IRAP molecular marker developed based on blueberry reverse transcription transposon sequence and application of IRAP molecular marker
By developing the IRAP molecular marker library of blueberry Ty1-copia retrotransposon sequence and optimizing the PCR reaction system, the problems of low efficiency and insufficient polymorphism of blueberry germplasm identification were solved, efficient and accurate germplasm identification and kinship analysis were achieved, and blueberry germplasm innovation and industrial development were promoted.
Patent Information
- Application Number
- CN202510621104.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2045-05-14
AI Technical Summary
The existing technology is difficult to efficiently and accurately identify blueberry germplasm resources. Traditional methods are susceptible to environmental influences, have a long identification cycle and are subjective. Traditional molecular marking technology has limited polymorphic coverage in blueberries, making it difficult to meet modern breeding needs.
Developed a library of IRAP molecular marker primers based on the blueberry Ty1-copia retrotransposon sequence, combined with an optimized PCR reaction system and identification method, and constructed a digital identification technology, using the high polymorphism and stability of IRAP markers to generate specific fingerprint maps of blueberry germplasm.
The efficiency of detection of blueberry germplasm polymorphism has been significantly improved, with the proportion of polymorphic sites ≥98.7%, achieving rapid and accurate germplasm identification and kinship identification, supporting the efficient utilization and breeding of blueberry germplasm resources.
Smart Images

Figure CN120505441A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to bio-agriculture and related industries, or gene detection services and other related technologies in the biopharmaceutical industry, and particularly to an IRAP molecular marker developed based on blueberry retrotransposon sequences and its application. Background Art
[0002] Blueberries (Vaccinium spp.) are an important berry crop with economic, ecological, and medical value. Accurate identification of their germplasm resources and assessment of genetic diversity are the core foundation for variety improvement, resource conservation, and industrial development. Currently, blueberry germplasm identification mainly relies on traditional methods such as morphological observation and physiological and biochemical index analysis. However, these methods are easily affected by the environment, have long identification cycles, and are highly subjective, making it difficult to meet the demands of modern breeding for efficient and accurate identification technologies.
[0003] The development of molecular marker technology has provided new avenues for germplasm identification. For example, simple sequence repeats (SSRs) and simple sequence repeat regions (ISSRs) markers have been widely used in plant genetic analysis. However, these technologies have limitations, including limited polymorphism coverage, reliance on genomic sequence information for primer development, and cumbersome procedures. Especially in blueberries, a species with a complex genome and rich genetic diversity, the detection efficiency and accuracy of traditional markers are insufficient to meet the requirements.
[0004] Retrotransposons are an important component of the plant genome. Their long terminal repeats (LTRs) are characterized by high frequency, extensive polymorphism, and multiple insertion site variations, making them ideal targets for developing efficient molecular markers. Intertransposon amplification polymorphism (IRAP) technology, based on LTR retrotransposons, amplifies polymorphism in intertransposon regions, offering advantages such as ease of operation, high polymorphism, and strong stability, demonstrating significant potential in plant genetic diversity analysis, phylogenetic identification, and fingerprinting. However, current technologies have not yet implemented practical applications of IRAP markers in blueberry germplasm identification, resulting in a lack of key technological support for the in-depth exploration and efficient utilization of blueberry germplasm resources.
[0005] Furthermore, there is an urgent need for digital management of blueberry germplasm resources, as traditional methods are insufficient for rapid tracing and accurate differentiation of germplasm characteristics. Therefore, developing IRAP molecular marker technology suitable for blueberries and constructing a standardized identification system are key to solving problems such as low efficiency in blueberry germplasm identification, insufficient polymorphism detection, and lack of digital management. Summary of the Invention
[0006] The purpose of this invention is to address the shortcomings mentioned in the background art by proposing a highly polymorphic IRAP molecular marker primer library based on the blueberry Ty1-copia retrotransposon sequence, optimizing the supporting PCR reaction system and identification method, and constructing a digital identification technology covering electronic ID cards.
[0007] This technology can significantly improve the efficiency of blueberry germplasm polymorphism detection (polymorphism site ratio ≥98.7%), fill the gap in domestic blueberry IRAP molecular marker technology, and provide an efficient and accurate technical solution for the assessment of genetic diversity, identification of kinship and molecular marker-assisted breeding of blueberry germplasm resources. It is of great significance for promoting blueberry germplasm innovation and high-quality development of the industry.
[0008] Based on a first principal aspect of the invention, an IRAP molecular marker primer library based on blueberry Ty1-copia retrotransposon sequences is provided, the IRAP molecular marker primer library containing at least one pair of the following primers:
[0009] Primer pairs LRT1-42 (CTTTATGAAGCCGACATACCTGATT) and LRT1-26 (AAGACATAGGTTATCTTGGTTCTAAACC);
[0010] Primer pairs LRT1-38 (CATGGCTTTGAGAAACCTGTCAAA) and LTR1-53 (ATCTCCAAGATGAAGTATATATGGAGCAAC);
[0011] Primer pairs LTR1-59 (AAGATCAAAAAACATTCAGATGGGTCTATAG) and LRT1-19 (TGTCAATCCCTGTAACGACAATATCA);
[0012] The primer library contains ≥98.7% polymorphic sites and can generate a specific fingerprint of blueberry germplasm through PCR amplification.
[0013] As a further preferred embodiment, the primer library also includes primers selected from the following:
[0014] LRT1-1(ATCACTGAATCATACTTGGGATCTTGT),
[0015] LTR1-3(ATCAAACACAATCCTGATGGTACTCT),
[0016] LRT1-7(ATTTTCTCCAGTTGCCAAGCT),
[0017] LRT1-11 (TCTCTGAGACCATTTATATGGCTTAACC),
[0018] LTR1-13 (AGATTGTTTGAGGCCATAGATAGACTT),
[0019] LTR1-14 (AGATTGTTTGAGGCCATAGATAGACTT),
[0020] LRT1-18 (CGTAGACTACAAGAATCACAATACCAGTA),
[0021] LRT1-20 (GAACAGAGGTGACGGATTAATATCTGAA),
[0022] LTR1-22 (AAACTTCGGTATTTTCTCGGCATT),
[0023] LTR1-23 (GCCACTTCAATGCCGAGAAAATA),
[0024] LRT1-25 (CTATGTCTTTCAAGAGATCGAGAGTGTATTTT),
[0025] LRT1-33 (TTTCTCAAAGCCATGTTGAGATTTGGATA),
[0026] LRT1-36 (GAGATGAGAAAAAACCCAGTGGAATAG), <
[0033] As a further preferred option, the primers are designed based on Ty1-copia-type retrotransposon RT sequences screened by LTR_Retriever and TEsorter software, and the primer length ranges from 18 to 25 bp.
[0034] Based on a second key aspect of the present invention, a blueberry germplasm identification kit is provided, comprising: the aforementioned IRAP molecular marker primer library; and
[0035] The optimized PCR reaction system, specifically a 10 μL system, comprises: 1.0 μL template DNA (30 ng / μL), 0.7 μL (10 μM) each of the forward and reverse primers of any primer pair as described in claim 1, 5.0 μL 2×Taq PCR Mix, and 2.6 μL ddH2O; and
[0036] The standardized PCR reaction procedure includes: pre-denaturation at 94°C for 4 minutes; 37 cycles of denaturation-annealing-extension steps: 94°C / 30 seconds, 57°C / 30 seconds, 72°C / 1 minute; final extension at 72°C for 7 minutes; and storage at 4°C.
[0037] As a further preferred embodiment, in the aforementioned blueberry germplasm identification kit, the annealing temperature in the PCR reaction program is 55℃-58℃, wherein the annealing temperature of primers LTR1-13 is 55℃, the annealing temperature of primers LTR1-22 is 56℃, the annealing temperature of primers LTR1-53 is 58℃, and the annealing temperature of the remaining primers is 57℃.
[0038] Based on the third main aspect of the present invention, a method for digital identification of genetic diversity in blueberry germplasm is provided, comprising the following steps:
[0039] S1. Genomic DNA was extracted from blueberry leaves using the Tiangen DNA Secure Plant Kit (DP320), and the extracted DNA purity met the requirement of an OD260 / OD280 value of 1.7-2.0.
[0040] S2, IRAP-PCR amplification was performed using the aforementioned IRAP molecular marker primer library, and the amplification products were separated by 2.0% agarose gel electrophoresis;
[0041] S3, convert the electrophoresis results into a 0 / 1 data matrix, where a band at the same electrophoresis position is marked as "1" and no band is marked as "0";
[0042] S4. Use PIC_CALC software to calculate the polymorphic information content (PIC) and select primer combinations with PIC values ≥ 0.8 as core primers;
[0043] S5. Based on the 0 / 1 data matrix of the core primers, generate a QR code electronic ID card containing germplasm name, collection location latitude, longitude and altitude information.
[0044] As a further preferred embodiment, the genomic DNA extracted in step S1 is detected by 1.0% agarose gel electrophoresis and nucleic acid concentration analyzer, and diluted to 20 mg / L-1 with TE buffer; when separating by 2.0% agarose gel electrophoresis in step S2, the electrophoresis voltage is 100V and the electrophoresis time is 40 minutes.
[0045] As a further preferred option, the construction criteria for the 0 / 1 data matrix in step S3 are as follows: when there is a band at the same electrophoresis position and it appears stably in three repeated experiments, it is marked as "1"; otherwise, it is marked as "0".
[0046] Based on a fourth key aspect of the present invention, a blueberry germplasm resource management system is provided, comprising:
[0047] Database module: Stores fingerprint codes and corresponding QR code electronic ID cards for 112 blueberry germplasms, wherein the fingerprint codes are composed of 0 / 1 data of the core primers in claim 6;
[0048] Identification module: Retrieves genetic polymorphism data of germplasm by scanning a QR code, including the number of amplified bands, fragment size, and geographical distribution information;
[0049] Analysis module: Calculates the genetic distance between germplasms based on Nei's genetic similarity coefficient and generates a visual kinship map.
[0050] In the above scheme, data integration and standardization are first completed through the database module. The genetic information (fingerprint code) and geographical information (latitude, longitude, and altitude) of 112 blueberry germplasms are integrated into a structured database to form a digital archive with "one item, one code".
[0051] Secondly, the fingerprint code consists of 0 / 1 data from core primers (e.g., LRT1-42, LRT1-26, LRT1-38), defining a unique genetic identifier for the germplasm based on PCR amplification results. QR code technology is used to encode complex genetic data (such as the number of amplified bands and fragment size) and geographical distribution information into identifiable graphic identifiers, enabling rapid data retrieval via "scan and read".
[0052] Finally, Nei's genetic similarity coefficient was used to calculate the genetic distance between germplasms, quantifying kinship. A visual kinship map was generated using clustering algorithms (such as UPGMA) to intuitively display germplasm classification and evolutionary paths.
[0053] The formula for calculating Nei's genetic similarity coefficient is as follows:
[0054]
[0055] Where, N AB Let N be the number of common stripes. A N B This represents the total number of bands in the two samples.
[0056] In the above scheme, the genetic and geographical data of 112 germplasm accessions are centrally stored through a database module, supporting rapid retrieval and updates, and avoiding the fragility and inefficiency of traditional paper records. By scanning a QR code, users can instantly obtain the amplified banding patterns, geographical origin (e.g., Qiandongnan Prefecture, Guizhou Province), and fitness parameters (e.g., pH 4.5-5.5) of the germplasm, significantly improving information transparency.
[0057] The analysis module is based on genetic distance calculations, and the system can automatically recommend parental combinations (e.g., LM33 "Lanmei 1" and LM77 "Nanda" are genetically distant and suitable for hybridization), assisting breeders in optimizing selection strategies. The visualization atlas displays germplasm clustering results in a tree diagram format (e.g., separation of northern and southern highbush groups), helping researchers analyze the blueberry population structure.
[0058] Furthermore, by using fingerprint code comparison (match rate ≥99% for authenticity), this invention can quickly identify the authenticity of varieties circulating in the market, combating counterfeit seedlings (such as inferior varieties masquerading as "Restylane"). Combined with a geographic information module, the system can recommend superior varieties adapted to specific ecological zones (such as high altitudes and acidic soils) to growers, reducing the risk of introduction failure.
[0059] Based on the fifth main aspect of the present invention, an application of the aforementioned IRAP molecular marker primer library in blueberry variety identification and geographic origin tracing is provided, comprising the following steps:
[0060] Leaf samples of blueberries to be tested were obtained, and PCR amplification was performed using at least three pairs of primers from the IRAP molecular marker primer library described in claim 1. The amplification conditions were: 94℃ pre-denaturation for 4 minutes, 37 cycles of 94℃ / 30 seconds denaturation, 57℃ / 30 seconds annealing, 72℃ / 1 minute extension, and 72℃ final extension for 7 minutes.
[0061] The amplification products were separated by 2.0% agarose gel electrophoresis to obtain an electrophoretic pattern, which was then converted into a 0 / 1 data matrix according to the method described in claim 6 to generate a fingerprint code for the sample to be tested.
[0062] The fingerprint code is compared with the 112 germplasm fingerprint codes pre-stored in the database module of the blueberry germplasm resource management system of claim 9:
[0063] If the matching degree is ≥99%, it is determined to be a genuine variety, and the corresponding germplasm name, place of origin and geographical coordinates are output; if the matching degree is <95%, it is determined to be a hybrid or counterfeit variety.
[0064] For genuine varieties, their ecological adaptability to their place of origin is traced through the geographical information in their electronic ID cards, and a planting area recommendation report is generated.
[0065] Compared with the prior art, the present invention also has the following advantages and beneficial effects:
[0066] (1) Ease of operation: The experimental procedure of IRAP labeling is highly simplified, avoiding dependence on complex instruments and equipment, as well as interference from cumbersome experimental steps. This feature enables the experimental operation to be completed efficiently in a short time, significantly improving experimental efficiency and providing strong support for large-scale blueberry germplasm resource analysis.
[0067] (2) Results stability: Through precise control of experimental conditions and careful optimization of primers, the marker exhibits highly consistent and stable experimental results under different experimental environments (such as different laboratories) and different operators. This stability effectively reduces experimental errors and uncertainties, and greatly enhances the reliability and scientific rigor of the research data.
[0068] (3) Identification efficiency: IRAP markers have the capability of high-throughput analysis, enabling simultaneous analysis of blueberry samples from different varieties in multiple regions. This advantage allows for the acquisition of a large amount of genetic information in a short time, providing a rapid and efficient technical approach for research such as genetic diversity analysis and kinship identification of blueberry germplasm resources. This helps breeders better select parents, improve breeding efficiency, and cultivate superior blueberry varieties.
[0069] (4) Environmental adaptability: The experimental results are minimally affected by external environmental factors (such as seasonal changes, regional differences, and fluctuations in laboratory environmental conditions), maintaining good stability and reliability under different spatiotemporal conditions. This characteristic ensures the accuracy and reproducibility of the experimental results, providing a solid technical foundation for in-depth research and scientific evaluation of blueberry germplasm resources. Attached Figure Description
[0070] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, obtaining other drawings based on these drawings without creative effort still falls within the scope of the present invention.
[0071] Figure 1The agarose gel electrophoresis results of a portion of blueberry genomic DNA in one embodiment of the present invention are shown, where M is DNA Marker and 1-24 represent portions of blueberry samples respectively;
[0072] Figure 2 The diagram shows the orthogonal experimental results of a 10 μL blueberry IRAP-PCR reaction system in one embodiment of the present invention and the gradient of three PCR cycle numbers. M is the DNA Marker, and 1-16 represent PCR systems numbered 1-16 in Table 2, respectively.
[0073] Figure 3 The results of 2.0% agarose gel electrophoresis screening of IRAP primers LRT1-3, LRT1-26, LRT1-38, LRT1-41, LRT1-42 and LRT1-71 after PCR amplification are shown in one embodiment of the present invention. M is DNA Marker and 1-8 represent 8 different blueberry germplasms.
[0074] Figure 4 The results of PCR amplification of 112 blueberry germplasms using IRAP primers LRT1-42 in one embodiment of the present invention are shown and detected by 2.0% agarose gel electrophoresis. M is the DNA Marker, and 1-112 represent blueberry samples 1-112, respectively.
[0075] Figure 5 An example of a partial germplasm identification card is shown in one embodiment of the present invention. DETAILED DESCRIPTION
[0076] The preferred embodiments of the present invention will be described in detail below to provide a clearer understanding of the purpose, features, and advantages of the invention. It should be understood that the following embodiments are not intended to limit the scope of the invention, but are merely illustrative of the essential spirit of the technical solution of the invention.
[0077] In the following description, certain specific details are set forth for the purpose of illustrating various disclosed embodiments in order to provide a thorough understanding of the various disclosed embodiments. However, those skilled in the art will recognize that embodiments may be practiced without one or more of these specific details. In other instances, well-known techniques associated with this application may not have been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments.
[0078] Throughout this specification, references to "an embodiment" or "an embodiment" indicate that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Therefore, the appearance of "in an embodiment" or "an embodiment" in various places throughout the specification does not necessarily refer to the same embodiment. Furthermore, a particular feature, structure, or characteristic may be combined in any manner in one or more embodiments.
[0079] The IRAP molecular marker primer library of this invention is designed based on the LTR (long terminal repeat) sequence of blueberry Ty1-copia retrotransposons. Its core principle is that Ty1-copia retrotransposons have high copy numbers and wide distribution in the blueberry genome, and the insertion / deletion and variation of their LTR sequences lead to inter-germ polymorphism, making them suitable for genetic marker development. Primers are designed to target the flanking regions of the LTR sequence to amplify inter-transposon sequences, and the differences in polymorphism are used to distinguish different blueberry germplasms.
[0080] This invention relates to an IRAP molecular marker primer library based on the blueberry Ty1-copia retrotransposon sequence, which contains at least one pair of primers from the following:
[0081] Primer pairs LRT1-42 (CTTTATGAAGCCGACATACCTGATT) and LRT1-26 (AAGACATAGGTTATCTTGGTTCTAAACC);
[0082] Primer pair LRT1-38 (CATGGCTTTGAGAAACCTGTCAAA) and LRT1-53
[0083] (ATCTCCAAGATGAAGTATATATGGAGCAAC);
[0084] Primer pairs LTR1-59 (AAGATCAAAAAACATTCAGATGGGTCTATAG) and LRT1-19 (TGTCAATCCCTGTAACGACAATATCA);
[0085] The primer library exhibits a polymorphic site ratio of ≥98.7% and can generate a specific fingerprint of blueberry germplasm via PCR amplification. In one embodiment, these three primer pairs (LRT1-42 and LRT1-26, LRT1-38 and LRT1-53, LRT1-59 and LRT1-19) demonstrate the following key characteristics:
[0086] First, they exhibit high polymorphism information content (PIC) values. Specifically, LRT1-42 has a PIC value of 0.921, while LRT1-26 and LRT1-38 have PIC values of 0.907, significantly higher than other primers (such as LRT1-3, which has a PIC value of 0.795). These high PIC values indicate that these primers can effectively detect the genetic diversity of blueberry germplasm.
[0087] Secondly, it has a 100% germplasm identification rate. Among them, the primer combination LRT1-42+LRT1-26+LRT1-38 can identify all 112 blueberry germplasms, covering all tested samples, demonstrating complete identification ability.
[0088] In this invention, the primer optimization process is performed using L16(4) 3 An orthogonal experiment (Table 2) was conducted to select the optimal combination from 80 initial primers. These three primer pairs amplified clear bands with stable polymorphism in the experiment and were highly compatible with the PCR system (e.g., annealing temperature 57℃).
[0089] Therefore, this invention combines these three primer pairs as core technical features. The selection of these primers is mainly based on the high polymorphism and identification ability supported by experimental data, the optimal results of orthogonal experimental screening, the specific matching with blueberry Ty1-copia retrotransposons, and their irreplaceability in digital identification and commercial applications.
[0090] In some embodiments, the primer library further includes primers selected from:
[0091] LRT1-1(ATCACTGAATCATACTTGGGATCTTGT),
[0092] LTR1-3(ATCAAACACAATCCTGATGGTACTCT),
[0093] LRT1-7(ATTTTCTCCAGTTGCCAAGCT),
[0094] LRT1-11(TCTCTGAGACCATTTATATGGCTTAACC),
[0095] LTR1-13(AGATTGTTTGAGGCCATAGATAGACTT),
[0096] LTR1-14(AGATTGTTTGAGGCCATAGATAGACTT),
[0097] LRT1-18(CGTAGACTACAAGAATCACAATACCAGTA),
[0098] LRT1-20(GAACAGAGGTGACGGATTAATATCTGAA),
[0099] LTR1-22(AAACTTCGGTATTTTCTCGGCATT),
[0100] LTR1-23(GCCACTTCAATGCCGAGAAAATA),
[0101] LRT1-25(CTATGTCTTTCAAGAGATCGAGAGTGTATTTT),
[0102] LRT1-33(TTTCTCAAAGCCATGTTGAGATTTGGATA),
[0103] LRT1-36(GAGATGAGAAAAAACCCAGTGGAATAG),
[0104] LRT1-41(CAAGAGGAGGTTTACATGGAGC),
[0105] LRT1-47(ACTTTTTAGGTATTGAAGTGGCCAG),
[0106] LRT1-55(AATTTGGTATGAAGCGTTGTCATTGT),
[0107] LRT1-61(AGAAAAGCATTTGAGACATCAAGCTG),
[0108] LRT1-71(TTTTTAACATCCAACTGAAAGAGAGGC),
[0109] At least one of LRT1-79 (ATTCTCATTTCTTTAGCTGCGAGTC).
[0110] In one embodiment of the present invention, a blueberry germplasm identification kit is provided, comprising: the aforementioned IRAP molecular marker primer library; and an optimized PCR reaction system, specifically a 10 μL system, comprising: 1.0 μL template DNA (30 ng / μL), 0.7 μL (10 μM) each of the forward and reverse primers of any primer pair from the primer library, 5.0 μL 2×Taq PCR Mix, and 2.6 μL ddH2O; and a standardized PCR reaction program, comprising: 94℃ pre-denaturation for 4 minutes; 37 cycles of denaturation-annealing-extension steps: 94℃ / 30 seconds, 57℃ / 30 seconds, 72℃ / 1 minute; final extension at 72℃ for 7 minutes; and storage at 4℃.
[0111] In the blueberry germplasm identification kit, the annealing temperature in the PCR reaction program is 55℃-58℃, with the annealing temperature of LTR1-13 primers at 55℃, LTR1-22 primers at 56℃, LTR1-53 primers at 58℃, and the remaining primers at 57℃.
[0112] In one embodiment of the present invention, a method for digital identification of genetic diversity in blueberry germplasm is provided, comprising the following steps:
[0113] (1) Genomic DNA was extracted from blueberry leaves using the Tiangen DNA Secure Plant Kit (DP320), and the extracted DNA purity met the requirement of OD260 / OD280 value of 1.7-2.0;
[0114] (2) IRAP-PCR amplification was performed using the primer library in claim 1. The amplification products were separated by 2.0% agarose gel electrophoresis under the following conditions: 100V voltage for 40 minutes.
[0115] (3) Convert the electrophoresis results into a 0 / 1 data matrix, where a band at the same electrophoresis position is marked as "1" and no band is marked as "0";
[0116] (4) Use PIC_CALC software to calculate the polymorphic information content (PIC) and select primer combinations with PIC values ≥ 0.8 as core primers;
[0117] (5) Based on the 0 / 1 data matrix of the core primers, generate a QR code electronic ID card containing germplasm name, collection location latitude, longitude and altitude information. The QR code is generated via https: / / www.qr-batch.com / .
[0118] In one embodiment, the present invention provides a blueberry germplasm resource management system, comprising:
[0119] Database module: Stores fingerprint codes and corresponding QR code electronic ID cards for 112 blueberry germplasms, wherein the fingerprint codes are composed of 0 / 1 data of the core primers in claim 6;
[0120] Identification module: Retrieves genetic polymorphism data of germplasm by scanning a QR code, including the number of amplified bands, fragment size, and geographical distribution information;
[0121] Analysis module: Calculates the genetic distance between germplasms based on Nei's genetic similarity coefficient and generates a visual kinship map.
[0122] The database module was constructed by first importing the fingerprint codes, geographic information, and amplification maps of 112 blueberry germplasms into a MySQL or MongoDB database. Using tools such as https: / / www.qr-batch.com / , the germplasm information was encoded into QR codes and linked to each database entry.
[0123] The identification module first retrieves data by scanning a QR code. Users read the germplasm's QR code using their mobile phones or dedicated scanning devices. The system then calls an API interface to return genetic polymorphism data from the database (e.g., LM01 has 15 bands, with fragment sizes ranging from 200-1500 bp). The data is displayed in an interactive interface showing germplasm details, including electrophoresis patterns, a map of the collection site (e.g., Yongle Township, Nanming District, Guiyang City), and fitness parameters.
[0124] The analysis module requires genetic distance calculation. This involves inputting target germplasm (e.g., LM33 and LM50), and the system automatically calculates the Nei's similarity coefficient. For example, S = 0.75 indicates a close genetic relationship. The map generation uses Python's SciPy library or R's ape package to perform UPGMA clustering, generating a dendrogram, which is then exported as a PDF or PNG file for user download.
[0125] The above systems have a wide range of practical applications. For research institutions, researchers can use the system to analyze the genetic diversity of blueberry populations and directly cite the phylogenetic trees output by the system when publishing papers. For seedling companies, seedlings are sold with QR code labels, allowing buyers to scan the code to verify the authenticity of the variety and obtain planting advice. For government regulation, agricultural departments use the system's database to conduct random checks on seedlings in the market and initiate anti-counterfeiting procedures for varieties with a matching degree of less than 95%.
[0126] Based on the fifth main aspect of the present invention, an application of the aforementioned IRAP molecular marker primer library in blueberry variety identification and geographic origin tracing is provided, comprising the following steps:
[0127] Leaf samples of blueberry to be tested were obtained, and PCR amplification was performed using at least three pairs of primers from the IRAP molecular marker primer library described in claim 1. The amplification conditions were: 94℃ pre-denaturation for 4 minutes, 37 cycles of 94℃ / 30 seconds denaturation, 57℃ / 30 seconds annealing, 72℃ / 1 minute extension, and 72℃ final extension for 7 minutes. The amplification products were separated by 2.0% agarose gel electrophoresis to obtain an electrophoretic pattern, which was converted into a 0 / 1 data matrix according to the method described in claim 6 to generate a fingerprint code for the sample to be tested. The fingerprint code was compared with 112 germplasm fingerprint codes pre-stored in the database module of the blueberry germplasm resource management system of claim 9. If the matching degree was ≥99%, it was determined to be a genuine variety, and the corresponding germplasm name, origin, and geographical coordinates were output. If the matching degree was <95%, it was determined to be a mixed or counterfeit variety. For genuine varieties, the ecological adaptability of their place of origin was traced through the geographical information in the electronic ID card, and a planting area recommendation report was generated.
[0128] In practice, the first step is to analyze geographic information, extracting the latitude, longitude, and altitude of the genuine variety's origin from its electronic identity card (e.g., LM33, altitude 1260 meters, pH 4.8). Then, ecological adaptability matching is performed, using a database and a GIS system to screen for similar ecological zones (e.g., pH 4.5-5.5, altitude 900-2300 meters, average annual temperature 12-18℃). The generated report should indicate the suitable region, such as Qiandongnan Prefecture in Guizhou Province (pH 4.6, altitude 769-1379 meters), and include risk warnings, such as avoiding planting in alkaline soils (pH > 6.0) or low-altitude areas ( < 500 meters). Recommended core tools include a PCR instrument (model: Bio-Rad T100), an electrophoresis imaging system (GelDoc XR+), and a germplasm database (MySQL + QR code generation interface).
[0129] The following is an example:
[0130] 1. Sample collection
[0131] This embodiment selected 112 blueberry germplasms (Table 1) with excellent performance as the research object. These germplasms cover three types: highbush, rabbiteye, and half-highbush, including 54 southern highbush blueberry, 37 rabbiteye blueberry, 19 northern highbush blueberry, and 2 half-highbush blueberry.
[0132] The blueberry materials used in the test were collected from Qiandongnan Prefecture, Guiyang City, and Bijie City in Guizhou Province. During sampling, only healthy and young leaves from the blueberry germplasm were selected. The leaf surfaces were carefully wiped clean, then wrapped in aluminum foil, clearly labeled, and stored at -80°C for subsequent DNA extraction.
[0133] Table 1 Blueberry Germplasm Information
[0134]
[0135] Table 1. Blueberry Germplasm Information (Continued)
[0136]
[0137] Table 1. Blueberry Germplasm Information (Continued)
[0138]
[0139] Table 1. Blueberry Germplasm Information (Continued)
[0140]
[0141] 2. Extraction of blueberry germplasm and its genomic DNA
[0142] Genomic DNA was extracted using the Tiangen DNAsecure Plant Kit (DP320). Its quality and concentration were detected by 1.0% agarose gel electrophoresis and a nucleic acid concentration analyzer. The DNA was diluted with TE buffer to approximately 20 mg / L. The OD260 / OD280 values were all within the range of 1.7 to 2.0, indicating that the purity and concentration of the DNA met the standards required for PCR amplification experiments using IRAP molecular markers.
[0143] 3. IRAP primer design and synthesis
[0144] The genome of blueberry (project number: GCA_014504835.1) was downloaded from NCBI. LTR retrotransposon subsets of *Actinidia chinensis* were obtained using LTRharverst v1.6.2 and LTR_Finder v1.07. The LTR retrotransposon subsets were then filtered using LTR_Retriever software. TESorizer v1.4.0 software was used to classify and structurally label the LTR retrotransposon subsets. Unidirectional primers were designed using the reverse transcriptase (RT) regions of high-copy Ale subfamily LTR retrotransposons, resulting in 80 IRAP primers, which were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0145] 4. Establishment of the IRAP-PCR reaction system
[0146] In the L16(43) orthogonal experiment, the main influencing factors of the 10 μL IRAP-PCR reaction system were optimized. These factors included the amount of template DNA, PCR Mix and IRAP primers. A total of 16 different combinations were investigated (Table 2), and three different PCR cycle number gradients were also set, namely 30, 35 and 37 cycles.
[0147] Table 2L16(4) 3 Orthogonal experimental table
[0148]
[0149] The results are as follows Figure 2 As shown, the optimal PCR reaction system was determined to be system 7, in which the volumes of IRAP primers, Mix enzyme, and sample DNA were 1.4 μL, 5.0 μL, and 1.0 μL, respectively, and 2.6 μL of ddH2O was added, with a PCR cycle number of 37.
[0150] 5. Establishment of the IRAP-PCR reaction procedure
[0151] The PCR reaction program was as follows: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 30 L, 50℃~57℃ annealing for 30 L, 72℃ extension for 1 min, for a total of 37 cycles; finally, react at 72℃ for 7 min and store at 4℃.
[0152] 6. Screening of IRAP primers
[0153] Eight blueberry germplasm accessions with significant morphological differences were randomly selected, including LM07 (Australia), LM14 (Restland), LM26 (Moloria), LM33 (Lanmei 1), LM50 (Free), LM57 (Spain 42), LM60 (L11), and LM77 (Nanda). A screening process was conducted using 80 IRAP primers. Primers that amplified distinct bands and exhibited significant polymorphism were prioritized for study, and their optimal annealing temperatures were further determined.
[0154] Table 3. IRAP Primer Sequence List
[0155]
[0156] 7. IRAP Marker Detection
[0157] Twenty-five IRAP primers were used to perform PCR amplification on 112 blueberry germplasms. Each IRAP primer was used in triplicate. PCR products were detected by 2.0% agarose gel electrophoresis. Some PCR amplification results are shown below. Figure 4 .
[0158] 8. Data Statistics
[0159] The repeatable and clear bands in three replicate experiments were counted. Bands with the same electrophoretic position were marked as "1" and no bands were marked as "0". A 0 / 1 data matrix was constructed for 112 blueberry germplasms.
[0160] 9. Electronic ID Card Production
[0161] The polymorphism information content (PIC value) was calculated using PIC_CALC software. Based on the banding patterns amplified by the core primers, a fingerprint code for blueberry germplasm was formed, assigning values of "0 / 1". This fingerprint code served as the direct basis for constructing a blueberry germplasm DNA fingerprint database or molecular identification (Table 4). Statistical analysis showed that LR1-42, the IRAP primer with the highest PIC value, could identify 59 germplasms and, in combination with primers LRT1-26 and LRT1-38, could identify 112 blueberry germplasms (Table 5). Therefore, it was selected as the core primer for constructing the fingerprint profiles of these 112 blueberry germplasms.
[0162] Table 4. PIC values and number of identified germplasms for each primer.
[0163]
[0164] Table 5. Statistical table of blueberry germplasm identification using primers LRT1-42, LRT1-26, and LRT1-38.
[0165]
[0166] The 0 / 1 digital codes of 112 blueberry germplasm characteristic fingerprint codes were constructed using the 0 / 1 digital codes identified by the specific bands obtained by complementary identification of primer LRT1-42 with primers LRT1-26 and LRT1-38 in blueberry IRAP markers (Table 6).
[0167] In the fingerprint code, the letter A represents primer LRT1-42, the letter B represents primer LRT1-26, and the letter C represents primer LRT1-38.
[0168] Taking Patriot (LM42) as an example, the fingerprint code of LM42 is: A11111111100011B111111000111C110010010111101. The 0 / 1 numbers after the letter A represent the amplification band data of primer LRT1-42, while the 0 / 1 numbers after the letter B represent the amplification band data of primer LRT1-26, and the 0 / 1 numbers after the letter C represent the amplification band data of primer LRT1-38.
[0169] Table 6112 blueberry germplasm fingerprint codes
[0170]
[0171] Table 6112 Blueberry Germplasm Fingerprint Codes (Continued)
[0172]
[0173] Subsequently, using a barcode and QR code generator (website: https: / / www.qr-batch.com / ), fingerprint profiles (Table 7) were generated covering basic information (such as variety name, origin, characteristics, etc.) of 112 tested blueberry germplasm samples.
[0174] Based on this, a unique fingerprint code corresponding to each germplasm was further constructed. As a unique identifier for each germplasm resource, this fingerprint code provides a reliable basis for the accurate identification, management, and traceability of each germplasm resource, facilitating efficient differentiation and application in the research, protection, and utilization of blueberry germplasm resources. Figure 5 Here are some examples.
[0175] Any aspects of this invention not described in detail are well-known to those skilled in the art.
[0176] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. An IRAP molecular marker primer library based on blueberry Ty1-copia retrotransposon sequences, characterized in that: Contains at least one of the following primer pairs: primer pair LRT1-42 (CTTTATGAAGCCGACATACCTGATT) and LRT1-26 (AAGACATAGGTTATCTTGGTTCTAAACC); primer pair LRT1-38 (CATGGCTTTGAGAAACCTGTCAAA) and LTR1-53 (ATCTCCAAGATGAAGTATATATGGAGCAAC); primer pair LTR1-59 (AAGATCAAAAAACATTCAGATGGGTCTATAG) and LRT1-19 (TGTCAATCCCTGTAACGACAATATCA); The ratio of polymorphic sites in the primer library is ≥98.7%, and a specific fingerprint of blueberry germplasm can be generated through PCR amplification.
2. The IRAP molecular marker primer library based on the blueberry Ty1-copia retrotransposon sequence according to claim 1, characterized in that: The primer library also includes primers selected from the following: LRT1-1(ATCACTGAATCATACTTGGGATCTTGT), LTR1-3(ATCAAACACAATCCTGATGGTACTCT), LRT1-7(ATTTTCTCCAGTTGCCAAGCT), LRT1-11(TCTCTGAGACCATTTATATGGCTTAACC), LTR1-13(AGATTGTTTGAGGCCATAGATAGACTT), LTR1-14(AGATTGTTTGAGGCCATAGATAGACTT), LRT1-18(CGTAGACTACAAGAATCACAATACCAGTA), LRT1-20(GAACAGAGGTGACGGATTAATATCTGAA), LTR1-22(AAACTTCGGTATTTTCTCGGCATT), LTR1-23(GCCACTTCAATGCCGAGAAAATA), LRT1-25(CTATGTCTTTCAAGAGATCGAGAGTGTATTTT), LRT1-33(TTTCTCAAAGCCATGTTGAGATTTGGATA), LRT1-36(GAGATGAGAAAAAACCCAGTGGAATAG), LRT1-41(CAAGAGGAGGTTTACATGGAGC), LRT1-47(ACTTTTTAGGTATTGAAGTGGCCAG), LRT1-55(AATTTGGTATGAAGCGTTGTCATTGT), LRT1-61(AGAAAAGCATTTGAGACATCAAGCTG), LRT1-71(TTTTTAACATCCAACTGAAAGAGAGGC), At least one of LRT1-79 (ATTCTCATTTCTTTAGCTGCGAGTC).
3. The IRAP molecular marker primer library based on the blueberry Ty1-copia retrotransposon sequence according to claim 1, characterized in that: The primers were designed based on the Ty1-copia class retrotransposon RT sequence screened by LTR_Retriever and TEsorter software, and the primer length ranged from 18 to 25 bp.
4. A blueberry germplasm identification kit, characterized in that: Comprising: the IRAP molecular marker primer library according to claim 1 or 2; as well as The optimized PCR reaction system, specifically a 10 μL system, comprises: 1.0 μL of template DNA (30 ng / μL), 0.7 μL each of the forward and reverse primers of any primer pair of claim 1 (10 μM), 5.0 μL of 2×Taq PCR Mix, and 2.6 μL of ddH2O; and The standardized PCR reaction program included: initial denaturation at 94°C for 4 minutes; 37 cycles of denaturation-annealing-extension steps: 94°C / 30 seconds, 57°C / 30 seconds, 72°C / 1 minute; final extension at 72°C for 7 minutes; and storage at 4°C.
5. The blueberry germplasm identification kit according to claim 4, characterized in that The annealing temperature in the PCR reaction program is 55°C-58°C, wherein the annealing temperature of the LTR1-13 primer is 55°C, the annealing temperature of the LTR1-22 primer is 56°C, the annealing temperature of the LTR1-53 primer is 58°C, and the annealing temperature of the remaining primers is 57°C.
6. A method for digital identification of blueberry germplasm genetic diversity, characterized in that: The following steps are involved: S1, genomic DNA was extracted from blueberry leaves using the Tiangen DNAsecure Plant Kit (DP320), and the purity of the extracted DNA met the OD260 / OD280 value of 1.7-2.0; S2, performing IRAP-PCR amplification using the primer library of claim 1 or 2, and separating the amplified products by 2.0% agarose gel electrophoresis; S3, converting the electrophoresis results into a 0 / 1 data matrix, where the presence of a band at the same electrophoresis position is marked as "1" and the absence of a band is marked as "0"; S4, polymorphism information content (PIC) was calculated using PIC_CALC software, and primer combinations with PIC values ≥ 0.8 were selected as core primers; S5, based on the 0 / 1 data matrix of the core primers, generate a QR code electronic ID card containing the germplasm name, longitude and latitude of the collection site, and altitude information.
7. The method for digital identification of blueberry germplasm genetic diversity according to claim 6, characterized in that: The genomic DNA extracted in step S1 was subjected to 1.0% agarose gel electrophoresis and nucleic acid concentration determination, and diluted to 20 mg / L-1 with TE buffer; during the 2.0% agarose gel electrophoresis separation described in step S2, the electrophoresis voltage was 100 V and the electrophoresis time was 40 minutes.
8. The method for digital identification of blueberry germplasm genetic diversity according to claim 7, characterized in that: The construction standard of the 0 / 1 data matrix in step S3 is: if there is a band at the same electrophoresis position and it appears stably in three repeated experiments, it is marked as "1", otherwise it is marked as "0".
9. A blueberry germplasm resource management system, characterized in that: include: Database module: storing fingerprint codes of 112 blueberry germplasms and corresponding QR code electronic ID cards, wherein the fingerprint codes are composed of 0 / 1 data of the core primers in claim 6; Identification module: retrieves genetic polymorphism data of germplasm by scanning QR code, including the number of amplified bands, fragment size and geographical distribution information; Analysis module: Calculate the genetic distance between germplasms based on Nei's genetic similarity coefficient and generate a visual phylogenetic map.
10. A use of the IRAP molecular marker primer library according to claim 1 or 2 in blueberry variety identification and geographical origin tracing, characterized in that: The following steps are involved: Obtain leaves of the blueberry sample to be tested, and perform PCR amplification using at least three pairs of primers from the IRAP molecular marker primer library according to claim 1, wherein the amplification conditions are: pre-denaturation at 94°C for 4 minutes, 37 cycles of denaturation at 94°C for 30 seconds, annealing at 57°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 7 minutes; The amplified products were separated by 2.0% agarose gel electrophoresis to obtain an electrophoresis pattern, which was converted into a 0 / 1 data matrix according to the method of claim 6 to generate a fingerprint code of the sample to be tested; The fingerprint code is compared with 112 germplasm fingerprint codes pre-stored in the database module of the blueberry germplasm resource management system of claim 9: If the matching degree is ≥99%, it is determined to be a genuine variety, and the corresponding germplasm name, origin and geographical coordinates are output; If the matching degree is less than 95%, it is judged as a mixed or counterfeit variety; For genuine varieties, the ecological adaptability of their origin can be traced through the geographical information in the electronic ID card, and a planting area recommendation report can be generated.
Citation Information
Patent Citations
IRAP molecular marker developed based on tea tree reverse transcription transposon sequence and application thereof
CN111607663A
Polygonatum sibiricum IRAP marker sequence based on reverse transcription transposon sequence, kit and application
CN118879903A