Application of OsDS1 gene in creating waterlogging-tolerant direct-seeding rice germplasm by genetic engineering
By overexpressing the OsDS1 gene of the DAHPS2 protein in rice, a new germplasm with rapid coleoptile elongation was created, solving the problems of insufficient waterlogging tolerance and direct seeding suitability of rice, and improving the growth adaptability and yield of rice under extreme precipitation conditions.
Patent Information
- Application Number
- CN202510404805.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2045-04-01
AI Technical Summary
In the current technology, the waterlogging tolerance and direct seeding suitability of rice still need to be improved, especially under the condition of frequent extreme precipitation events, which affects rice yield and planting stability.
By overexpressing the OsDS1 gene of the DAHPS2 protein in rice, its expression level in rice can be increased. New germplasm with rapid coleoptile elongation characteristics can be created using transgenic or gene editing technologies, thereby enhancing the waterlogging resistance and direct seeding suitability of rice.
It improved the coleoptile elongation ability of rice under flooded or non-flooded conditions, enhanced the rice's tolerance to flooding and suitability for direct seeding, and improved direct seeding efficiency and yield stability.
Smart Images

Figure CN120505346B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering, and more particularly to the application of the OsDS1 gene in the creation of water-tolerant, direct-seeding rice germplasm using genetic engineering. Background Technology
[0002] The shikimate pathway is a core metabolic pathway in the biosynthesis of aromatic amino acids (such as phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp)) in plants, algae, fungi, and some microorganisms. This pathway mainly consists of seven enzyme-catalyzed reactions. The initial step involves the condensation of phosphoenolpyruvate (PEP), the end product of glycolysis, with erythrose-4-phosphate (E4P), the end product of the pentose phosphate pathway, catalyzed by 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (DAHPS, known as DHS in Arabidopsis thaliana), to form 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) and inorganic phosphate, laying the foundation for the synthesis of aromatic amino acids. DAHPS exists in two unrelated types, type I and type II, with less than 10% sequence identity. Higher plants such as Arabidopsis thaliana, sorghum, and rice belong to type II DHS enzymes. Arabidopsis thaliana has three type II DHS enzymes: AthDHS1, 2, and 3. AthDHS1 has been biochemically identified as a recombinant protein and has shown activity against Mn2. +Strict dependence on cofactors and reducing conditions (dithiothreitol, DTT). Tyr and Trp inhibit AthDHS2 but not AthDHS1 or AthDHS3; mixing AthDHS2 with AthDHS1 or 3 weakens its inhibitory effect. BY1 (Biomass Yield 1) encodes DAHPS in sorghum, affecting sorghum biomass and cereal yield. Rice contains at least two DAHPS enzymes, OsDAHPS1 and OsDAHPS2. The study by Wang Huimei et al. (Wang, H., Shi, Y., Zhang, X., Xu, X., & Wu, JL (2020). Characterization of a Novel Rice Dynamic Narrow-Rolled Leaf Mutant with Deficiencies in Aromatic AminoAcids. International Journal of Molecular Sciences, 21(4), 1521.) showed that DNRL1 encodes DAHPS, which plays a key role in leaf morphogenesis by mediating the biosynthesis of amino acids in rice. Although the DAHPS enzyme has been preliminarily characterized in rice, its specific functions still need further investigation.
[0003] In direct-seeded rice cultivation, flood tolerance and rapid coleoptile elongation are key factors for achieving high-efficiency production. Rice responds to flood stress through two strategies: a quiescent strategy and an escape strategy. The quiescent strategy primarily relies on the flood tolerance locus SUBMERGENCE 1 (SUB1), involving hormonal signaling interactions between jasmonic acid (JA), auxin (IAA), ethylene, gibberellin (GA), and brassinolide (BR), conserving carbohydrates by limiting aboveground elongation until flooding subsides. Conversely, the escape strategy relies on rapid coleoptile elongation early in seed germination. As a tubular tissue that forms before the first leaf appears, the coleoptile determines the maximum suitable sowing depth. Under flood conditions, rapid coleoptile elongation helps seedlings reach the water surface to obtain oxygen, thereby supporting the development of subsequent leaves and roots.
[0004] Several genes have been identified as being associated with accelerated coleoptile elongation. For example, trehalose-6-phosphate phosphatase (OsTPP7) enhances rice's tolerance to anaerobic germination by elongating the coleoptile. Variations in calcineurin B subunit-like protein 10 (OsCBL10) affect coleoptile length and seedling survival under flooded conditions. The 14-3-3 protein OsGF14h acts as a regulatory switch, enhancing flood tolerance by balancing abscisic acid (ABA) and GA signaling to increase coleoptile length. Urate diphosphate glucosyltransferase OsUGT75A promotes flooded germination and coleoptile elongation by glycosylation of ABA and JA, thereby reducing free ABA and JA levels. The ethylene signaling regulator ETHYLENEINSENSITIVE 3-LIKE 1 / 2 (OsEIL1 / 2) induces the expression of reactive oxygen species scavenging genes, thereby promoting coleoptile elongation and inhibiting its radial expansion. Furthermore, the peroxisome CA-CoA ligase OsCNL1 / 2, involved in salicylic acid (SA) biosynthesis, was significantly induced during deep-water immersion. Elevated SA levels triggered a GH3-dependent auxin conjugation response, mitigating the inhibitory effect of IAA on germination. Despite these advances, the specific mechanisms of IAA and JA-mediated coleoptile elongation in rice still require further investigation.
[0005] As climate change intensifies its impact on rice production and extreme precipitation events become more frequent, direct-seeded rice cultivation faces increasingly severe flooding challenges. In direct-seeded rice cultivation, flood tolerance has become a key factor in improving rice yield and adaptability, directly affecting the stability of rice cultivation and farmers' economic benefits. Rapid coleoptile elongation is crucial for rice to break through the water surface, obtain oxygen, and maintain normal growth in flooded environments. This process is regulated by multiple factors, with plant hormones playing a central role. Therefore, in-depth research into the molecular mechanisms of rice flood tolerance, especially the regulatory mechanisms of plant hormones, is of great significance for rice variety improvement.
[0006] Meanwhile, cultivating new rice germplasm with flood tolerance and direct seeding capabilities by applying plant hormone regulation mechanisms is crucial for ensuring global food security, optimizing agricultural planting structures, and promoting sustainable agricultural development. Against the backdrop of continuous global population growth, a stable food supply is the foundation of human societal development. New rice germplasm with flood tolerance and direct seeding capabilities can effectively reduce yield losses caused by flooding, providing strong support for increased grain production. In terms of planting structure, the new germplasm can adapt to a wider range of planting environments, expanding rice planting areas, especially in flood-prone regions, and improving land utilization. From the perspective of sustainable agricultural development, these new germplasm types reduce replanting costs caused by flooding, lower agricultural resource waste, reduce the use of chemical agents, and help protect the ecological environment, achieving green agricultural development. Summary of the Invention
[0007] To address the aforementioned technical problems, this invention provides an application of the OsDS1 gene in the creation of water-tolerant, direct-seeding-suitable rice germplasm through genetic engineering. This invention is the first to discover that the OsDS1 gene, encoding the initiation enzyme of the rice shikimic acid synthesis pathway, is associated with rice's water-tolerance and direct-seeding suitability. Based on this, this invention utilizes OsDS1 as a target gene, employing methods such as transgenic technology or gene editing to increase its expression level, thereby creating new rice germplasm. This type of germplasm exhibits rapid coleoptile elongation after germination under both water- and non-water-tolerant conditions, thus enhancing the direct-seeding suitability of rice.
[0008] The specific technical solution of this invention is as follows:
[0009] In a first aspect, the present invention provides the application of the OsDS1 gene in improving the waterlogging tolerance or direct seeding suitability of rice: by overexpressing the DAHPS2 protein in rice to improve the waterlogging tolerance or direct seeding suitability of rice. The full-length nucleotide sequence of the cDNA of the OsDS1 gene is shown in SEQ ID NO: 1.
[0010] This invention clones a dwarf sterility gene, OsDS1, in rice, which encodes the DAHPS2 protein. This invention is the first to discover that increasing the expression level of OsDS1 in rice results in rapid coleoptile elongation after germination under both flooded and non-flooded conditions, thereby improving the direct-seeding tolerance of rice under normal or low-temperature environments and increasing direct-seeding efficiency.
[0011] Furthermore, the nucleotide sequence of the complete gene expression unit of the OsDS1 gene is shown in SEQ ID NO: 2.
[0012] Secondly, the present invention provides an artificially modified OsDS1 gene that can highly express the DAHPS2 protein in rice: based on the nucleotide sequence of the complete gene expression unit of the OsDS1 gene as shown in SEQ ID NO: 2, the number of regulatory elements DS1-7 (ATAGATACGA) is increased.
[0013] The transcription factor OsDS1PR1 positively regulates OsDS1 expression by binding to the DS1-7 elements in the OsDS1 promoter. This invention utilizes precise editing technology to create a new rice germplasm with high OsDS1 expression and no exogenous components by adjusting the structure and number of the DS1-7 elements in the OsDS1 promoter. This germplasm, like OsDS1 overexpression materials, can improve the rice's resistance to flooding and its suitability for direct seeding.
[0014] Preferably, the artificially modified OsDS1 gene has a nucleotide sequence of one of SEQ ID NO: 4-6.
[0015] Thirdly, the present invention provides the application of the above-mentioned artificially modified OsDS1 gene in improving the waterlogging tolerance or direct seeding suitability of rice: by overexpressing the DAHPS2 protein in rice to improve the waterlogging tolerance or direct seeding suitability of rice.
[0016] Fourthly, the present invention provides a vector for overexpressing the OsDS1 gene, the vector containing a nucleotide sequence as shown in any one of SEQ ID NO: 1, 4-6.
[0017] Preferably, the vector is obtained by inserting the nucleotide sequence shown in SEQ ID NO: 1 between the KpnI restriction sites of the base vector, based on pCAMBIA1300-GFP-FLAG; or by modifying DS1-7 in the promoter sequence of SEQ ID NO: 2 with ePE2 (pHUC411-cMYL-PEmaxNC) as the base vector, to contain the nucleotide sequences shown in SEQ ID NO: 4-6.
[0018] Fifthly, the present invention provides a host cell containing the OsDS1 gene, wherein the host cell contains the nucleotide sequence shown in SEQ ID NO: 1.
[0019] Sixthly, the present invention provides the application of the above-mentioned OsDS1 gene or artificially modified OsDS1 gene in the creation of new rice germplasm with water-resistant and direct-seeding properties: using the OsDS1 gene with nucleotides as shown in SEQ ID No: 1-2 as the target gene, the expression level of the OsDS1 gene is increased by transgenic or gene editing methods, thereby obtaining new rice plants with water-resistant and direct-seeding properties.
[0020] Preferably, an overexpression vector containing nucleotides as shown in SEQ ID No: 1 or SEQ ID No: 2 is converted into rice cells to obtain new rice plants that are tolerant to flooding and suitable for direct seeding.
[0021] Furthermore, the transformation method involves transferring the vector into the Agrobacterium tumefaciens strain EHA105 via electroporation to transform rice.
[0022] In a seventh aspect, the present invention provides a method for improving the water-resistant and direct-seeding characteristics of rice: using a gene having nucleotides as shown in SEQ ID No: 1 or SEQ ID No: 2 as a target gene, the expression level of the gene is increased by transgenic or gene editing methods, thereby improving the water-resistant and direct-seeding characteristics of rice.
[0023] As a preferred option, the number of OsDS1 gene regulatory elements DS1-7 (ATAGATACGA) in the nucleotides shown in SEQ ID No: 2 can be increased using precise editing technology to achieve high expression of the OsDS1 gene.
[0024] In specific experiments, this invention provides a precise editing vector containing the OsDS1 regulatory element DS1-7 (ATAGATACGA) of the above-mentioned gene. Using the pHUC411-cMYL-PEmaxNC (ePE2) precise editing system as the base vector, the ePE2-DS1-7X3 vector was constructed and transformed into the indica rice variety "Huazhan" to obtain precise edited rice without exogenous components.
[0025] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention is the first to discover that the gene encoding the initiation enzyme of the rice shikimic acid synthesis pathway, OsDS1, is related to the waterlogging tolerance and direct seeding suitability of rice. Based on this, this invention utilizes OsDS1 as a target gene and enhances its expression level through transgenic methods or gene editing to create new rice germplasm. This type of germplasm exhibits the characteristic of rapid coleoptile elongation after germination under both waterlogged and non-waterlogged conditions, thereby improving the direct seeding suitability of rice. Attached Figure Description
[0026] Figure 1 Phenotyps of the rice dwarf male sterile mutant ds1 and wild type at germination, seedling, and maturity stages; (A) Phenotyps of wild type and mutant at germination stage; (B) Phenotyps of wild type and mutant at seedling stage; (C) Close-up phenotype of root system of wild type and mutant at seedling stage; (D) Phenotyps of wild type and mutant at maturity stage; (E) Close-up phenotype of leaf of wild type and mutant at maturity stage; (F) Close-up phenotype of panicle of wild type and mutant at maturity stage; (G) Close-up phenotype of spikelet and anther iodine staining of wild type and mutant at maturity stage.
[0027] Figure 2 The diagram shows the location and mutation sites of the OsDS1 gene; (A) is the preliminary location map of the OsDS1 gene on chromosome 7 of rice; (B) is the fine location map of the OsDS1 gene; (C) is the analysis of candidate genes and mutation sites in the OsDS1 gene location region; (D) is the sequence analysis of gDNA genomic mutation sites of the OsDS1 gene in wild type and mutant; (E) is the sequence analysis of cDNA genomic mutation sites of the OsDS1 gene in wild type and mutant; (F) is the sequence analysis of protein mutation sites of the OsDS1 gene in wild type and mutant.
[0028] Figure 3The image shows the complementation map and phenotype of the OsDS1 gene; (A) is the map of the complementation vector pCAMBIA1300-DS1; (B) is the phenotype of the T2 transgenic rice plant in the functional complementation experiment, from left to right: wild type, mutant and mutant transgenic plant transformed with the complementation vector.
[0029] Figure 4 Schematic diagram of the OsDS1 knockout target sequence and phenotype; (A) Schematic diagram of the OsDS1 knockout target sequence; (B) Sequence diagram of wild-type plant OsDS1cas1 containing the Cas9 / sgRNA structure. The 20nt target sequence of the Cas9 / sgRNA complex is marked in blue, and the PAM site is marked in orange. For DNA sequences with Cas9 / sgRNA mutations, inserted nucleotides are shown in green, and deleted nucleotides are shown as red dashed lines; (C) Sequence diagram of wild-type plant OsDS1cas2 containing the Cas9 / sgRNA structure. The 20nt target sequence of the Cas9 / sgRNA complex is marked in blue, and the PAM site is marked in orange. For DNA sequences with Cas9 / sgRNA mutations, deleted nucleotides are shown as red dashed lines; (D) Phenotypic diagram of mature plants containing the OsDS1Cas9 / sgRNA structure mutant, from left to right: wild type and three mutant individual plants.
[0030] Figure 5 The overexpression map and phenotype of the OsDS1 gene are shown below. (A) is the map of the overexpression vector pCAMBIA1300-GFP-FLAG-DS1; (B) is the germination phenotype of T2-positive transgenic rice plants, from left to right: wild type and three overexpression lines; (C) is the coleoptile length of wild type and T2-positive transgenic rice plants at the germination stage; (D) is the radicle length of wild type and T2-positive transgenic rice plants at the germination stage.
[0031] Figure 6The images show the water-flood phenotypes and low-temperature water-flood phenotypes of OsDS1 overexpressing plants. Specifically: (A) is the phenotype of wild-type and T2-positive transgenic rice plants after 10 days of water flooding at 5cm depth; (B) is the coleoptile length of wild-type and T2-positive transgenic rice plants after 10 days of water flooding at 5cm depth; (C) is the phenotype of wild-type and T2-positive transgenic rice plants after 18 days of water flooding at 15℃ + 5cm depth; and (D) is the phenotype of wild-type and T2-positive transgenic rice plants after water flooding at 15℃ + 5cm depth. (E) Coleoptile length after 18 days; (F) Germination rate of wild-type and T2-positive transgenic rice plants after 18 days of submersion at 15℃ + 5cm; (G) Phenotype of wild-type and T2-positive transgenic rice plants after 36 days of submersion at 15℃ + 5cm; (H) Coleoptile length of wild-type and T2-positive transgenic rice plants after 36 days of submersion at 15℃ + 5cm;
[0032] Figure 7 The results show the field flooding phenotype and temperature changes of OsDS1 overexpressing plants; (AI) shows the phenotype of wild-type and T2-positive transgenic rice plants after 0, 1, 14, 16, 17, 18, 19, 20, and 23 days of field flooding at 5cm depth in Lingshui County, Hainan Province; (J) shows the temperature changes after 24 days of field flooding at 5cm depth in Lingshui County, Hainan Province.
[0033] Figure 8 The diagrams show the results of positive regulation of OsDS1 expression by the transcription factor OsDS1PR1; (A) is a schematic diagram of the bimolecular luciferase vector; (B) is a diagram of the results of bimolecular luciferase transformation of protoplasts; (C) is a diagram of the results of bimolecular luciferase transformation of tobacco; (D) is a schematic diagram of the OsDS1-7 sequence at the OsDS1PR1 binding site on the OsDS1 promoter; (E) is a schematic diagram and result of the yeast one-hybrid vector; (F) is a diagram of the gel migration assay results; (G) is a diagram of the results of bimolecular luciferase transformation of protoplasts, where 1-248bp is the core promoter region of OsDS1, and CK is pGreen0800-LUC+OsDS1PR1GFP; (H) is a diagram of the results of bimolecular luciferase transformation of protoplasts, where OsDS1PR1 is the positive regulator of OsDS1, and CK is pGreen0800-LUC+OsDS1PR1GFP.
[0034] Figure 9The diagram shows the OsDS1 promoter modification sequence, expression level, and phenotype after waterlogging treatment. (A) shows the precise OsDS1-7ePE2 editing sequence, with the target sequence highlighted in blue, substituted nucleotides in red, and deleted nucleotides indicated by green dashed lines. (B) shows the relative expression level of OsDS1 in wild-type and six independent DS1-7X3 edited plants without exogenous components. (C) shows the phenotype of wild-type and three independent DS1-7X3 edited plants without exogenous components after waterlogging for 8 days at a depth of 5 cm. (D) shows the coleoptile length of wild-type and three independent DS1-7X3 edited plants without exogenous components after waterlogging for 8 days at a depth of 5 cm. (E) shows the germination rate of wild-type and three independent DS1-7X3 edited plants without exogenous components after waterlogging for 8 days at a depth of 5 cm. Detailed Implementation
[0035] The present invention will be further described below with reference to embodiments.
[0036] General Implementation Examples
[0037] In a first aspect, the present invention provides the application of the OsDS1 gene in improving the waterlogging tolerance or direct seeding suitability of rice: by overexpressing the DAHPS2 protein in rice to improve the waterlogging tolerance or direct seeding suitability of rice. The full-length nucleotide sequence of the cDNA of the OsDS1 gene is shown in SEQ ID NO: 1.
[0038] Furthermore, the nucleotide sequence of the complete gene expression unit of the OsDS1 gene is shown in SEQ ID NO: 2.
[0039] Secondly, the present invention provides an artificially modified OsDS1 gene that can highly express the DAHPS2 protein in rice: based on the nucleotide sequence of the complete gene expression unit of the OsDS1 gene as shown in SEQ ID NO: 2, the number of regulatory elements DS1-7 (ATAGATACGA) is increased.
[0040] Preferably, the artificially modified OsDS1 gene has a nucleotide sequence of one of SEQ ID NO: 4-6.
[0041] Thirdly, the present invention provides the application of the above-mentioned artificially modified OsDS1 gene in improving the waterlogging tolerance or direct seeding suitability of rice: by overexpressing the DAHPS2 protein in rice to improve the waterlogging tolerance or direct seeding suitability of rice.
[0042] Fourthly, the present invention provides a vector for overexpressing the OsDS1 gene, the vector containing a nucleotide sequence as shown in any one of SEQ ID NO: 1, 4-6.
[0043] Preferably, the vector is obtained by inserting the nucleotide sequence shown in SEQ ID NO: 1 between the KpnI restriction sites of the base vector, based on pCAMBIA1300-GFP-FLAG; or by modifying DS1-7 in the promoter sequence of SEQ ID NO: 2 with ePE2 (pHUC411-cMYL-PEmaxNC) as the base vector, to contain the nucleotide sequences shown in SEQ ID NO: 4-6.
[0044] Fifthly, the present invention provides a host cell containing the OsDS1 gene, wherein the host cell contains the nucleotide sequence shown in SEQ ID NO: 1.
[0045] Sixthly, the present invention provides the application of the above-mentioned OsDS1 gene or artificially modified OsDS1 gene in the creation of new rice germplasm with water-resistant and direct-seeding properties: using the OsDS1 gene with nucleotides as shown in SEQ ID No: 1-2 as the target gene, the expression level of the OsDS1 gene is increased by transgenic or gene editing methods, thereby obtaining new rice plants with water-resistant and direct-seeding properties.
[0046] Preferably, an overexpression vector containing nucleotides as shown in SEQ ID No: 1 or SEQ ID No: 2 is converted into rice cells to obtain new rice plants that are tolerant to flooding and suitable for direct seeding.
[0047] Furthermore, the transformation method involves transferring the vector into the Agrobacterium tumefaciens strain EHA105 via electroporation to transform rice.
[0048] In a seventh aspect, the present invention provides a method for improving the water-resistant and direct-seeding characteristics of rice: using a gene having nucleotides as shown in SEQ ID No: 1 or SEQ ID No: 2 as a target gene, the expression level of the gene is increased by transgenic or gene editing methods, thereby improving the water-resistant and direct-seeding characteristics of rice.
[0049] As a preferred option, the number of OsDS1 gene regulatory elements DS1-7 (ATAGATACGA) in the nucleotides shown in SEQ ID No: 2 can be increased using precise editing technology to achieve high expression of the OsDS1 gene.
[0050] In specific experiments, this invention provides a precise editing vector containing the OsDS1 regulatory element DS1-7 (ATAGATACGA) of the above-mentioned gene. Using the pHUC411-cMYL-PEmaxNC (ePE2) precise editing system as the base vector, the ePE2-DS1-7X3 vector was constructed and transformed into the indica rice variety "Huazhan" to obtain precise edited rice without exogenous components.
[0051] More specifically, the specific technical steps for implementing this invention are as follows:
[0052] I. Segregation and genetic analysis of the rice dwarfing and sterile mutant ds1:
[0053] In this invention, the rice dwarfing and sterile mutant ds1 is a mutation produced by EMS (Ethylmethyl Sulfonate) mutagenesis of the superior restorer line of the super rice variety Huazhan. Figure 1 Through reciprocal crosses with wild-type rice, it was demonstrated that the mutant ds1 is controlled by a recessive single gene.
[0054] II. Map-based cloning of the OsDS1 gene controlling dwarfing and male sterility in rice:
[0055] 1) Preliminary localization of the OsDS1 gene:
[0056] To isolate the OsDS1 gene, this invention first constructed a mapping population by crossing ds1 with the japonica rice variety Wuyunjing 7. The F1 generation was self-crossed to create the F2 mapping population. Mutant individuals were selected from this population, and the OsDS1 locus was initially located using map-based cloning with molecular markers such as STS and SSR. It was preliminarily located at the long arm of chromosome 7, between markers C998-78 and C998-3. (See...) Figure 2 A.
[0057] 2) Fine localization and prediction of the OsDS1 gene:
[0058] By analyzing the BAC sequence between the two markers C998-78 and C998-3, new SSR and STS markers were developed to precisely locate OsDS1 within a 58-kb range between the C998-20 and C998-1 markers on BAC B1056G08. Figure 2 B) Analysis of the open reading frame (ORF) in this region was used to infer candidate genes. Sequencing of the entire localization region was then performed to determine the mutation patterns of the candidate genes. Sequencing results showed a single-base substitution (G1407C) on exon 5 of LOC_Os07g42960 in ds1, resulting in a one-amino acid change (M469I). Figure 2 CF).
[0059] 3) Identification and functional verification of the OsDS1 gene:
[0060] To verify the function of candidate genes, a system was constructed as follows: Figure 3 The complementary vector shown in A was transferred into the heterozygote ds1 using transgenic technology. The results indicate that this invention yielded transgenic rice that restored the mutant to a normal phenotype. Figure 3 B). In addition, the inventors designed two knockout target sites (cas1, cas2), and knocked these two target sites out of a Nipponbare background, obtaining knockout materials with different mutation modes. The phenotype of the knockout materials was similar to that of ds1. Figure 4 This invention proves that the OsDS1 gene was correctly cloned, and amino acid sequence analysis shows that OsDS1 encodes DAHPS2, the initiation enzyme of the shikimic acid synthesis pathway.
[0061] Applications of the OsDS1 gene:
[0062] To further explore the application scenarios of the OsDS1 gene, the inventors constructed, as follows: Figure 5 The overexpression vector shown in A was used to obtain DS1 gene overexpressing plants through Agrobacterium rice transformation technology. Figure 5 B). OsDS1-overexpressing plants showed significantly higher coleoptile and radicle elongation rates during germination compared to wild-type plants. Figure 5 C, D), waterlogging and low-temperature waterlogging experiments proved that the present invention obtained waterlogged-resistant rice plants suitable for direct seeding. Figure 6 AH). Field flooding experiments further demonstrated that high expression of OsDS1 can increase the coleoptile elongation rate after rice germination under low temperature and flooding conditions, thereby improving the direct seeding rate. Figure 7 AJ). Two-molecule luciferase assays, yeast one-hybrid assays, and gel migration assays demonstrated that OsDS1PR1 binds to the OsDS1 promoter DS1-7 (ATAGATACGA). Figure 8 The inventors subsequently used Luciferase experiments to identify the core promoter region containing OsDS1 in the range of -1 to -248. Figure 8 G), further experiments revealed that the LUC / REN ratio increased linearly with the increase of the number of repeats of the OsDS1PR1 binding site DS1-7. Figure 8 H), indicating that OsDS1PR1 is a positive regulator of OsDS1, promoting OsDS1 expression. By modifying the OsDS1 promoter using precise editing technology, exogenous-free OsDS1-edited plants were created. Figure 9 A), qRT-PCR results showed that the expression level of OsDS1 was significantly increased in these edited positive plants. Figure 9B). After flooding treatment, the new germplasm coleoptiles obtained from these gene-edited organisms rapidly elongated. Figure 9 C, D), germination rate significantly increased ( Figure 9 E) indicates that this germplasm has great application potential in the breeding of new varieties suitable for direct seeding, and provides important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.
[0063] This invention utilizes the rice dwarfing sterile mutant ds1, whose related gene encodes a protein that primarily affects the coleoptile elongation rate after rice germination. Using map-based cloning technology, the OsDS1 gene, which encodes the shikimic acid synthesis pathway initiation enzyme DAHPS2, was cloned in rice. Overexpression of OsDS1 significantly improved the direct-seeding suitability and flood tolerance of rice. Furthermore, this invention demonstrated through bimolecular luciferase assays, yeast one-hybrid assays, and gel migration assays that OsDS1PR1 positively regulates OsDS1 expression. Moreover, by using precise editing technology to modify the OsDS1 promoter regulatory element DS1-7 (ATAGATACGA), edited plants without exogenous components were created, providing important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.
[0064] In summary, this invention utilizes the rice dwarfing male-sterile mutant ds1 to clone the OsDS1 gene encoding the DAHPS2 protein, the initiation enzyme of the shikimic acid synthesis pathway, in rice using map-based cloning technology. This is the first time that the OsDS1 gene has been demonstrated to participate in flood tolerance in rice. It is also the first time that overexpression of OsDS1 has been found to significantly improve the direct-seeding flood tolerance of rice. Furthermore, this invention, through bimolecular luciferase assays, yeast one-hybrid assays, and gel migration assays, has demonstrated for the first time that OsDS1PR1 positively regulates OsDS1 expression. Moreover, by modifying the OsDS1 promoter using precise editing technology, this invention has created, for the first time, a new direct-seeding rice germplasm with high OsDS1 expression and no exogenous components, providing important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.
[0065] Specific embodiments and comparative examples
[0066] Example 1:
[0067] 1. Rice material:
[0068] The rice (Oryza sativa L.) mutant ds1 originated from the indica rice variety "Huazhan (HZ)".
[0069] The rice seedling dwarfing and sterile mutant ds1 is a mutation induced by Hua Zhan EMS mutagenesis (e.g. Figure 1 As shown in the image, this mutant was obtained in Zhejiang Province, China.
[0070] The specific mutagenesis method is as follows: rice seeds are soaked in 1.5% EMS for 8 hours, rinsed with clean water and germinated normally; in the M1 generation, the extreme dwarf mutant ds1 is selected, and the ds1 heterozygous plants are used for population construction and gene mapping after stable inheritance for multiple generations.
[0071] 2. Analysis and Positioning of the Population: Hybrid plants of the ds1 mutant were crossed with the japonica rice variety Wuyunjing 7. The F1 generation was self-crossed to create the F2 positioning population. From this, 2100 ds1 mutant individuals were selected as the positioning population. Approximately 1 gram of young leaves from each plant was collected at the three-leaf stage for total DNA extraction.
[0072] 3. SSR and STS markers locate the OsDS1 gene
[0073] A rapid method for extracting trace amounts of rice DNA was used to extract genomic DNA for gene mapping from rice leaves. Approximately 0.2 g of rice leaves were frozen in liquid nitrogen, ground into powder in a 5 cm diameter mortar, and transferred to a 1.5 ml centrifuge tube to extract DNA. The obtained DNA precipitate was dissolved in 150 μl of ultrapure water. 2 μl of DNA sample was used for each PCR reaction.
[0074] Preliminary localization of the OsDS1 gene: Twenty-one recessive individuals were selected from the F2 population of a hybrid plantlet of ds1 mutant and the japonica rice variety Wuyunjing 7. Based on the molecular genetic map created from published japonica and indica rice genome data, SSR primers approximately uniformly distributed across chromosomes were selected. PCR amplification was performed under known reaction conditions. The PCR products were separated by 5% agarose gel electrophoresis and stained with ethidium bromide (EB). Polymorphism of the PCR products was detected, and OsDS1 was preliminarily located between two STS markers, C998-78 and C998-3, on the long arm of chromosome 7 (e.g., [missing information]). Figure 2 (As shown in A).
[0075] Note: The 21 recessive individuals in the F2 population of the above-mentioned ds1 mutant heterozygous plant and the japonica rice variety Wuyunjing 7 are included in the 2100 mutant plants. In this invention, the 21 plants were used for initial mapping, and then the population was expanded to 2100 plants for fine mapping and gene cloning.
[0076] Fine mapping of the OsDS1 gene: 2100 recessive mutant individuals from the F2 population of a hybrid population of ds1 mutant plants and the japonica rice variety Wuyunjing 7 were selected. Based on the initial mapping, SSR and STS markers were further designed, ultimately pinpointing OsDS1 to a range of 58 kb on BAC number B1056G08. Figure 2 B), with molecular markers C998-20 and C998-1 on both sides, and primer sequences as follows:
[0077] C998-20: F: TTCAAGCTTCACAAGGAGACTAAA: R: TCATGGAATCAATCCAGCAT: C998-1: F: GAAGCCATCAGCTGCCTAGT; R: ACCGGTGTGGACGAAGGT.
[0078] Note: Primer sequences are shown in Table 1.
[0079] Table 1. Localization marker sequences of the OsDS1 gene
[0080] Marke Primers (5' to 3') Sense Anti-sense B7-12 TCAAGGTCGACATGTTAGGTATGC AACCCTATCACCTGAGAAACATCC B7-13 ACAGTATCCAAGGCCCTGG CACGTGAGACAAAGACGGAG B7-14 TGGAAGTTTCCTGGCGATAG TGGTTGGACTGAAAAGTCCC C998-1 GAAGCCATCAGCTGCCTAGT ACTCGGTGTGGACGAAGGT C998-3 GCTGAACCAGCAGCCTTTAC CCCAGATCATTGCCTCTGTT C998-4 TTTGATTCAGTTAAATGCTTTCAT CTGCATTCGCTTTTCCTTCT C998-10 GTCCTGCTTTGGGCAGTAAA TGGCAAAACCACATAAATCG C998-20 TTCAAGCTTCACAAGGAGACTAAA TCATGGAATCAATCCAGCAT C998-22 TGATCTACCTGCCCAACTGA TGGCCAATTGTTTTGACCTA C998-23 TTGGCTGACAGATTTACGAATG TGATTGCACTTAAAATGGAACG C998-25 CTTGCAATGCTAGGTGTTTTT CAATTCACACGTACAAAAACCA C998-43 TGGAATTATCTGGTTGCCAAG CCGTTGAACAACAACAGCAC C998-45 GTTTTCCGCCCAAAACTGTA CGATCTGATGAGCACGTTTTT C998-64 CTGCTCCGATTCTTGAGACC GACCACGTCGAGCTTCTCC C998-66 GAAGCGCACGTATTCCTAGC GCAGCTAATCAGCAATTGACC C998-74 GGATGGGGTGATGGGAAC CGTCATGGACCACGGAATA C998-78 TTGACAGCATTGCCATAGGA TCCCTTGTTGATTCACGGTAG
[0081] 4. Gene prediction and comparative analysis:
[0082] Based on the results of fine mapping, six candidate genes were found within the 58-kb range. Figure 2 C). Based on the number of recombinations on both sides of the reference localization interval, sequencing primers for each gene were designed. Candidate genes were amplified from the ds1 and wild-type genomes using PCR for sequencing analysis. A single-base substitution (G1407C) was found on the 5th exon of LOC_Os07g42960 in ds1, resulting in a one-amino acid change (M469I). Figure 2 (DF). The mutation site was repeatedly verified three times using different mutant single plants and single plants with the mutant phenotype from the population, and the mutation site remained stable (sequencing primer sequences are shown in Table 2). Based on the gene annotation information of sequence B1056G08 (BAC number), it was predicted that this gene encodes phospho-2-dehydro-3-deoxyheptonate aldolase, chloroplast precursor, putative, expressed protein, the shikimic acid synthesis pathway initiation enzyme DAHPS2. This gene was named OsDS1, with a full length of 3239 bp, containing 5 exons and 4 introns. The OsDS1 gene in rice has 90% homology with the protein genes in sorghum and maize.
[0083] The amino acid sequence of the protein encoded by this gene is shown in SEQ ID No: 3 of the sequence listing.
[0084] The cDNA of this gene is shown in SEQ ID NO: 1, and the gDNA is shown in SEQ ID NO: 2.
[0085] Table 2. Sequencing primer sequences for the OsDS1 gene
[0086]
[0087]
[0088] Example 2:
[0089] Plant transformation:
[0090] Using the genome of the indica rice variety "Huazhan" as a template, primers were designed based on the target gene:
[0091] 42960COMF-5'-tatgaccatgattacgaattcGGAAGCTAAGCTAAGGAGTAGGAGAA-3'
[0092] 42960COMR-5'-ccgggtaccgagctcgaattcTATTGGGTTGGTCCGGTCTCA-3'.
[0093] The PCR amplification system was as follows: 50 μL PCR reaction system: 2 μL template DNA; 25 μL 2×PCR buffer; 10 μL 2 mmol dNTP (Roche); 1 μL KODFX (TOYOBO) enzyme; 3 μL 10 μM PrimerF; 3 μL 10 μM PrimerR; 6 μL ddH2O; PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 4 min for a total of 35 cycles; 10 min extension at 68℃, and incubation at 15℃.
[0094] Note: The genome of the indica rice variety "Huazhan" was used as a template.
[0095] After PCR amplification, electrophoresis was performed to separate the DNA fragment, yielding a 6988 bp fragment. pCAMBIA1300 (p1300) was digested with EcoRI and homologous recombination was performed to obtain the complementary vector pCAMBIA1300-DS1. This clone covers the entire genomic region of the ORF (i.e., contains the nucleotide sequence shown in SEQ ID No: 2), and also includes a 2749-bp promoter sequence upstream of ATG and a 1000-bp terminator sequence downstream of TAA (e.g., ...). Figure 3 (As shown in A).
[0096] This plasmid was transferred into the Agrobacterium tumefaciens strain EHA105 via electroporation to transform rice. The inventors induced callus tissue using mature seeds from heterozygous mutant plants. After culturing in induction medium for 3 weeks, vigorously growing callus was selected as the recipient for transformation. Rice callus was infected with the EHA105 strain containing the binary plasmid vector and co-cultured in the dark at 25°C for 3 days, followed by cultivation on selection medium containing 300 mg / L hygromycin. Resistant callus was screened and cultured on pre-differentiation medium containing 250 mg / L hygromycin for approximately 10 days. The pre-differentiated callus was then transferred to differentiation medium and cultured under light. Resistant transgenic plants were obtained after approximately one month. Identification and continuous observation of the plants revealed that, compared to mutants at the same stage, the transgenic plants exhibited normal growth.
[0097] Through the above-mentioned transgenic technology, the results show that: this invention has obtained transgenic rice that restores the mutant to a normal phenotype. Figure 3 B).
[0098] Note: The formulations of the various culture media mentioned above can be found in Toki S., Hara N., Ono K., Onodera H., Tagiri A., Oka S., Tanaka H. (2006) Early infection of scutellum tissue with Agrobacterium allows high-speed transformation of rice. The Plant Journal 47: 969-976.
[0099] Example 3:
[0100] OsDS1 gene function verification:
[0101] According to predictions in the Rice Genome Annotation Project (RGAP, https: / / www.ricedata.cn / gene / index.htm), OsDS1 (LOC_Os07g42960) encodes phospho-2-dehydro-3-deoxyheptonate aldolase, chloroplast precursor, putative, and expressed, consisting of 5 exons and 4 introns, with a full-length gDNA of 3239 bp and a full-length cDNA of 1614 bp. To further verify whether DS1 mutation is the main cause of the ds1 mutant phenotype, the inventors designed two target sequences (cas1 and cas2) on the second exon of DS1. Figure 4 A) The target sequence primer sequence is:
[0102] gR1tF-cas1-5'-gcaTTCATGGATCACAGCGAACAgttttagagctagaaatagcaagttaaaataag-3';
[0103] tR1tR-cas1-5'-TGTTCGCTGTGATCCATGAATGCACCAGCCGGGAATCGAAC-3';
[0104] gR1tF-cas2-5'-gcaTACAGGGGAGACAACATCAAgttttagagctagaaatagcaagttaaaataag-3';
[0105] tR1tR-cas2-5'-TTGATGTTGTCTCCCCTGTATGCACCAGCCGGGAATCGAAC-3'.
[0106] After knocking out these two target sites in Nipponbare background using CRISPR / Cas9 technology, knockout materials with different mutation modes were obtained. The phenotypes of the knockout materials were similar to those of ds1. Figure 4 BD).
[0107] These results indicate that mutations in the OsDS1 gene are the main cause of the ds1 mutant phenotype.
[0108] Note: The CRISPR / Cas9 gene editing vector pCAR2-Cas9 mentioned above was provided by Professor Liu Yaoguang's research group at South China Agricultural University.
[0109] Example 4:
[0110] Obtaining OsDS1 overexpression lines:
[0111] 1. Amplification of the target fragment: The cDNA transcribed from Nipponbare total RNA was used as the amplification template (1 μL), 2× Kod FX DNA polymerase buffer (25 μL); 2 mM dNTPs (8 μL); Kod FX DNA polymerase (Toyobo) (1 μL); 10 mM DS1-GFPF (tttaaacaagagctcggtaccATGGCGCTCGCCACCAAC) (3 μL); 10 mM DS1-GFPR (gctcaccatggatccggtaccGAAAGCCAATGGGGGCAA) (3 μL); sterile water (9 μL); final volume (50 μL). After mixing, the following program was run on the PCR instrument:
[0112] 98℃, 10 min;
[0113] 98℃, 30s; 60℃, 30s; 72℃, 2min; 35 cycles;
[0114] Incubate at 72℃ for 10 min; store at 4℃. The 1611 bp target fragment was recovered after separation with 1% agarose gel.
[0115] 2. Enzyme digestion of the target vector
[0116] The target vector pCAMBIA1300-GFP-FLAG was digested with KpnI (Takara) using the following digestion system: 5 μL 10×H buffer; 10 μL pCAMBIA1300-GFP-FLAG vector; 2 μL KpnI; 33 μL sterile water; 50 μL final volume; digestion at 37℃ for 2 hours. The digested products were separated by 1% agarose gel and recovered.
[0117] 3. Construction of OsDS1 overexpression vector
[0118] The fragment recovered in step 1 was ligated into the target vector recovered in step 2 via homologous recombination. The recombination system was as follows: 8 μL of PCR product; 2 μL of enzyme-digested and recovered pCAMBIA1300-GFP-FLAG vector; 4 μL of 5×CE II Buffer. II 2 μL; sterile water 4 μL; final volume 20 μL; ligation at 37℃ for 1 hour. Except for the target fragment and expression vector pCAMBIA1300-GFP-FLAG, all other reagents were purchased from Nanjing Novizan Pharmaceutical Co., Ltd. (ClonExpress-II OneStep Cloning Kit).
[0119] 10 μL of the ligation product was added to 50 μL of freshly thawed DH5α competent cells, gently mixed, incubated on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and incubated on ice for 2 minutes. Then, 500 μL of antibiotic-free LB was added, and the mixture was placed in a 37°C shaker at 170 rpm. After one hour of recovery, the cells were plated with kanamycin-resistant (Kan) agar. Five white colonies were selected, and positive clones were identified by colony PCR using DS1-GFPF / R primers. The PCR product was 1611 bp in size. Two positive clones were selected and sent for sequencing using s65tF: TTGATGTGGGTTTTACTGATGC and s65tR: GGGAAGCAAATTCTGAACCA. The OsDS1 green fluorescent fusion expression vector pCAMBIA1300-GFP-FLAG-DS1 was obtained. Figure 5 A). The original source of the pCAMBIA1300-GFP-FLAG vector is:
[0120] Ren D, Li Y, Zhao F, Sang X, Shi J, Wang N, Guo S, Ling Y, Zhang C, Yang Z, HeG.MULTI-FLORET SPIKELET 1, which encodes an AP2 / ERF protein.determinesspikelet meristemfate and sterile lemma identity in rice.Plant Physiol. 2013;162(2):872-884.
[0121] 4. Transformation with OsDS1 overexpression vector
[0122] The constructed pCAMBIA1300-GFP-FLAG-DS1 vector plasmid was transformed into the Agrobacterium tumefaciens strain EHA105 in rice via electroporation. The inventors induced callus tissue using mature seeds of the indica rice variety "Huazhan." After culturing in induction medium for 3 weeks, vigorously growing callus was selected as the recipient for transformation. Rice callus was infected with the EHA105 strain containing the binary plasmid vector and co-cultured in the dark at 25°C for 3 days, followed by culture on selection medium containing 300 mg / L hygromycin. Resistant callus was screened and cultured on pre-differentiation medium containing 250 mg / L hygromycin for approximately 10 days. The pre-differentiated callus was then transferred to differentiation medium and cultured under light. Resistant transgenic plants were obtained after approximately one month. Identification and continuous observation of the germination period of overexpression plants revealed that, compared with the wild type at the same stage, the coleoptile and radicle elongation rates of the transgenic overexpression positive plants were faster. Figure 5 BD).
[0123] The primer sequences for identifying OsDS1 overexpressing plants are:
[0124] DS1-OE identification 1F-5'-TTACAAGAATGGGGGCAGAG-3'
[0125] DS1-OE identification 1R-5'-ACGTTCTGCCCAGTCATTTC-3'
[0126] DS1-OE identification 2F-5'-CGCCTGGTTCTTCTTTTTCA-3'
[0127] DS1-OE identification 2R-5'-CAGCTATCCACCGTCCACTT-3'.
[0128] Through the above-mentioned transgenic technology, the results show that: this invention has obtained transgenic rice that causes faster coleoptile elongation in normal plants. Figure 5 BD).
[0129] Example 5:
[0130] Overexpression of OsDS1 can significantly improve the flood tolerance of plants:
[0131] 1. OsDS1 overexpressing plants exhibited excellent flood tolerance in the laboratory.
[0132] The inventors conducted water submersion experiments on wild-type indica rice variety "Huazhan" and OsDS1 overexpression (DS1-OE) plants under laboratory conditions. 300 mature seeds from Huazhan and three OsDS1 overexpression lines were placed in transparent glass bottles with 5 cm of distilled water added. These bottles were then incubated at 26℃ for 14 hours under light and 10 hours in darkness for 10 days. The coleoptile length was then photographed and measured. The experiment was repeated three times. The results showed that DS1-OE exhibited excellent water submersion tolerance under 5 cm of water. Figure 6 A, B).
[0133] 2. OsDS1 overexpression in plants can still improve their flood tolerance at low temperatures.
[0134] Considering that direct-seeded rice is mostly grown in relatively low temperatures, and that low temperatures can inhibit germination and growth, the inventors subjected DS1-OE to cold stress through waterlogging treatment. Two hundred mature seeds from Huazhan and three OsDS1 overexpression lines were placed in transparent glass bottles with 5cm of single-distilled water added. These bottles were then placed in a 15℃ incubator for 14 hours of light followed by 10 hours of darkness, and cultured for 18 and 36 days. Photographs were taken and coleoptile length and germination were measured. The results showed that under 15℃ treatment and 5cm waterlogging conditions, DS1-OE still exhibited better waterlogging tolerance than the wild type, with significantly higher coleoptile length and germination rate. Figure 6 CH).
[0135] 3. OsDS1 overexpressing plants exhibited excellent flood tolerance in the field.
[0136] The inventors conducted a waterlogging experiment on wild-type indica rice variety "Huazhan" and OsDS1 overexpressing plants under natural field conditions. The field trial was carried out in Lingshui County, Hainan Province. Four seedbeds, each 10.5m long and 0.8m wide, were used. The perimeter was reinforced with soil and covered with a mulch to prevent water seepage. 150g of mature seeds from Huazhan and three OsDS1 overexpressing lines were dry-sown in the field, and the seeds were then tamped down in the soil to prevent them from being washed away by irrigation. The next day, after the seeds absorbed water, they were flooded with water to a depth of about 5cm and then continuously submerged for 23 days before photographing. The results showed that DS1-OE did indeed exhibit faster elongation and more uniform emergence than the wild type under waterlogging conditions. Figure 7 AI). Meanwhile, during the flooding livestream, Hainan experienced temperatures around 15℃ for nearly half the time. Figure 7 J).
[0137] In conclusion, overexpression of OsDS1 can significantly improve the plant's tolerance to flooding and its tolerance to flooding under low temperature conditions.
[0138] Note: The flooding experiments mentioned above were all continuous flooding, with the water level maintained at about 5cm from the time the seeds were sown.
[0139] Example 6:
[0140] Precise editing of the OsDS1 promoter regulatory element DS1-7 yielded new rice germplasm suitable for direct seeding.
[0141] 1. Transcription factor OsDS1PR1 positively regulates OsDS1 expression
[0142] To identify transcription factors that regulate OsDS1 expression, the inventors used the PlantCARE website (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) to predict OsDS1 transcription factors and binding sites. Through Luciferase (dual-luciferase) experiments, they identified a potential transcription factor, LOC_Os01g67770. Figure 8 A, B). The dual-luciferase vector plasmid was transiently transformed into *Nicotiana benthamiana* leaves via *Agrobacterium tumefaciens*-mediated transformation. After 48 hours of dark incubation at 28°C, fluorescence signals were observed using a low-light cooling imaging system (Tanon 5200). The results also confirmed that LOC_Os01g67770 binds to the OsDS1 promoter. Figure 8 C). Yeast one-hybrid experiments further demonstrated that the transcription factor LOC_Os01g67770 binds to the predicted OsDS1 binding site DS1-7 (OsDS1 promoter -226 to -248 bp, element sequence ATAGATACGA). Figure 8 D, E), and EMSA (gel migration) experiments also confirmed this result. Figure 8 F). This indicates that LOC_Os01g67770 binds to OsDS1. Since LOC_Os01g67770 has not yet been cloned, the inventors named it OsDS1PR1 (DS1 positive regulator 1).
[0143] The inventors subsequently used Luciferase experiments to confirm that the OsDS1 promoter -1 to -232 bp contains the core promoter region of OsDS1. Figure 8 G), further experiments revealed that the LUC / REN ratio increased linearly with the increase of the number of repeats of the OsDS1PR1 binding site DS1-7. Figure 8 H), indicating that OsDS1PR1 is a positive regulator of OsDS1, promoting OsDS1 expression.
[0144] The specific experimental method is as follows:
[0145] 1) Luciferas experiment (transplantation to protoplasts):
[0146] a) Vector construction: The promoter regions of OsDS1, 232bp, 647bp, DS1-7(ATAGATACGA), DS1-7X2, DS1-7X3, DS1-7+232bp, DS1-7X2+232bp, DS1-7X3+232bp, and 2700bp upstream of the ATG start codon, were cloned into the KpnI / SPEI double restriction site upstream of the LUC reporter gene in the pGreen0800-LUC vector to obtain OsDS1. The pGreen0800-LUC expression vectors pDS1-232-LUC, pDS1-248-LUC, pDS1-647-LUC, pDS1-7-LUC, pDS1-7X2-LUC, pDS1-7X3-LUC, pDS1-7+232-LUC, pDS1-7X2+232-LUC, pDS1-7X3+232-LUC, and pDS1-LUC. Primer sequences are shown in Table 3. The cDNA from Nipponbare total RNA reverse transcription was used as the amplification template. The amplification primer sequences were OsDS1PR1-GFPF(cttctgcaggagctcggtaccATGGACGCCACCGCCTTC) and OsDS1PR1-GFPR(gctcaccatggatccggtaccGGATGATGCAAAGAGACATTCATC), which yielded a 1746bp OsDS1PR1 target fragment. This fragment was then recombined into pCAMBIA1300-GFP-FLAG, which was digested with KpnI, to obtain the OsDS1PR1 green fluorescent fusion expression vector pCAMBIA1300-GFP-FLAG-OsDS1PR1.
[0147] Table 3. Primer sequences for vector construction
[0148]
[0149]
[0150] b) Extraction of rice protoplasts and vector transformation:
[0151] (1) After about 15 days of growth, chop the stems and leaves of rice 9311 seedlings on a plastic petri dish with a sharp blade, and transfer them to a 200ml clean conical flask (generally 20ml of enzymatic hydrolysate is used for about 60 seedlings each time; pour the enzymatic hydrolysate into the flask in advance and distribute it reasonably according to the size of the bottom of the flask). Do not fill each flask too much. Place it on a shaker at 28℃, 70rpm, for 5 hours.
[0152] (2) Before the enzymatic hydrolysis time is completed, prepare a 40% PEG4000 solution, place it in a 65℃ water bath to dissolve, and take it out and shake it once in the middle.
[0153] (3) After enzymatic hydrolysis, add 15 ml of W5 to the hydrolyzed bottle. Filter out the broken leaf fragments using a 200-mesh steel filter and collect the hydrolyzed protoplasts in a clean plastic petri dish. Then, slowly pour the protoplasts into (or aspirate with a pipette tip removed) a 50 ml centrifuge tube, weigh and balance it, then place it in a horizontal centrifuge at 150 g for 5 min to fully collect the protoplasts. After centrifugation, slowly aspirate the supernatant.
[0154] (4) Add 1 ml of W5 solution to the protoplast precipitate, slowly and gently tilt to mix and resuspend, and then use a pipette tip to transfer it to a 2 ml centrifuge tube. At this time, there may still be a small amount of unresuspended protoplasts in the 50 ml centrifuge tube. You can add another 1 ml of W5 to dissolve it, transfer it to the previous 2 ml centrifuge tube, incubate at 150 g for 3 min, and then remove the supernatant.
[0155] (5) Resuspend with MMG. Add 1200ul MMG to resuspend, then aliquot into 2ml centrifuge tubes, 100ul per tube.
[0156] (6) Prepare approximately 10ug of the plasmids for transformation (pCAMBIA1300-GFP-FLAG, pCAMBIA1300-GFP-FLAG-OsDS1PR1, pDS1-232-LUC, pDS1-248-LUC, pDS1-647-LUC, pDS1-7-LUC, pDS1-7X2-L UC, pDS1-7X3-LUC, pDS1-7+232-L UC, pDS1-7X2+232-L UC, pDS1-7X3+232-LUC, pDS1-LUC) in a 2ml centrifuge tube.
[0157] (7) Add 100 μL of resuspended protoplasts, then add 110 μL of 40% PEG and mix well.
[0158] (8) Let stand at 28℃ in the dark for 15 minutes.
[0159] (9) Add sufficient W5 for dilution, mix well, then centrifuge at 150g for 3 minutes, slowly remove the supernatant, and wash once more with W5 (there will be some loss during the process, but it will not affect the results). Resuspend the final precipitate with W5 (fill a 2ml tube), mix gently, and transfer to a cell culture plate. Wrap with aluminum foil and incubate at 28°C in the dark for 14 hours.
[0160] (10) After the culture time is completed, gently mix the protoplasts precipitated in each well of the culture plate, transfer them to a 2ml tube, centrifuge at 150g for 3min, remove the supernatant, retain about 100ul of supernatant, and resuspend the protoplasts.
[0161] c) Luciferase assay: Following the instructions provided by Promega... Follow the instructions for the Reporter AssaySystem kit (catalog number E1910) and calculate the relative LUC activity by measuring the LUC / REN value using an Aomega Gloma fluorescence analyzer.
[0162] 2) YIH experiment:
[0163] a) Vector construction: The promoter regions 232-248 bp (OsDS1-7), 647 bp, 647-2700 bp, and 2700 bp upstream of the ATG start codon of OsDS1 were cloned into the SalI restriction site of the pLacZi vector to obtain the OsDS1pLacZi expression vectors pLacZi-DS1-7, pLacZi-DS1-647, pLacZi-DS1-647-2700, and pLacZi-DS1-2700. Primer sequences are shown in Table 3. The cDNA from Nipponbare total RNA reverse transcription was used as the amplification template. The amplification primer sequences were OsDS1PR1-pB42ADF(TATGCCTCTCCCGAATTCATGGACGCCACCGCCTTC) and OsDS1PR1-pB42ADR(CTCGAGTCGGCCGAATTCTCAGGATGATGCAAAGAGACATTC), which yielded a 1746bp OsDS1PR1 target fragment. This fragment was then recombined into the EcoRI-digested pB42AD vector to obtain the expression vector pB42AD-OsDS1PR1.
[0164] b) Yeast experiment: pLacZi-DS1-7, pLacZi-DS1-647, pLacZi-DS1-647-2700, and pB42AD-OsDS1PR1 were transformed into EGY48 strain according to the Coolaber Super Yeast Competency Preparation and Transformation Kit (SK2401-200T) and the SD / -Trp / -Ura with Agar (PM2262-10X0.5L) instructions. After incubation at 30℃ for 2 days, photographs were taken for observation.
[0165] 3) EMSA experiment:
[0166] a) Vector construction: cDNA from Nipponbare total RNA reverse transcription was used as the amplification template. The amplification primer sequences were OsDS1PR1-1302bp-His-F(CTGTATTTTCAGGGCCATATGAGTTTTGAGGGACTGGA) and OsDS1PR1-His-R(ACGGAGCTCGAATTCGGATCCTCAGGATGATGCAAAGAG), obtaining a 1302bp OsDS1PR1 target fragment with the N-terminus 453bp removed. This fragment was then recombined into the BamHI / NedI double-digested PET-28a-His vector to obtain the OsDS1PR1 protein expression vector PET-28a-His-OsDS1PR1.
[0167] b) Biotin probe synthesis: Biotin-labeled and unlabeled probes were synthesized at Zhejiang Shangya Biotechnology Co., Ltd. The primer sequences were: Biotin-OsDS1PR1-pDS1-7-F(GGTCATATAGATACGAAGAAA) and Biotin-OsDS1PR1-pDS1-7-R(TTTCTTCGTATCTATATGACC).
[0168] c) EMSA Experiment: The procedure was performed according to the DIG Gel Shift Kit (Roche, catalog number 03353591910). The probe primers were denatured at 95°C for 10 minutes, slowly cooled to 15°C, and diluted to a concentration of 100 fmol / μL. This was then mixed with 100 ng of purified protein and incubated at room temperature for 30 minutes. The sample was placed in a natural polyacrylamide gel (6.5%) in 0.5X TBE buffer (45 mM Tris, 45 mM boric acid, and 1 mM EDTA) and electrophoresed at 400 mA for 30 minutes. Immediately afterward, the membrane was cross-linked with UV light for 5 minutes. The membrane was then incubated for 30 minutes each in blocking solution and DIG antibody solution. After thorough washing, CSPD working solution was spread onto the membrane, and the membrane was observed and photographed using a low-light-cooled CCD imaging device (Tanon 5200).
[0169] 2. Creation of new direct-seeding rice germplasm with high OsDS1 expression and no exogenous components.
[0170] The inventors' results have demonstrated that high expression of OsDS1 can improve the flood tolerance of rice, combined with the positive regulatory effect of OsDS1PR1 on OsDS1, and that the LUC / REN ratio increases linearly with the increase of the number of repeats at the OsDS1PR1 binding site DS1-7(ATAGATACGA). Figure 8 H), the inventors used DS1-7 as an ideal modification site to modify the promoter of OsDS1. First, the inventors edited DS1-7 using the precise editing ePE2 system.
[0171] The experimental method was as follows: Following the operating procedure of the pHUC411-cMYL-PEmaxNC(ePE2) precise editing system of Wang Kejian's research group, the editing primer sequences were designed as follows:
[0172] DS1-7X3-PE2-g++(TGCATAAAGTATCTTTTCCAAGTCGTTTC);
[0173] DS1-7X3-PE2-g--(CTCTGAAACGACTTGGAAAAGATACTTTA);
[0174] DS1-7X3-RP-PE2-F(GTGCttcgtatctatTCGTATCTATTCGTATCTAtgacctgacttggaaaagataGAACATTT);
[0175] DS1-7X3-RP-PE2-R(TCAAAAATGTTCtatcttttccaagtcaggtcatATAGATACGAATAGATACGAatagatacgaa).
[0176] The reaction system consisted of 10 μL (10 μM) each of DS1-7X3-PE2-g++ and DS1-7X3-PE2-g-; 5 μL of T4 DNA ligase buffer; 1 μL of T4 PNK; 24 μL of sterile water; and a final volume of 50 μL. After mixing, the mixture was incubated at 37°C for 1 h, followed by the addition of 2.5 μL of 1M NaCl. The PCR reaction was then carried out at 95°C for 5 seconds, followed by natural annealing for 3 h. The PCR instrument was then turned off and allowed to cool naturally to obtain the target fragment. The obtained target fragment was recombined into a BsaI-digested pHUC411-cMYL-PEmaxNC (ePE2) to obtain the precise editing vector ePE2-DS1-7X3. The ePE2-DS1-7X3 vector was then transformed into the indica rice variety “Huazhan”.
[0177] The inventors intended to repeat the binding site DS1-7 three times, but the actual editing methods obtained did not repeat DS1-7 three times; instead, three different editing methods were obtained. The first editing method was a one-time repetition of DS1-7. Specifically, the promoter sequence of DS1 itself was edited after the original DS1-7. The "AGAAA" immediately following DS1-7 was edited into the first half of DS1-7, "ATAGA," and then the next three bases (CTA) were deleted. The subsequent "TACGA" became the second half of DS1-7. This editing method repeated DS1-7 once, and the corresponding positive edited plant was DS1-7X3-1 (SEQ ID NO: 4). The second editing method involved a single base substitution (C replaced with A) after the first editing method, and the corresponding positive edited plant was DS1-7X3-2 (SEQ ID NO: 5). The third editing method involves replacing "ACT" with "TAG" after the first editing method, which is equivalent to the first half of DS1-7, "ATAGA". This means DS1-7 is repeated one and a half times. The corresponding positive edited plants are DS1-7X3-3, 4, 5, 6 (SEQ ID NO: 6). Figure 9 A). qRT-PCR results showed that the expression level of OsDS1 was significantly increased in these edited positive plants. Figure 9B), the qRT-PCR primers were pOsDS1F(GACTCCGTGCTCAAGACGAT) and pOsDS1R(TTGTTGGCGTTGAACTCCTT). These edited plants without exogenous components also showed strong flood tolerance after flooding treatment. Figure 9 C), after being submerged in 5cm of water for 8 days, both the coleoptile length and germination rate were significantly higher than those of the wild type. Figure 9 The results (D, E) show that this germplasm has great application potential in the breeding of new varieties suitable for direct seeding, and provides important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.
[0178] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.
[0179] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.
Claims
1. OsDS1 The application of the gene in improving the waterlogging tolerance or direct sowing suitability of rice is characterized in that: Overexpression of DAHPS2 protein in rice can improve the waterlogging tolerance or direct seeding suitability of rice. The OsDS1 The cDNA full-length nucleotide sequence of the gene is shown as SEQ ID NO: 1; The OsDS1 The gene encodes the DAHPS2 protein.
2. Use according to claim 1, characterized in that: The OsDS1 The nucleotide sequence of the complete gene expression unit of the gene is shown as SEQ ID NO:
2.
3. An artificially modified rice protein that can highly express DAHPS2 protein. OsDS1 Genes are characterized by: It has a nucleotide sequence of one of SEQ ID NO: 4-6.
4. The artificial construct of claim 3. OsDS1 The application of the gene in improving the waterlogging tolerance or direct seeding suitability of rice is characterized in that: Overexpression of DAHPS2 protein in rice can improve the waterlogging tolerance or direct seeding suitability of rice. The artificial modification OsDS1 The gene encodes a DAHPS2 protein.
5. A vector overexpressing OsDS1 application of the vector overexpressing a gene in improving the waterlogging tolerance or direct-seeding suitability of rice, characterized in that: The vector contains a nucleotide sequence as shown in one of SEQ ID NO: 1, 4-6.
6. A composition comprising OsDS1 The use of a host cell containing a gene in improving the waterlogging tolerance or direct sowing suitability of rice, characterized in that: The host cell contains a nucleotide sequence as shown in SEQ ID NO:
1.
7. The application described in claim 1 or 2 OsDS1 Genes or the artificial modifications described in claim 3 or 4 OsDS1 The application of genes in creating new rice germplasm with waterlogging tolerance and direct seeding properties is characterized by: With nucleotides as shown in SEQ ID No: 1-2 OsDS1 Genes are target genes, and their enhancement is achieved through transgenic or gene-editing methods. OsDS1 Gene expression levels were measured to obtain new rice plants with characteristics of waterlogging tolerance and direct seeding.
8. A method for improving water logging tolerance direct seeding characteristics in rice, characterized in that: Using genes containing nucleotides as shown in SEQ ID No: 1 or SEQ ID No: 2 as target genes, the expression level of these genes is increased through transgenic or gene editing methods to improve the waterlogging tolerance and direct seeding characteristics of rice.
9. Use as claimed in claim 7 or method as claimed in claim 8, characterised in that: By increasing the number of nucleotides as shown in SEQ ID No: 2 OsDS1 Gene regulatory elements DS1-7 for the purpose of achieving OsDS1 high expression of genes.