Application of human circular RNA (Ribonucleic Acid) in preparation of diagnostic reagent or medicine for diagnosing and / or treating aortic dissection

Abstract

The invention provides an application of human source circular RNA hsacirc0083796 in preparation of a diagnostic reagent or a medicine for diagnosing and / or treating aortic dissection. The invention also provides a kit for diagnosing the aortic dissection. The invention also provides a pharmaceutical composition for treating aortic dissection. According to the application of the human source circular RNA in preparation of heart disease related products, the related heart disease related circular RNA (circled-Frizzled class receptor 3, hsacirc0083796) is one of circular RNAs with the highest expression quantity in the blood of aortic dissection patients and has high conservative property, the function of the circular RNA is closely related to heart diseases, and the circular RNA has a good application prospect in preparation of heart disease related products. The method has great significance in diagnosis and treatment of heart diseases. Meanwhile, due to the stable and specific properties of the circular RNA, compared with other types of markers, the circular RNA has larger abundance in body fluid of a patient and more obvious change, so that the circular RNA has the potential of becoming a novel diagnostic marker.

Description

Technical Field

[0001] The present invention relates to the use of human circular RNA in preparing a diagnostic reagent or medicine for diagnosing and / or treating aortic dissection. Background Art

[0002] In most cases, there are no obvious symptoms before aortic dissection. Currently, there is a lack of early diagnostic markers and early warning systems for AD. Patients often present with sudden chest and abdominal pain, which can be misdiagnosed as myocardial infarction, pulmonary embolism, and other conditions, leading to delayed treatment. Therefore, identifying biomarkers and novel strategies for early diagnosis and prevention is crucial to reducing the mortality rate of AD. Circular RNAs (circRNAs) are covalently closed RNAs that can be stably present in cells and even in body fluids, regulating gene expression by acting as miRNA / protein sponges, protein scaffolds, and templates for protein translation. Current studies have shown that abnormal circRNA expression is closely associated with the development and progression of cardiovascular disease. Summary of the Invention

[0003] The technical solution of the present invention provides the use of human circular RNA in the preparation of diagnostic reagents or drugs for diagnosing and / or treating aortic dissection. Specifically, the present invention provides a diagnostic kit and therapeutic drug combination for heart disease that targets the heart disease-associated circular RNA hsa_circ_0083796. The present invention also provides a kit for diagnosing aortic dissection and a pharmaceutical composition for treating aortic dissection.

[0004] The present invention provides the use of human circular RNA hsa_circ_0083796 in preparing a diagnostic reagent or a drug for diagnosing and / or treating aortic dissection.

[0005] Wherein, the hsa_circ_0083796 contains the nucleotide sequence shown in SEQ ID NO.1.

[0006] The present invention provides a kit for diagnosing aortic dissection, which comprises a probe or primer for specifically detecting circular RNA, or an antibody or small molecule compound for specifically detecting a polypeptide; wherein the circular RNA is a nucleic acid comprising the sequence shown in SEQ ID NO.1.

[0007] Wherein, the primers are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0008] The present invention also provides a pharmaceutical composition for treating aortic dissection, comprising at least one of hsa_circ_0083796, a recombinant vector containing a gene encoding hsa_circ_0083796, a recombinant virus containing a gene encoding hsa_circ_0083796, and a recombinant viral vector containing a gene encoding hsa_circ_0083796; the hsa_circ_0083796 contains the nucleotide sequence shown in SEQ ID NO.1.

[0009] The pharmaceutical composition includes a preparation prepared with pharmaceutically acceptable carriers or excipients.

[0010] Wherein, the carrier includes at least one of chitosan, cholesterol, liposomes and lipid nanoparticles; the drug dosage form includes tablets, capsules, granules, pills, syrups, oral solutions, oral suspensions, oral emulsions or injections.

[0011] In the application of human circular RNA provided by the present invention in the preparation of heart disease-related products, the heart disease-related circular RNA (circ-Frizzled class receptor 3, hsa_circ_0083796) involved is one of the most highly expressed circular RNAs in the blood of patients with aortic dissection, has high conservation, and its function is closely related to heart disease, which is of great significance in the diagnosis and treatment of heart disease. At the same time, due to the stable and specific nature of circular RNA, its abundance in patient fluids is greater and its changes are more significant compared to other types of markers, so it has the potential to become a new diagnostic marker. In addition, the stability of circular RNA allows it to remain active even at room temperature or under repeated freeze-thaw conditions, and the requirements for storage and transportation conditions are relatively low, reducing the dependence and cost of cold chain transportation, making it more convenient for use in different regions and medical conditions; the lack of structural features such as the 5' end cap and 3' end poly (A) tail on linear mRNA that can trigger innate immune responses avoids stimulating the body to produce a strong innate immune response and reduces the risk of adverse reactions such as inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 In Example 2, gene chip sequencing was used to detect changes in the expression profile of circular RNA in the serum of patients with aortic dissection (Figure A is the distribution analysis of total RNA expression values of serum samples; Figure B is the correlation coefficient analysis of total RNA of serum samples; Figure C is the significant differential expression analysis of circRNA in serum samples; Figure D is the overall distribution analysis of differentially expressed circRNA; Figure E is the cluster analysis of differential circRNA expression levels).

[0013] Figure 2In Example 3, the expression changes and diagnostic value of hsa_circ_0083796 in the serum of multiple patients with aortic dissection were analyzed (Figure A shows the expression levels of differentially expressed circRNAs in the serum of patients with aortic dissection and control patients; Figure B shows the expression levels of hsa_circ_0083796 in the serum of patients with aortic dissection and control patients; Figure C shows the ROC curve of hsa_circ_0083796 as a marker for aortic dissection).

[0014] Figure 3 For Example 4, the sequence and feature analysis of hsa_circ_0083796 (Figure A shows the genomic location of hsa_circ_0083796 obtained from the UCSC gene annotation database; Figure B is a schematic diagram of the splicing loop of mouse hsa_circ_0083796; Figure C is the basic information of hsa_circ_0083796 in the circbase database; Figure D is the conservation analysis of the hsa_circ_0083796 sequence in rats, mice, and humans).

[0015] Figure 4 Figure 5 shows the expression changes of hsa_circ_0083796 in aortic dissection patient tissues and mouse tissues. (Figure A shows the expression level of hsa_circ_0083796 in aortic dissection tissues from AD patients and normal controls detected by FISH assay; Figure B shows the quantitative analysis of hsa_circ_0083796 fluorescence intensity; Figure C shows the expression level of hsa_circ_0083796 in aortic dissection tissues from AD patients and normal controls; Figure D shows the expression level of hsa_circ_0083796 in aortic dissection tissues from mice).

[0016] Figure 5 The expression level of hsa_circ_0083796 in vascular smooth muscle cells was changed after Ang II induced the expression of hsa_circ_0083796 in Example 6.

[0017] Figure 6 Figure 7: Changes in vascular smooth muscle cell proliferation, migration, and phenotypic conversion after hsa_circ_0083796 interference (Figures A and B show changes in m-VSMC cell migration ability; Figures C and D show changes in mVSMC cell proliferation ability; Figure E shows the expression levels of α-SMA, SM-MHC, and calponin, indicators related to mVSMC cell phenotypic conversion).

[0018] Figure 7 This is the hsa_circ_0083796 siRNA adeno-associated virus construction in Example 8 (Figure A is the siRNA vector, and Figure B is the empty vector map (before the target sequence is inserted)).

[0019] Figure 8 Figure 9 shows the effect of knocking down hsa_circ_0083796 on the incidence of aortic dissection in mice (Figure A shows the survival curve of mice after modeling. Figure B shows the survival rate of mice after modeling. Figure C shows the incidence of small aortic dissection 13 days after the induction of the model. Figure D shows the characteristic image of the mouse aorta 13 days after the induction of the model. Figures E and F show the maximum diameter of the mouse thoracic aorta measured by small animal ultrasound 13 days after the induction of the model). DETAILED DESCRIPTION

[0020] The technical solutions of the present invention will be described below in conjunction with embodiments. Obviously, those skilled in the art will understand that the described embodiments are only some embodiments of the present invention, rather than all embodiments. These embodiments are only used to illustrate the present invention and do not limit the scope of the present invention in any way. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention.

[0021] Example 1 Characteristic Analysis of Study Population

[0022] To identify and screen for potential circular RNA markers for the diagnosis of aortic dissection (AD), blood samples from patients with aortic dissection and a control group were collected for ceRNA microarray sequencing. The inclusion criteria for clinical specimen collection were as follows: 1) detailed clinical history and patient information; 2) complete imaging reports and data supporting a confirmed diagnosis of AD; 3) patients who had not received blood transfusions or large-volume fluid therapy outside the hospital on admission; and 4) patients who had no shock or organ failure and had normal biochemical tests, blood routine, and urine routine. Exclusion criteria were as follows: 1) patients with traumatic or iatrogenic aortic dissection or infectious aortitis; 2) patients with confirmed or highly suspected familial aortic disease, such as Marfan syndrome (MFS), Turner syndrome, Ehlers-Danlos syndrome, Loeys-Dietz syndrome, or hereditary vascular diseases; and 3) patients with aortic aneurysms. The control group was selected from the inpatients of the general internal medicine department of our hospital. The patients were diagnosed with no aortic dilatation, and neither the patients themselves nor their immediate family members had a history of large vessel disease. All patients signed informed consent forms when they were admitted to the hospital. This invention was authorized and approved by the Ethics Committee of the Affiliated Hospital of Qingdao University (approval number: QYFYWZLL-26857). According to the statistical analysis of the basic information and clinical characteristics of the patients in the aortic dissection group and the control group, it was considered that the clinical characteristics of the two groups of patients were consistent. As shown in the attached Figure 1Among them, AD aortic dissection; BMI body mass index; WBC white blood cell count; NEU neutrophil count; Hb hemoglobin; CRP C reactive protein; BNP brain natriuretic peptide; D-dimer D dimer; TC total cholesterol; TG triglyceride; LDL-C low density lipoprotein cholesterol; FPG fasting blood glucose; LDH lactate dehydrogenase; LVEF left ventricular ejection fraction. The Shapiro-Wilk normality test was used to test the normality of the measurement data. Intergroup comparisons were performed using the independent sample t-test. Non-normally distributed continuous data were expressed using the M(Q1, Q3) test and compared between groups using the Mann-Whitney U test. Enumeration data were expressed as cases or percentages (%) and compared between groups using the χ2 test. P < 0.05 was considered statistically significant. The basic information and clinical characteristics of the patients enrolled in the AD and control groups are shown in Table 1.

[0023] Table 1 Basic information and clinical characteristics of patients in the AD group and the control group

[0024]

[0025]

[0026] Example 2 Analysis of CircRNA Expression Profiles in Serum Samples

[0027] Main experimental methods

[0028] 1. Total RNA Extraction

[0029] Total RNA from the sample was extracted using Trizol (Invitrogen). Add 500 μl of Trizol per 100 μl of serum and repeatedly pipette until fully lysed. After standing on ice for 5 minutes, add 1 / 5 volume of chloroform to the lysate. Vigorously shake for 15 seconds until the solution becomes turbid. Stand at 4°C for 5 minutes. Centrifuge at 12,000 × g at 4°C for 15 minutes. The liquid in the tube will now separate into three layers. Transfer the top layer to a new EP tube, being careful not to aspirate the middle white layer. Add an equal volume of pre-chilled isopropanol, invert and mix thoroughly, and stand at 4°C for 10 minutes. Centrifuge at 12,000 × g at 4°C for 10 minutes. A white precipitate will usually be visible. Discard the supernatant and retain the precipitate. Add 1 ml of 75% ethanol (prepared in RNase-free ddH2O), invert the EP tube and rinse. Centrifuge at 12,000 × g at 4°C for 2 minutes. After the final wash and centrifugation, discard the 75% ethanol, avoiding aspirating the RNA precipitate until there is no liquid around the precipitate. Open the EP tube and place it in a clean bench or a ventilated place in a biosafety cabinet for 2 minutes. Use a fan to dry the remaining ethanol in the tube (this time should not be too long). After drying, add 20μl RNase-free ddH2O water to each EP tube and gently tap the precipitate to fully dissolve it. The extracted RNA concentration is detected by a nucleic acid analyzer and recorded in ng / μl. The product purity is detected by a spectrophotometer. An OD260 / OD280 ratio between 1.8-2.2 indicates high RNA purity. The RNA integrity is further tested by Agilent Bioanalyzer 2100 (Agilent Technologies).

[0030] 2. ceRNA chip detection and data analysis

[0031] To obtain circRNA expression profiles in samples from patients with aortic dissection and normal controls, we commissioned Lianchuan Biotechnology to perform ceRNA microarray testing. Prior to hybridization, the process involved total RNA purification, reverse transcription and amplification, labeling and purification, hybridization, and scanning.

[0032] (1) Purification of total RNA. The purity of total RNA will affect the labeling efficiency of the probe and the results of chip hybridization. Therefore, the total RNA was purified using the QIAGEN RNeasy Kit and the concentration was measured.

[0033] (2) Total RNA Reverse Transcription and Amplification. 250 ng of purified total RNA was labeled and amplified. First, the RNA was reverse transcribed into the first strand of cDNA using the AffinityScript-RT kit and Ptomoter Primer. The second strand of cDNA was then generated using Anti-sense Promoter. T7 RNA polymerase was added, and the second strand of cDNA was amplified to generate cRNA.

[0034] (3) Labeling and purification: The protein was then labeled with the fluorescent dye Cyanine-3-CTP (Cy3) and purified using the QIAGEN RNeasy Kit.

[0035] (4) Hybridization and scanning: Finally, rolling hybridization was performed at 65°C for 17 h. After elution, the original image was scanned using Agilent Scanner G5761A (Agilent Technologies).

[0036] (5) Data analysis process

[0037] Feature Extraction software (version 12.0.3.1, Agilent Technologies) was used to process the raw images and extract raw data. Genespring software (version 14.8, Agilent Technologies) was then used for quantile normalization and subsequent processing. The normalized data were filtered, and at least one group of probes marked as 80% detected in each group of samples used for comparison was retained for subsequent analysis. Differentially expressed genes were screened using the p-value of the T test, with a P-value <= 0.05 or a fold difference >= 2. Unsupervised hierarchical clustering was performed on the differentially expressed genes, and the expression patterns of the differentially expressed genes across different samples were displayed using heat maps.

[0038] 3. RNA reverse transcription

[0039] The inversion reaction used 1 μg of RNA, and the experiment was performed using the HiScript Q RT SuperMix for qPCR (+gDNA wiper) kit (Nanjing Novozymes Biotechnology Co., Ltd.). The inversion reaction was performed in a 0.2 ml RNase-free centrifuge tube. In the first step, genomic DNA was removed. 1 μg of RNA was taken and added to 4 μl of 4× gDNA wiper mix. The volume was made up to 16 μl with RNase-free ddH2O. After gently pipetting to mix, the reaction was placed in a PCR instrument and heated at 42°C for 2 minutes. The reaction volume was 16 μl. To the reaction tube from the first step, 4 μl of 5× qRT SuperMix II reagent was added. After pipetting to mix, the reaction was heated in a PCR instrument for 20 μl in a gradient of 50°C for 15 minutes and 85°C for 2 minutes.

[0040] 4. Real-time quantitative PCR

[0041] Primer 5 software was used to design primers for circRNA identification. The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primer sequences are shown in Table 2:

[0042] Table 2 qPCR primer sequences

[0043]

[0044] The qRT-qPCR experiment used the SYBR Green mix kit produced by Nanjing Norwegian Biotechnology Co., Ltd. The reaction system and reaction conditions are shown in the table below.

[0045] Table 3 qPCR system

[0046]

[0047] Table 4 qPCR program

[0048]

[0049] 5. Obtaining tissue samples from patients with aortic dissection (AD)

[0050] AD tissue samples were obtained from the aortic wall at the site of the dissection rupture in patients undergoing open surgery for AD at the Department of Cardiovascular Surgery, Affiliated Hospital of Qingdao University. A control group of samples was obtained from patients diagnosed with coronary artery disease (CAD) by coronary angiography and undergoing coronary artery bypass grafting (CABG), who had no history of major vascular disease in either the patient or their immediate family members. During surgery, aortic wall tissue was collected from the ascending aorta-saphenous vein anastomosis. All aortic wall tissue was removed of excess fat and rinsed with saline. The tissue was immediately chilled in liquid nitrogen and stored at -80°C. Tissue was frozen for total RNA extraction or frozen sections, which were then stored at -80°C until further use. Other tissue samples were fixed in 4% neutral formaldehyde in a cool, ventilated area for at least three days, embedded in paraffin, and serially sectioned at approximately 5 μm thickness for subsequent storage. Six samples were collected from each of the experimental and control groups.

[0051] 6. Fluorescence in situ hybridization (FISH)

[0052] FISH assays were used to examine the localization and expression of hsa_circ_0083796 in aortic tissue from patients with AD and mouse models. The RNA FISH kit (SA-Biotin system) was manufactured by Shanghai Jima Biotechnology Co., Ltd. The hsa_circ_0083796 probe sequence was 5′-ATGTCCGTACCAGATAGCGAGTGTTC-3′, labeled with biotin at the 5′ end. The random negative control probe sequence was 5′-TATCGTAGCACGCAGTGCGAGTATCT-3′. All reagents and experimental procedures were performed according to the kit instructions.

[0053] Reagent preparation:

[0054] (1) 0.1% Buffer A: Buffer A is prepared by mixing 999 μL of PBS solution with 1 μL of specific Buffer A. To ensure the accuracy of the experimental results, the solution should be freshly prepared before each use.

[0055] (2) The stock solution concentration of Buffer C is 20×. When used, it needs to be diluted with first-grade pure water to obtain a working concentration of 4×, 2×, or 1×.

[0056] (3) 0.1% Buffer F: Mix 999 μL of 4× Buffer C with 1 μL of Buffer F. Make sure to prepare freshly before each use to ensure the accuracy and reliability of the experimental results.

[0057] (4) The blocking solution is the mother solution, which can be used directly after diluting with 5 mL of 1× PBS and stored at 4°C.

[0058] (5) SA-Cy3 concentration is 1 μM, ready-to-use reagent.

[0059] Experimental steps:

[0060] (1) Take out the frozen sections of human aorta / mouse aorta tissue from the -80℃ freezer, add 4% paraformaldehyde, and fix at room temperature for 15 minutes.

[0061] (2) Remove the paraformaldehyde fixative and add 100 μL of 0.1% Buffer A. Treat the sliced tissue at room temperature for 15 minutes.

[0062] (3) Discard Buffer A, add 100 μL of proteinase K working solution to the slices, and incubate at 37°C for 25 min; remove proteinase K and wash twice with PBS;

[0063] (4) Add 100 μL of 1× blocking solution and incubate at 37°C for 35 minutes.

[0064] (5) Remove the blocking solution, add 100 μL of 2× Buffer C, and place the slices in a 37°C incubator for 30 min.

[0065] (6) Preheat Buffer E (denaturing solution) in a 78°C metal bath for 30 minutes. Add 100 μL of preheated denaturing solution to each section and incubate at 78°C for 10 minutes. Discard the denaturing solution and wash the sections sequentially with formaldehyde (10 minutes), 75% ethanol (2 minutes), 85% ethanol (2 minutes), and 100% ethanol (2 minutes).

[0066] (7) Probe preparation: Add an appropriate amount of sterile DEPC water to the probe powder and mix well to obtain a 100 μM probe storage solution. After the storage solution is divided, store it at -20°C in the dark. Preparation of probe working solution: Take the probe storage solution and mix it with SA-Cy3 in PBS solution in proportion (prepare 10 μL probe working solution, containing 1 μL of 100 μM biotin-probe, 1 μL of SA-Cy3 and 8 μL of PBS).

[0067] (8) When using, place the probe in a 75°C water bath for 10 minutes to denature it, and incubate it at 37°C for 30 minutes.

[0068] (9) Add 100 μL of the treated probe mixture to the slices, protect from light, and place them in a 37°C molecular hybridization oven for overnight hybridization (12 hours).

[0069] (10) The next day, remove the sample from the hybridization oven, remove the probe mixture, and then add 100 μL of 0.1% Buffer F and wash at 37°C for 10 min.

[0070] (11) After washing, discard Buffer F and use 100 μL of 2× Buffer C to wash three times at 60°C, each washing for 10 min.

[0071] (12) Remove 2× Buffer C again, add 100 μL of fresh 2× Buffer C, and wash three times at 37°C for 10 min each time. Remove 2× Buffer C from the plate.

[0072] (13) Immunofluorescence staining: Anti-α-SMA primary antibody was incubated overnight, and then incubated with the corresponding secondary antibody.

[0073] (14) DAPI (4',6-diamidino-2'-phenylindole) staining solution was added to the tissue sections to stain the cell nuclei. The staining was performed at room temperature for 5 minutes and then washed with PBS.

[0074] (15) Seal the slides with sealing glue, store the sections away from light, and observe and photograph them under a fluorescent inverted microscope as soon as possible.

[0075] 7. Experimental cell culture and cell model construction

[0076] The cells used in this project were mouse aortic smooth muscle cells (m-VSMCs), isolated and cultured from mouse aortas in our laboratory; HEK-293 cells were purchased from our laboratory. These cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C in an incubator containing 5% CO2.

[0077] (1) Isolation and culture of m-VSMC cells:

[0078] Thoracic aortas were extracted from 3-week-old mice using sterile instruments and digested in 37°C digestive solution for 15 minutes. The adventitia and media were separated, and the media was thoroughly minced using microtweezers and microscissors. 1 mL of digestive solution was added and the cells were placed in a 37°C cell culture incubator for further digestion, mixing by pipetting every 20 minutes until no large granular tissue fragments remained. An equal volume of complete culture medium (DMEM supplemented with 10% fetal bovine serum) was added to terminate digestion. The cells were filtered through a sterile 70μm filter, and the filtrate was collected and centrifuged at 1000 rpm for 10 minutes. The supernatant was discarded, and the pellet was resuspended in complete culture medium and incubated in a 37°C incubator with 5% CO2. After 24 hours of culture, cells adhered and were used for subsequent experiments.

[0079] (2) Cell passaging:

[0080] Observe the cell growth. When the cell growth density reaches 90% of the culture dish area, perform cell passage. Discard the culture medium in the cell culture dish and use sterile PBS to wash the cells at the bottom of the culture dish. Wash gently to avoid cell shedding. Add 1-3mL of 0.25% trypsin for digestion and place in the incubator for 2-3 minutes to digest. Observe under a microscope. When the cells become round, separate from each other, and are no longer tightly attached to the bottom of the dish, discard the trypsin and add 5mL of DMEM culture medium containing 10% FBS to terminate digestion. Use a pipette to repeatedly blow the cells to disperse the cells and mix them. Divide them into new cell culture dishes according to the cell density, add fresh culture medium and place them in the incubator for culture.

[0081] (3) Construction of AD cell model:

[0082] In this study, we treated m-VSMC cells with 150 nM Ang II to induce phenotypic transformation and proliferation, mimicking the changes in vascular smooth muscle cells during AD development. Prior to induction, cells were starved (cultured in serum-free medium) for 24 hours. When the cell density reached 70-90%, the medium was replaced with complete medium and Ang II treatment was administered.

[0083] 8. Cell transfection

[0084] When the cells are growing well in the cell culture dish / plate and the density reaches 70%, cell transfection is performed using Lipofectamine 3000.

[0085] (1) Dilute Lipofectamine 3000 reagent: Dilute Lipofectamine 3000 reagent with culture medium in an EP tube and mix thoroughly. For transfection of a six-well plate, use 125 μL of culture medium + 4 μL of Lipofectamine 3000 reagent. Incubate at room temperature for 5 minutes.

[0086] (2) Plasmid dilution: Based on the plasmid concentration, transfect 2 μg of plasmid into each well and take an appropriate amount of plasmid solution + 125 μL of culture medium.

[0087] (3) Mix the diluted Lipo3000 reagent and the diluted DNA, mix gently, and incubate at room temperature for 20 minutes. Drop the mixture into the cell culture dish / plate.

[0088] 9. Determination of CCK8 Cell Activity

[0089] The cell proliferation ability was determined using the Cell Counting Kit-8 (CA1210, Solebro).

[0090] m-VSMCs were seeded at a density of 5500 cells / well in 96-well plates, with three replicates per group. After 24 hours, the cells were treated with drugs or transfected. After another 24 hours of culture, the culture medium in the 96-well plates was removed. 200 μL of CCK-8 working solution (CCK-8 stock solution diluted 1:50 in DMEM containing 3% serum) was added to each sample well and blank well. The cells were incubated at 37°C for 1 hour, and the absorbance (OD) at 450 nm was measured using a microplate reader.

[0091] Cell viability = [(OD experimental - OD blank) / (OD control - OD blank)] x 100%.

[0092] 10. Cell proliferation detection (EdU experiment)

[0093] Using BeyoClick TM The cell proliferation ability was determined by EdU-594 kit (C0078S, Beyotime).

[0094] (1) Cell culture. Place a sterile glass slide in a 24-well plate in a clean bench, seed the cell suspension at a density of 8,000 to 10,000 cells per well, and then proceed with subsequent experiments.

[0095] (2) Remove the culture medium and wash the cells three times with PBS. Prepare 2×EdU working solution (1:500 dilution) and preheat 2×EdU at 37°C. Add 400 μL DMEM + 400 μL 2×EdU working solution to each well and incubate for 40 min.

[0096] (3) Remove the culture medium, add 1 mL of 4% paraformaldehyde, and fix at room temperature for 15-30 minutes.

[0097] (4) Remove the fixative and wash each well with 500 μL of washing solution three times, each time for 3-5 minutes.

[0098] (5) Remove the washing solution and add 500 μL of permeabilization solution to each well and incubate for 10-15 minutes.

[0099] (6) Remove the permeabilization solution and wash each well with 500ml washing solution 1-2 times, each time for 3-5 minutes.

[0100] (7) Prepare Clik reaction solution (Clik reaction buffer: 1.72 mL; CuSO4: 80 μL; Azide 594: 4 μL; Clik additive solution: 200 μL).

[0101] (8) Remove the washing solution from the previous step, add 200 mL of Clik reaction solution to each well, shake gently, and incubate at room temperature in the dark for 30 minutes.

[0102] (9) Remove the Clik reaction solution and wash with washing solution three times, each time for 3-5 minutes.

[0103] (10) DAPI or Hoechest was used to stain the cell nucleus.

[0104] Fluorescence microscopy was used to take pictures and count cells.

[0105] 11. Cell scratch assay to detect cell migration

[0106] Cells were seeded in 6-well plates (2×105 cells / well) and cultured overnight in 10% FBS medium. m-VSMCs were cultured in 10% serum growth medium to a cell density of 80% for transfection. After the cell density reached 100%, a scratch was made in the middle of each well using a 200μL pipette tip against the bottom of the 6-well plate to form an initial wound of monolayer cells, and the cells were washed twice with PBS. Subsequently, the cells were cultured in FBS-free medium for 24 hours. Cell growth was observed under a fluorescence microscope, images were taken, and the scratch healing area was measured using image analysis software. The scratch healing ability was analyzed based on the ratio of the initial scratch area to the scratch area after 24 hours of growth to evaluate the level of cell migration.

[0107] 12. Transwell assay to detect cell migration

[0108] Cells were seeded in 12-well plates (2 × 104 cells / well) and cultured overnight in 10% FBS medium. The plates were trypsinized, and digestion was terminated with complete medium (200 μL / well). The cells were then transferred to a centrifuge tube, centrifuged at room temperature, and the supernatant removed. The cells were trypsinized and transferred to a chamber (8-μm pore size) containing FBS-free medium. The chamber was incubated for 24 hours in 10% FBS medium (500 μL). The cells were then fixed with 4% paraformaldehyde for 30 minutes, stained with 0.1% crystal violet for 30 minutes, and washed three times with PBS. Cells were imaged using a fluorescence microscope, and the number of migrated cells was determined using image analysis software.

[0109] 13. Western Blot (WB)

[0110] Western blotting was used to detect the expression levels of CDK-6, SM-MHC, α-SMA and calponin proteins in tissues and cells.

[0111] Total cell protein extraction:

[0112] (1) Discard the culture medium from the cell culture dish and wash the cells twice with PBS. Add RIPA lysis buffer (RIPA) containing 0.1 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitors (Roche) and incubate on ice for 30 minutes. Collect the cells using a cell scraper and transfer them to a 1.5 mL EP tube.

[0113] (2) Centrifuge the EP tube at 12000g and 4°C for 5 min.

[0114] (3) Take the supernatant and add 4× loading buffer according to the proportion. Mix well and heat at 95°C for 10 min to denature the protein. Store in a refrigerator at -20°C until use.

[0115] Protein concentration measurement:

[0116] The protein concentration was determined using the Biotech BCA Protein Concentration Assay Kit (enhanced).

[0117] (1) Prepare BCA working solution: Mix BCA reagent and Cu reagent in a ratio of 50:1.

[0118] (2) Standard dilution: The concentrations of the standards were 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively, and added to the standard wells of a 96-well plate.

[0119] (3) Add an appropriate volume of sample to the sample wells of a 96-well plate (20 μL).

[0120] (4) Add 200 μL of BCA working solution and incubate at 37°C in the dark for 20 min.

[0121] (5) After standing, the 96-well plate changes color, and the absorbance of A562 is measured using a microplate reader.

[0122] (6) Calculate the standard curve based on the absorbance of the standard, then subtract the sample absorbance from the standard curve to calculate the protein concentration of the sample. Perform subsequent protein imprinting tests based on the protein concentration.

[0123] (Western Blot)

[0124] Preparation of experimental reagents:

[0125] (1) Preparation of 10× electrophoresis buffer:

[0126] Table 5 10× electrophoresis fluid composition

[0127]

[0128] Dilute to 1× with deionized water.

[0129] (2) Preparation of 10× transfer buffer:

[0130] Table 6 10× transfer buffer composition

[0131]

[0132] When using, add 200 mL of methanol and then dilute with deionized water to 1×. Pre-cool before use.

[0133] (3) Preparation of 1×TBS (Tris buffered saline) buffer:

[0134] Table 7 1×TBST composition

[0135]

[0136]

[0137] (4) Preparation of TBST buffer:

[0138] Add 1 mL of Tween-20 to 1 L of 1× TBS buffer and stir to dissolve and mix thoroughly. Store at an appropriate temperature (such as room temperature or 4°C) in a cool, dry place to prevent deterioration.

[0139] (5) Preparation of blocking solution:

[0140] Dissolve 2.5 g of skim milk powder in 50 mL of 1× TBST buffer to prepare a 5% skim milk blocking solution. Prepare fresh for use.

[0141] Western Blot Experimental Procedure

[0142] (1) Use the ExpressCast PAGE Color Gel Rapid Kit (New Cymer) to prepare an electrophoresis gel with a separation gel concentration of 12%;

[0143] (2) Sample loading: Place the prepared electrophoresis gel into the electrophoresis tank, add the prepared 1× electrophoresis solution, remove the comb, rinse the sample loading space with electrophoresis solution, and add protein samples in sequence, 10-15 μl per well.

[0144] (3) Electrophoresis: First, maintain a constant voltage of 80V for 30min. After the bromophenol blue dye enters the lower separation gel, adjust the voltage to 120V and continue electrophoresis until the bromophenol blue dye runs to the edge of the gel.

[0145] (4) Transfer: Cut a 0.45 μm nitrocellulose membrane (PVDF membrane) in advance and activate it in methanol. Use a transfer tongs to fix the sponge, filter paper, gel, and nitrocellulose membrane in order. Add 1× electrotransfer buffer and place the transfer tank in an ice bath. Transfer at 250 mA, constant current for 1.5 h.

[0146] (5) Blocking: Transfer the PVDF membrane to an incubation box and block it with blocking solution that covers the PVDF membrane at room temperature for 1 hour. After blocking, wash it three times with 1× TBST (5 minutes each time).

[0147] (6) Incubation with primary antibody: Add the prepared primary antibody to the incubation box and incubate on a shaker at room temperature for 2 h or at 4°C overnight.

[0148] (7) Recover the primary antibody and wash the membrane three times with 1× TBST (5 min / time).

[0149] (8) Incubation with secondary antibody: Add the prepared secondary antibody to the incubation box and incubate on a shaker at room temperature for 1 h.

[0150] (9) Membrane washing: Wash three times with 1×TBST (5 min / time).

[0151] (10) Development: Add ECL chemiluminescence solution (enhanced chemiluminescence detection kit, ECL, 34578, Thermo Fisher Scientific) to the membrane, cover with a transparent plastic film to ensure uniform distribution of the luminescent solution, develop with a chemiluminescence imager, and take photos.

[0152] 14. Statistical analysis

[0153] Experimental results are expressed as mean ± standard error (SEM) and statistically analyzed using GraphPad Prism software (GraphPad Prism 9.0). Student t-tests were used to compare two independent samples, and one-way ANOVA was used to compare multiple groups. P < 0.05 indicated statistical significance.

[0154] 15. Experimental Results

[0155] Take 3-4 mL of venous blood from the two groups of patients in Example 1 and place it in an ethylene diaminetetraacetic acid (EDTA) anticoagulant tube, centrifuge at 3000 rpm for 10 minutes at room temperature or let it stand for 1 hour, separate the serum, and store it at -80°C for subsequent plasma circRNA examination. In order to determine the overall level of RNA expression in the experimental samples and the repeatability of the samples, we performed a statistical analysis on the distribution of total RNA expression values in the serum of patients with aortic dissection and the control group in the sequencing results. The results showed that the expression levels of total RNA in each group of samples were basically the same (maximum value, upper quartile, median, lower quartile and minimum value), indicating that the quality of the samples met the requirements of subsequent experiments and had good repeatability. See the attached figure for details. Figure 1 A. Next, we analyzed the correlation between the samples in each group. The results showed that the expression of total RNA in each group of samples had significant correlation. Figure 1 B.

[0156] In order to screen for differentially expressed circRNAs in each group of samples, we conducted an in-depth analysis of the normalized data (screening criteria: up-regulation or down-regulation fold change value ≥ 2). The results showed that compared with the control group, there were 6966 differentially expressed circRNAs in the serum of patients with aortic dissection, of which 2537 circRNAs were significantly overexpressed and 4429 circRNAs were significantly underexpressed. Figure 1 C. Based on the test data, we drew a volcano plot to further determine the overall distribution of differentially expressed circRNAs, where the horizontal axis represents the fold change of differential expression of circRNAs in different samples; the vertical axis represents the statistical significance of the difference in gene expression; red represents significantly upregulated differentially expressed genes, blue represents significantly downregulated differentially expressed genes, and gray dots represent non-significantly differentially expressed genes. See the attached figure for details. Figure 1 D.

[0157] In order to intuitively display the expression of differential circRNAs in different samples, we clustered the data according to the similarity of circRNA expression profiles. The vertical axis represents the sample, the horizontal axis represents the differentially expressed circRNA, and different colors represent different circRNA expression levels. The colors from green to red represent the signal value from low to high. Red represents highly expressed circRNA, and green represents low expressed circRNA. See the attached table for details. Figure 1 E.

[0158] Example 3

[0159] Feasibility analysis of hsa_circ_0083796 as a plasma biomarker for the diagnosis of aortic dissection

[0160] According to the sequencing results, the expression level of hsa_circ_0083796 was significantly upregulated in patients with aortic dissection. Therefore, hsa_circ_0083796 was selected as the research object to further explore its potential as a clinical diagnostic marker. Subsequently, we expanded the sample size to collect 50 serum samples from patients with aortic dissection and 21 serum samples from control patients, and detected the expression level of hsa_circ_0083796 in the serum of patients with aortic dissection and control patients. The results showed that the expression of hsa_circ_0083796 in the serum of patients with aortic dissection was significantly increased by about 109.10±76.28 times (P<0.05). See the attached figure for details. Figure 2 A. Further, the diagnostic ability of hsa_circ_0083796 as a marker for aortic dissection was evaluated by ROC curve. The results showed that the area under the curve (AUC) of serum hsa_circ_0083796 for diagnosing aortic dissection was 0.956 (95% CI: 0.879-0.991, P < 0.001), the diagnostic cutoff value was >4.358, the sensitivity was 100%, and the specificity was 76.19%. See the Appendix for details. Figure 2 B.

[0161] Example 4

[0162] hsa_circ_0083796 exists in different species and has good sequence identity

[0163] After our preliminary screening, hsa_circ_0083796 was significantly upregulated. According to the basic information of this circular RNA in the circbase website and combined with the UCSC gene annotation, we found that: This circular RNA is 1215bp long and is located between exons 3 and 4 of the fzd3 gene on the short arm of human chromosome 8. Figure 3A. The transcribed RNA is spliced to remove the middle intron (6312 bp at the middle dotted line), and exons 3 and 4 are looped to form a 1215 bp loop. See the attached figure for details. Figure 3 B. The information of hsa_circ_0083796 in human, mouse and rat in the database is shown in the attached Figure 3 C. The homology of human and mouse FZD3 sequences is very high, with a similarity of up to 92.59%, which is very well conserved, and also suggests that hsa_circ_0083796 has important biological functions. Figure 3 D.

[0164] Example 5

[0165] hsa_circ_0083796 expression changes in aortic dissection tissue

[0166] To investigate the expression changes of hsa_circ_0083796 during the pathological development of aortic dissection, we further studied the expression level of hsa_circ_0083796 in tissues of patients with aortic dissection and mouse models. RNA-FISH experiments were performed to verify the expression of hsa_circ_0083796 in patient aortic dissection tissues. The results showed that the level of hsa_circ_0083796 was significantly upregulated in patient aortic dissection tissues. Figure 4 A. Immunofluorescence staining was used to verify the colocalization of hsa_circ_0083796 with the smooth muscle cell-specific protein α-SMA, suggesting that hsa_circ_0083796 is mainly expressed in vascular smooth muscle cells. See the Appendix for details. Figure 4 B. RNA was extracted from aortic dissection tissues of patients using TRIzol, and the expression changes of hsa_circ_0083796 were detected by RT-qPCR. The results showed that the level of hsa_circ_0083796 was also significantly upregulated in aortic dissection tissues of patients. See the attached figure for details. Figure 4 C. An aortic dissection mouse model was established by intraperitoneal injection of angiotensin II (Ang II) (2 mg / kg every 12 hours) and beta-aminopropionitrile (BAPN) (0.33 g / kg every 24 hours). RNA from aortic tissue was extracted using TRIzol. qRT-PCR analysis showed that the expression level of hsa_circ_0083796 was significantly increased in the diseased aortic tissue. (See Appendix for details.) Figure 4 D.

[0167] Example 6

[0168] Expression changes of hsa_circ_0083796 in mouse vascular smooth muscle cells after Ang II treatment

[0169] Mouse vascular smooth muscle cells were treated with 150nM Ang II. After 24 hours, the cells were collected and total RNA was extracted with TRIzol. The expression level of hsa_circ_0083796 in cardiomyocytes was detected by RT-qPCR. The results showed that the expression level of hsa_circ_0083796 in vascular smooth muscle cells showed a significant upward trend after Ang II treatment. Figure 5 .

[0170] Example 7

[0171] Changes in proliferation, migration, and phenotypic transition of vascular smooth muscle cells after knockdown of hsa_circ_0083796

[0172] The expression level of hsa_circ_0083796 was upregulated in AD patients, mice and Ang II-induced VSMCs models, suggesting that hsa_circ_0083796 may be involved in the occurrence and development of AD. An important mechanism for the pathogenesis of AD is the conversion of VSMCs from a contractile phenotype to a synthetic phenotype, and the migration and proliferation ability of VSMCs cells are enhanced. Therefore, it is speculated that the increased expression of hsa_circ_0083796 is involved in the migration, proliferation and phenotypic transformation of VSMCs cells induced by Ang II. In mVSMCs cells, hsa_circ_0083796-shRNA and control SC were transfected, respectively, and treated with 150nM AngII for 24 hours. The results of the cell scratch experiment and Transwell experiment showed that inhibiting the expression of hsa_circ_0083796 significantly reduced the migration ability of mVSMC cells. For details, see the attached figure. Figure 6 A and Figure 6 B. CCK8 and EDU experiments further demonstrated that inhibition of hsa_circ_0083796 expression significantly inhibited the proliferation of mVSMC cells induced by AngII. Figure 6 C and Figure 6 D. Western blot was used to detect the expression levels of mVSMC cell phenotypic transformation-related indicators α-SMA, SM-MHC, and calponin. The results showed that when hsa_circ_0083796 was inhibited, the expression levels of these protein markers α-SMA, SM-MHC, and calponin were restored. Figure 6 E.

[0173] Example 8

[0174] hsa_circ_0083796siRNA adeno-associated virus construction

[0175] To further explore the role and function of hsa_circ_0083796 in the development of aortic dissection, we constructed hsa_circ_0083796 siRNA AAV-9 virus. Adeno-associated virus (AAV) is a type of non-enveloped, icosahedral, small virus with a single-stranded linear DNA structure that cannot replicate autonomously.

[0176] (Adeno-associated virus serotype 9, AAV9) targets multiple tissues and organs for animal-level gene overexpression or siRNA interference experiments. We commissioned Heyuan Biotechnology (Shanghai) Co., Ltd. to design and prepare mouse hsa_circ_0083796 siRNA AAV-9 virus. AAV9-hsa_circ_0083796-siRNA (4×1011 vg / mL) was injected into the tail vein to infect vascular smooth muscle cells of C57BL / 6 male mice. About one week after infection, the expression level of hsa_circ_0083796 in mouse arterial tissue was significantly reduced. Detailed information on viral vectors is attached. Figure 7 .

[0177] Example 9

[0178] Changes in aortic vascular injury and aortic dissection after hsa_circ_0083796 inhibition in mice

[0179] We used β-aminopropionitrile (BAPN) and Ang II to induce thoracic aortic dissection (AD) in mice, constructed hsa_circ_0083796 siRNA adeno-associated virus, and inhibited the expression of hsa_circ_0083796 in mice to explore the preventive and therapeutic effects of hsa_circ_0083796 in AD. We performed hsa_circ_0083796-siRNA-AAV viral intervention in AD model mice. The results showed that compared with the group of mice treated with BAPN and Ang II alone, the survival rate of mice receiving virus treatment was significantly improved. For details, see the Appendix. Figure 8 A. In addition, a significant reduction in mortality and dissection rates was observed in mice treated with the virus, as detailed in the Appendix. Figure 8 BD. Thirteen days after the induction of the model, the maximum diameter of the mouse thoracic aorta was measured by small animal ultrasound. The results showed that viral treatment significantly reduced the maximum diameter of the mouse thoracic aorta. See the attached figure for details. Figure 8 EF.

[0180] Gene chip detection found that there were significant differences in the expression of hsa_circ_0083796 in the serum of patients with aortic dissection, and the expression of hsa_circ_0083796 was significantly upregulated in the aortic tissue of patients; by expanding the clinical samples, extracting sera from 50 patients with aortic dissection and 21 control patients, and ROC curve evaluation verified the ability of hsa_circ_0083796 as a diagnostic marker for aortic dissection; after angiotensin II treatment, the expression of hsa_circ_0083796 in vascular smooth muscle cells was significantly upregulated; knocking down hsa_circ_0083796 by small interfering RNA can significantly reduce the proliferation and migration ability of vascular smooth muscle cells increased by Ang II treatment and promote cell phenotypic conversion, proving that silencing hsa_circ_0083796 can inhibit aortic dissection. In addition,

[0181] The incidence of aortic dissection in AD model mice treated with hsa_circ_0083796-siRNA-AAV virus was significantly reduced, suggesting that using appropriate vectors to package hsa_circ_0083796 small interfering RNA into drugs and deliver them to aortic tissue will have the effect of treating and preventing aortic dissection.

[0182] In summary, the inventors have experimentally demonstrated that detecting the expression level of hsa_circ_0083796 and inhibiting hsa_circ_0083796 in vascular smooth muscle cells have important application value in the prevention and treatment of heart disease. In addition, by using blood and tissue samples from patients with clinical aortic dissection, it was confirmed that hsa_circ_0083796 can be used as a clinical diagnostic marker for heart disease.

[0183] Therefore, the present invention provides a kit for diagnosing heart disease by detecting hsa_circ_0083796, comprising hsa_circ_0083796-specific primers / probes / small molecule compounds, and a drug packaged with hsa_circ_0083796 small interfering RNA and appropriate carriers or excipients (such as mammalian expression plasmids, adenoviruses, adeno-associated viruses, chitosan, cholesterol, liposomes, nanoparticles, etc.), which is used for preventing and / or treating heart disease by intravenous injection.

[0184] Appendix list:

[0185] SEQ ID No.1

[0186]

[0187] SEQ ID No.2

[0188] GGTGTTTTCAGCATTCTTTATCTCG

[0189] SEQ ID No.3

[0190] CCATAGGGTGGAATGGCTGATA

Claims

1. Use of human circular RNA hsa_circ_0083796 in the preparation of diagnostic reagents or drugs for the diagnosis and / or treatment of aortic dissection.

2. The use according to claim 1, characterized in that: The hsa_circ_0083796 contains the nucleotide sequence shown in SEQ ID NO.

1.

3. A kit for diagnosing aortic dissection, characterized in that: The kit comprises a probe or primer for specifically detecting circular RNA, or an antibody or small molecule compound for specifically detecting a polypeptide; wherein the circular RNA is a nucleic acid comprising the sequence shown in SEQ ID NO.

1.

4. The kit for diagnosing aortic dissection according to claim 3, wherein: The primers are shown as SEQ ID NO.2 and SEQ ID NO.

3.

5. A pharmaceutical composition for treating aortic dissection, characterized in that: The invention comprises at least one of hsa_circ_0083796, a recombinant vector containing a gene encoding hsa_circ_0083796, a recombinant virus containing a gene encoding hsa_circ_0083796, and a recombinant viral vector containing a gene encoding hsa_circ_0083796; the hsa_circ_0083796 contains the nucleotide sequence shown in SEQ ID NO.

1.

6. The pharmaceutical composition according to claim 5, characterized in that It includes preparations prepared with pharmaceutically acceptable carriers or excipients.

7. The pharmaceutical composition according to claim 6, characterized in that: The carrier includes at least one of chitosan, cholesterol, liposomes and lipid nanoparticles; the pharmaceutical dosage form includes tablets, capsules, granules, pills, syrups, oral solutions, oral suspensions, oral emulsions or injections.

Images