Example 1 and the promoter pPYK10 obtained in step (2) were ligated into the pMD20-T vector (purchased from TAKALA) using DNA ligase. After transforming E. coli, the transformed bacterial culture was plated on LB solid medium containing kanamycin resistance. Colonies were picked and cultured in a medium solution containing the corresponding antibiotic. After confirmation, plasmids of positive clones were extracted, digested with enzymes, electrophoresed, and the target band was recovered. The recovered product was transformed into E. coli, plated, positive clones were screened, and plasmids were extracted to obtain the AtCEPD2 gene overexpression vector, which was used for experiments such as Agrobacterium transformation.

[0048] 2. Electroporation method for transforming Agrobacterium

[0049] Remove Agrobacterium tumefaciens GV3101 competent cells and freeze-thaw them on ice. Add 2 μL of the AtCEPD2 gene overexpression vector obtained in step 1 to 100 μL of Agrobacterium tumefaciens GV3101 competent cells and gently mix with a pipette tip. Transfer the mixture of cells and plasmids to an electroporation cuvette, pre-cool it, and then electroporate it at 2500V. Remove the electroporation cuvette, add 800 μL of pre-cooled LB liquid medium, gently mix by pipetting, and transfer the bacterial solution to a 1.5 mL centrifuge tube. Incubate at 28℃ and 200 rpm for 5 h with shaking. Spread 35 μL of the bacterial solution onto LB solid medium containing the corresponding antibiotics and incubate upside down at 28℃ for 2 days. Then, screen Agrobacterium tumefaciens resistant to rifampicin and kanamycin for colony PCR, select positive colonies, and expand the culture by shaking.

[0050] 3. Cultivating transgenic plants

[0051] Arabidopsis seeds were disinfected twice with a 1:13 sodium hypochlorite solution for a total of 8 minutes, then washed six times with sterile water for a total of 6 minutes, and sown on 1 / 2 MS medium. The 1 / 2 MS medium containing the seeds was chilled at 4°C for 3 days, then placed in a light incubator with a photocycle of 20°C, 16h (light) / 20°C, 8h (dark). After 10 days of culture, the seedlings were transferred to plastic containers containing a 4:3:3 mixture of nutrient soil, vermiculite, and perlite, and watered regularly. The Agrobacterium cultured in step 2 was then used to infect Arabidopsis seeds using the floret infection method.

[0052] 4. Screening of transgenic plants

[0053] Seeds of generation T0 were screened on 1 / 2 MS medium containing 100 μg / mL herbicide (PPT). T0 generation transgenic Arabidopsis and wild-type Arabidopsis were collected. DNA was extracted from the leaves of the transgenic Arabidopsis. PCR identification was performed using wild-type Arabidopsis and transgenic Arabidopsis, and positive plants were selected. Approximately ten T1 generation plants were obtained from each type of transgenic Arabidopsis. Three T1 generation transgenic Arabidopsis plants were randomly selected for further culture. RNA was extracted from the transgenic Arabidopsis and wild-type Arabidopsis. RT-PCR identification was performed using wild-type Arabidopsis as a control. The T2 generation seeds of the positive RT-PCR plants were used as experimental material to obtain T2 generation Arabidopsis transgenic with the AtCEPD2 gene.

[0054] Example 3: Effects of the Arabidopsis ATCEPD2 gene on the growth phenotype of Arabidopsis seedlings under cadmium stress.

[0055] Eight Arabidopsis seeds of the T2 generation transgenic AtCEPD2 gene prepared in Example 2 were divided into experimental group 1 (OE-1) and experimental group 2 (OE-2); four wild-type Arabidopsis seeds collected from the same batch as the T2 generation transgenic AtCEPD2 gene Arabidopsis seeds were used as the control group (WT).

[0056] The three groups of Arabidopsis seeds were germinated on 1 / 2 MS medium for 3 days, then transferred to 1 / 2 MS medium containing 50 μM CdCl2 for another 7 days until they developed into Arabidopsis seedlings. Their growth was observed, and root length was measured and recorded. The results are as follows: Figure 2 and Figure 3 As shown.

[0057] Depend on Figure 2 and Figure 3 It can be seen that the root length of Arabidopsis thaliana seeds transgenic with the AtCEPD2 gene in experimental group 1 (OE-1) reached 1.467 cm after growth under cadmium stress, and the root length of Arabidopsis thaliana seeds transgenic with the AtCEPD2 gene in experimental group 2 (OE-2) reached 1.332 cm after growth under cadmium stress, while the root length of wild-type Arabidopsis thaliana seeds in the control group (WT) was only 1.048 cm after growth under cadmium stress. This indicates that the growth of Arabidopsis thaliana seeds transgenic with the AtCEPD2 gene under cadmium stress was significantly better than that of wild-type Arabidopsis thaliana seeds.

[0058] Example 4: Effect of the AtCEPD2 gene on cadmium accumulation capacity in Arabidopsis seedlings under cadmium stress.

[0059] Ten Arabidopsis thaliana seeds transgenic with the AtCEPD2 gene from the T2 generation prepared in Example 2 were divided into experimental group 1 (OE-1) and experimental group 2 (OE-2); five wild-type Arabidopsis thaliana seeds collected from the same batch as the T2 generation transgenic Arabidopsis thaliana seeds were used as the control group (WT).

[0060] The above three groups of Arabidopsis seeds were grown on 1 / 2 MS medium containing 50 μM CdCl2 for 10 days until they grew into Arabidopsis seedlings. After being washed several times with water, they were dried at room temperature and weighed. After nitric acid digestion, their cadmium content was detected by inductively coupled plasma mass spectrometry (ICP-MS).

[0061] Depend on Figure 4 The results show that the cadmium content in transgenic Arabidopsis thaliana with the AtCEPD2 gene was significantly lower than that in wild-type Arabidopsis thaliana, indicating that under Cd stress, transgenic Arabidopsis thaliana either excretes Cd or blocks Cd. 2+ The ability of the ATCEPD2 gene to reduce cadmium absorption and accumulation in Arabidopsis thaliana, while enhancing the plant's cadmium resistance, has been significantly enhanced.

Claims

1. The application of overexpression of the AtCEPD2 gene in reducing cadmium uptake in Arabidopsis thaliana, characterized in that, The nucleotide sequence of the AtCEPD2 gene is shown in SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, The application includes: inserting the AtCEPD2 gene into a plasmid vector to construct an overexpression vector of the AtCEPD2 gene, then introducing the overexpression vector of the AtCEPD2 gene into recipient Arabidopsis thaliana, and screening to obtain functional transgenic Arabidopsis thaliana.

3. The application as described in claim 2, characterized in that, The plasmid vector used in the overexpression vector of the AtCEPD2 gene is pMD20-T, and the promoter is pPYK10.

Citation Information

Patent Citations

  • Application of WAKL4 gene in specific regulation of plant cadmium accumulation

    CN117511990A

  • Application of arabidopsis PLD zeta 2 gene in cadmium resistance of plants

    CN118460573A