Streptococcus pneumoniae conjugate vaccine formulations

Abstract

The present invention relates to a novel vaccine formulation comprising a conjugated Streptococcus pneumoniae capsular saccharide antigen (glycoconjugate), and to the use thereof. The present invention relates to a novel vaccine formulation comprising a conjugated Streptococcus pneumoniae capsular saccharide antigen (glycoconjugate). The vaccine formulations of the present invention would typically include at least one glycoconjugate from Streptococcus pneumoniae serotype in a formulation designed to promote resuspension.

Description

Technical Field

[0001] The present invention relates to novel vaccine formulations comprising conjugated capsular saccharide antigens (glycoconjugates) and their uses. The formulations of the invention will generally comprise a glycoconjugate (wherein the saccharide is derived from a serotype of Streptococcus pneumoniae) in a formulation of buffer, saline, surfactant, and adjuvant, the formulation being specifically designed to facilitate resuspension of the adjuvant and / or glycoconjugate and to provide long-term stability of the vaccine. Background Art

[0002] Infections caused by Streptococcus pneumoniae (pneumococci) are a major cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, but dissemination of the bacteria within the respiratory tract can lead to middle ear infections, sinusitis, or recurrent bronchitis. Noninvasive manifestations are generally less severe than invasive disease but are more common.

[0003] Streptococcus pneumoniae (pneumococcus), the causative agent of pneumococcal disease, is a Gram-positive, encapsulated coccus surrounded by a polysaccharide capsule. Variation in the composition of this capsule allows for serological differentiation between approximately 91 capsular types, some of which are frequently associated with pneumococcal disease, while others are less frequently associated. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; common noninvasive manifestations include otitis media, sinusitis, and bronchitis.

[0004] Streptococcus pneumoniae polysaccharides, specifically capsular polysaccharides, are important immunogens found on the surface of the bacteria. This makes them important components in the design of S. pneumoniae vaccines. They have been shown to be useful in eliciting immune responses, particularly when linked to carrier proteins.

[0005] Pneumococcal conjugate vaccines (PCVs) are pneumococcal vaccines used to protect against disease caused by Streptococcus pneumoniae (pneumococcus). The vaccines typically contain multiple saccharide conjugates derived from different serotypes of S. pneumoniae. There are currently six approved PCV vaccines: (called Prevenar in some countries, which is a heptavalent vaccine, i.e., containing seven different serotypes), (10-valent vaccine), PREVNAR (13-valent vaccine), VAXNEUVANCE TM (15-valent vaccine), PREVNAR 20 TM (20-valent vaccine) and PNEUMOVAX 23TM (23-valent vaccine).

[0006] One of the challenges of vaccine formulation is the sedimentation of adjuvants and / or active ingredients (e.g., saccharide conjugates) when the formulation is stored before administration. As the number of serotypes in a pneumococcal conjugate vaccine increases, the overall concentration of the active ingredient increases, leading to differences in dispersion and sedimentation of the formulation. The formulation must be resuspended by oscillation before administration to ensure the accuracy of the administered dose. As the number of serotypes and / or the concentration of serotypes in the vaccine increases, resuspending the formulation becomes more difficult. Thus, there is a need for vaccine formulations that facilitate easier resuspension of the vaccine for administration. Summary of the Invention

[0007] The present invention is based on the groundbreaking discovery of a vaccine formulation for S. pneumoniae vaccines that facilitates the resuspension of particles that settle out of solution to ensure dosage accuracy and long-term stability.

[0008] In one embodiment, the invention provides a formulation comprising: at least 21 different glycoconjugates; a succinate or histidine buffer having a pH in the range of 5.0 to 7.5; calcium chloride, sodium chloride, and / or sodium phosphate; a surfactant; and an adjuvant.

[0009] In one embodiment, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different saccharide conjugates. In one embodiment, the formulation is a 24-valent pneumococcal conjugate composition. In one embodiment, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the saccharide conjugate is a pneumococcal polysaccharide-protein conjugate.

[0010] In one embodiment, the saccharide conjugate comprises at least one saccharide conjugate derived from a serotype of Streptococcus pneumoniae selected from the group consisting of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In one embodiment, the carrier protein of the one or more saccharide conjugates is a diphtheria cross-reactive substance (CRM). 197 ), diphtheria toxin (DT), tetanus toxoid (TT), C5a peptidase (SCP) from Streptococcus, or rhizavidin [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).

[0011] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and the S. pneumoniae serotypes are conjugated to CRMs. 197 .

[0012] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.

[0013] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0014] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0015] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0016] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.

[0017] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0018] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRMs. 197 In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to a CRM. 197 , S. pneumoniae serotype 3 conjugated to SCP.

[0019] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including saccharide conjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM.197 , S. pneumoniae serotype 3 conjugated to SCP.

[0020] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In one embodiment, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, at least two of the S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM. 197 In one embodiment, conjugated to a CRM 197 The at least 17 S. pneumoniae serotypes are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0021] In one embodiment, the pneumococcal saccharide conjugate is selected from: 197 Streptococcus pneumoniae serotype 1, conjugated to CRM 197 Streptococcus pneumoniae serotype 3, conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0022] In one embodiment, the pneumococcal saccharide conjugate is selected from: 197 S. pneumoniae serotype 1, S. pneumoniae serotype 3 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0023] In one embodiment, the total polysaccharide concentration is about 1 to 100 μg / dose. In one embodiment, the concentration of polysaccharide for each serotype is about 1 to 10 μg / dose. In one embodiment, the buffer has a concentration of about 1 to 50 mM. In one embodiment, sodium chloride has a concentration of about 1 to 300 mM. In one embodiment, Formulation C has a calcium chloride concentration of about 1 to 50 mM. In one embodiment, Formulation D has a sodium phosphate concentration of about 1 to 50 mM. In one embodiment, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80. In one embodiment, the surfactant is polysorbate 20. In one embodiment, the concentration of the surfactant is about 0.001% to 1%. In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the concentration of the adjuvant is about 0.1% to 1%.

[0024] In one embodiment, the adjuvant is a liposomal adjuvant. In another embodiment, the adjuvant comprises monophosphonyl lipid A (MPLA) and saponin. In one embodiment, the adjuvant comprises monophosphonyl lipid A phosphorylated hexaacyl disaccharide. and QS-21. In one embodiment, the adjuvant is Liposomal Novel Adjuvant-1 (LiNA-1) described herein. In one embodiment, the adjuvant comprises 3D- and QS-21. In one embodiment, the adjuvant is liposomal novel adjuvant-2 (LiNA-2) described herein. In another embodiment, the adjuvant is LiNA-2A described herein. In another embodiment, the adjuvant is LiNA-2B described herein. In other embodiments, the formulation comprises more than one adjuvant. In specific embodiments, the formulation comprises aluminum phosphate and LiNA-2.

[0025] In one embodiment, the present invention provides a formulation comprising: at least 21 different glycoconjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; calcium chloride; sodium chloride; a surfactant; and an adjuvant.

[0026] In one embodiment, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different saccharide conjugates. In one embodiment, the formulation is a 24-valent pneumococcal conjugate composition. In one embodiment, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the saccharide conjugate is a pneumococcal polysaccharide-protein conjugate.

[0027] In one embodiment, the saccharide conjugate comprises at least one saccharide conjugate derived from a serotype of Streptococcus pneumoniae selected from the group consisting of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In one embodiment, the carrier protein of the one or more saccharide conjugates is a diphtheria cross-reactive substance (CRM). 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a peptidase (SCP) from Streptococcus, or rhizobium avidin protein [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).

[0028] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and the S. pneumoniae serotypes are conjugated to CRMs. 197 .

[0029] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.

[0030] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0031] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0032] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0033] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.

[0034] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0035] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRMs. 197In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to a CRM. 197 , S. pneumoniae serotype 3 conjugated to SCP.

[0036] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including saccharide conjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 , S. pneumoniae serotype 3 conjugated to SCP.

[0037] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In one embodiment, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, at least two of the S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM. 197 In one embodiment, conjugated to a CRM 197 The at least 17 S. pneumoniae serotypes are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0038] In one embodiment, the pneumococcal saccharide conjugate is selected from the group consisting of 197 Streptococcus pneumoniae serotype 1, conjugated to CRM 197 Streptococcus pneumoniae serotype 3, conjugated to CRM197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0039] In one embodiment, the pneumococcal saccharide conjugate is selected from the group consisting of 197 S. pneumoniae serotype 1, S. pneumoniae serotype 3 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0040] In one embodiment, the total polysaccharide concentration is about 1 to 100 μg / dose. In one embodiment, the concentration of polysaccharide for each serotype is about 1 to 10 μg / dose. In one embodiment, the buffer has a concentration of about 1 to 50 mM. In one embodiment, sodium chloride has a concentration of about 1 to 300 mM. In one embodiment, the surfactant is a polysorbate or poloxamer with a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80. In one embodiment, the surfactant is polysorbate 20. In one embodiment, the concentration of the surfactant is about 0.001% to 1%. In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the concentration of the adjuvant is about 0.1% to 1%. In another embodiment, the concentration of the adjuvant is between about 0.01% and about 0.1%. In another embodiment, the concentration of the adjuvant is between about 0.1 and about 1.0 mg / ml. In one embodiment, the concentration of the adjuvant is about 0.025%. In a specific embodiment, the adjuvant is aluminum phosphate at a concentration of about 0.025%.

[0041] In one embodiment, the invention provides a formulation comprising: at least 21 different glycoconjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; sodium chloride; sodium phosphate; a surfactant; and an adjuvant.

[0042] In one embodiment, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different saccharide conjugates. In one embodiment, the formulation is a 24-valent pneumococcal conjugate composition. In one embodiment, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the saccharide conjugate is a pneumococcal polysaccharide-protein conjugate.

[0043] In one embodiment, the saccharide conjugate comprises at least one saccharide conjugate derived from a serotype of Streptococcus pneumoniae selected from the group consisting of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In one embodiment, the carrier protein of the one or more saccharide conjugates is a diphtheria cross-reactive substance (CRM). 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a peptidase (SCP) from Streptococcus, or rhizobium avidin protein [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).

[0044] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and the S. pneumoniae serotypes are conjugated to CRMs. 197 .

[0045] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.

[0046] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0047] In one embodiment, the formulation comprises at least 25 saccharide conjugates including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F and additionally comprising S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to CRMs. 197 .

[0048] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0049] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally comprises S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.

[0050] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0051] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRMs. 197 In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to a CRM. 197 , S. pneumoniae serotype 3 conjugated to SCP.

[0052] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including saccharide conjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 , S. pneumoniae serotype 3 conjugated to SCP.

[0053] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In one embodiment, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, at least two of the S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM. 197 In one embodiment, conjugated to a CRM 197The at least 17 S. pneumoniae serotypes are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0054] In one embodiment, the pneumococcal saccharide conjugate is selected from the group consisting of 197 Streptococcus pneumoniae serotype 1, conjugated to CRM 197 Streptococcus pneumoniae serotype 3, conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0055] In one embodiment, the pneumococcal saccharide conjugate is selected from the group consisting of 197S. pneumoniae serotype 1, S. pneumoniae serotype 3 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0056] In one embodiment, the total polysaccharide concentration is about 1 to 100 μg / dose. In one embodiment, the concentration of polysaccharide for each serotype is about 1 to 10 μg / dose. In one embodiment, the buffer has a concentration of about 1 to 50 mM. In one embodiment, sodium chloride has a concentration of about 1 to 300 mM. In one embodiment, the calcium chloride concentration is about 1 to 50 mM. In one embodiment, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80. In one embodiment, the surfactant is polysorbate 20. In one embodiment, the concentration of the surfactant is about 0.001% to 1%. In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the concentration of the adjuvant is about 0.1% to 1%.

[0057] In one embodiment, the present invention provides a formulation comprising: at least 21 different glycoconjugates; a histidine buffer having a pH in the range of 5.0 to 7.5; sodium chloride; a surfactant; and an adjuvant.

[0058] In one embodiment, the formulation comprises at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different saccharide conjugates. In one embodiment, the formulation is a 24-valent pneumococcal conjugate composition. In one embodiment, the formulation is a 25-valent pneumococcal conjugate composition. In one embodiment, the saccharide conjugate is a pneumococcal polysaccharide-protein conjugate.

[0059] In one embodiment, the saccharide conjugate comprises at least one saccharide conjugate derived from a serotype of Streptococcus pneumoniae selected from the group consisting of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof. In one embodiment, the carrier protein of the one or more saccharide conjugates is a diphtheria cross-reactive substance (CRM). 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a peptidase (SCP) from Streptococcus, or rhizobium avidin protein [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).

[0060] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and the S. pneumoniae serotypes are conjugated to CRMs.197 .

[0061] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 5, and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V, and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.

[0062] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0063] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0064] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0065] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.

[0066] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 .

[0067] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRMs. 197 In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to a CRM. 197 , S. pneumoniae serotype 3 conjugated to SCP.

[0068] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally including saccharide conjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to a CRM. 197 In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 , S. pneumoniae serotype 3 conjugated to SCP.

[0069] In one embodiment, the formulation comprises at least 25 saccharide conjugates, including at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F, and additionally S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F. In one embodiment, at least two of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, at least two of the S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM. 197 In one embodiment, conjugated to a CRM 197 The at least 17 S. pneumoniae serotypes are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0070] In one embodiment, the pneumococcal saccharide conjugate is selected from the group consisting of 197 Streptococcus pneumoniae serotype 1, conjugated to CRM 197 Streptococcus pneumoniae serotype 3, conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0071] In one embodiment, the pneumococcal saccharide conjugate is selected from the group consisting of 197 S. pneumoniae serotype 1, S. pneumoniae serotype 3 conjugated to SCP, S. pneumoniae serotype 3 conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0072] In one embodiment, the total polysaccharide concentration is about 1 to 100 μg / dose. In one embodiment, the concentration of polysaccharide for each serotype is about 1 to 10 μg / dose. In one embodiment, the buffer has a concentration of about 1 to 50 mM. In one embodiment, the sodium chloride has a concentration of about 1 to 300 mM. In one embodiment, the sodium phosphate concentration is about 1 to 50 mM. In one embodiment, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80. In one embodiment, the surfactant is polysorbate 20. In one embodiment, the concentration of the surfactant is about 0.001% to 1%. In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the concentration of the adjuvant is about 0.1% to 1%.

[0073] In one embodiment, the formulation comprises 25 glycoconjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

[0074] In one embodiment, the formulation comprises 25 glycoconjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

[0075] In one embodiment, the formulation comprises 25 glycoconjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

[0076] In one embodiment, the present invention provides a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant to form a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; at time At T2, another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; and wherein the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in the liquid, wherein the measurement head comprises a pulsed near-infrared light source with a wavelength of about 880 nm, and has a synchronous transmission detector at 180° from the light source and a backscattering detector at 45° from the light source, the detectors moving along the height of the flat-bottomed cylindrical glass sample unit, and precipitate data is collected every 20 μm.

[0077] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is about 1 hour to 2 hours. In one embodiment, T2 is about 1 hour to 5 hours. In one embodiment, T2 is about 4 hours. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0078] In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm to 20 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is about 2 mm to 25 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm. In one embodiment, the sedimentation rate of the sedimentation front is less than the peak thickness of 10 mm in about 1 hour and greater than the peak thickness of 18 mm in about 4 hours.

[0079] In one embodiment, the present invention further comprises a time T3, wherein at T3, the sedimentation of the insoluble aluminum phosphate-adsorbed saccharide conjugate is in equilibrium with the liquid phase. In one embodiment, T3 is about 2 hours to 5 hours. In one embodiment, at T3, the peak thickness of the sedimentation front is about 25 mm to 35 mm. In one embodiment, the composition has been allowed to stand for about 1 month. In one embodiment, the composition has been allowed to stand for at least 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe. In one embodiment, wherein after T3, the composition is resuspended using 1 to 10 manual shakings. In one embodiment, after T3, the composition is resuspended using 1 manual shaking. In one embodiment, the composition comprises the formulation previously described.

[0080] In one embodiment, the present invention provides a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant to form a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant settles from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; at time During time T2, another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant settles from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; and wherein the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in the liquid, wherein the measurement head comprises a pulsed near-infrared light source with a wavelength of about 880 nm and has a synchronous transmission detector 180° from the light source and a backscattering detector 45° from the light source, the detectors moving along the height of the flat-bottomed cylindrical glass sample unit, and precipitate data is collected every 20 μm.

[0081] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is about 1 hour to 2 hours. In one embodiment, T2 is about 1 hour to 5 hours. In one embodiment, T2 is about 4 hours. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0082] In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm to 20 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is about 2 mm to 25 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm.

[0083] In one embodiment, the present invention further comprises a time T3, wherein at T3, the sedimentation of the insoluble aluminum phosphate-adsorbed saccharide conjugate is in equilibrium with the liquid phase. In one embodiment, T3 is about 2 hours to 5 hours. In one embodiment, at T3, the peak thickness of the sedimentation front is about 25 mm to 35 mm. In one embodiment, the container has been standing for about 1 month. In one embodiment, the container has been standing for at least 2 weeks. In one embodiment, the container is a syringe. In one embodiment, after T3, the composition is resuspended using 1 to 10 manual shakings. In one embodiment, after T3, the composition is resuspended using 1 manual shaking. In one embodiment, the liquid comprises the formulation previously described. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] Figure 1 Shown are the sedimentation velocities of different vaccine formulations by plotting the peak thickness (also called sedimentation front) as a function of time (hr).

[0085] Figure 2 Shown is the area on the graph (shaded) indicating the difference between the sedimentation curves for the 7 serotype control formulation and the sedimentation curves for the 20 serotype control formulation.

[0086] Figure 3 Shown is the area on the graph (shaded) indicating the difference between the sedimentation curves for the 7 serotype control formulation and the sedimentation curves for the 25 serotype control formulation.

[0087] Figure 4 The sedimentation cake heights for different vaccine formulations are shown.

[0088] Figure 5 Shown are the resuspensions of the different formulations after standing for 3 days or 2 weeks.

[0089] Figure 6 Graphically depicts the number of manual shaking times required to resuspend the test samples in a prefilled syringe (PFS) after storage in the syringe for 2 days, 7 days, and 30 days. The samples tested included samples with and without LiNA-2A (as discussed in Example 6).

[0090] Figure 7Graphically depicts the number of manual shaking times required to resuspend the test samples in a prefilled syringe (PFS) after storage in the syringe at 0, 7, and 30 days. The samples tested included samples with and without LiNA-1 (as discussed in Example 6). DETAILED DESCRIPTION

[0091] The present invention is based on the groundbreaking discovery of a vaccine formulation for a S. pneumoniae vaccine that facilitates the resuspension of particles that settle out of a liquid phase to ensure dosage accuracy and long-term stability.

[0092] Before describing the present compositions and methods, it should be understood that the present invention is not limited to the specific compositions, methods, and experimental conditions described, as such compositions, methods, and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.

[0093] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "the method" includes one or more methods and / or steps of the type described herein that will be apparent to those skilled in the art upon reading this disclosure, and so forth.

[0094] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0095] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the present invention belongs. Although any methods and materials similar or equivalent to the methods and materials described herein can be used in the practice or testing of the present invention, it should be understood that modifications and variations are also encompassed within the spirit and scope of the present invention. Preferred methods and materials are now described.

[0096] Vaccine preparations

[0097] In some embodiments, the vaccine formulation of the present invention comprises one or more of the following immunogens: naturally occurring or artificially produced proteins, recombinant proteins, glycoproteins, peptides, carbohydrates, sugars, nucleic acids, haptens, whole viruses, bacteria, protozoa, or virus-like particles, or conjugates thereof. Exemplary nucleic acids or polynucleotides of vaccine formulations include, but are not limited to, ribonucleic acids (RNA, including mRNA) and deoxyribonucleic acids (DNA). In some embodiments, the vaccine formulation comprises DNA encoding a polypeptide described herein or a fragment thereof. In some embodiments, the vaccine formulation comprises RNA encoding a polypeptide described herein or a fragment thereof. In some embodiments, the vaccine formulation comprises an mRNA polynucleotide encoding a polypeptide described herein or a fragment thereof. In some embodiments, the vaccine formulation comprises a modified RNA molecule (modRNA).

[0098] In some embodiments, the vaccine formulations of the invention comprise a capsular saccharide antigen, optionally wherein the capsular saccharide is conjugated. The vaccine formulations of the invention will typically comprise a conjugated capsular saccharide antigen (also known as a glycoconjugate), wherein the saccharide is derived from a serotype of S. pneumoniae.

[0099] Preferably, the number of S. pneumoniae capsular saccharides is at least 25 different serotypes (or "v", valence, "25v"). In one embodiment, there are 21 different serotypes. In one embodiment, there are 22 different serotypes. In one embodiment, there are 23 different serotypes. In one embodiment, there are 24 different serotypes. In one embodiment, there are 25 different serotypes. In one embodiment, there are 26 different serotypes. In one embodiment, there are 27 different serotypes. In one embodiment, there are 28 different serotypes. In one embodiment, there are 29 different serotypes. In one embodiment, there are 30 different serotypes. In one embodiment, there are 31 different serotypes. In one embodiment, there are 32 different serotypes. In one embodiment, there are 32 different serotypes. In one embodiment, there are 33 different serotypes. In one embodiment, there are 34 different serotypes. In one embodiment, there are 35 different serotypes. The capsular saccharide is conjugated to a carrier protein to form a glycoconjugate as described below.

[0100] In a preferred embodiment, the saccharides are each individually conjugated to a different molecule of a protein carrier (each molecule of the protein carrier is conjugated to only one type of saccharide). In such an embodiment, the capsular saccharides are said to be individually conjugated to a carrier protein.

[0101] For the purposes of the present invention, the term "glycoconjugate" refers to a capsular saccharide that is linked to a carrier protein covalently or via high affinity interactions. In one embodiment, the capsular saccharide is directly linked to the carrier protein. In a second embodiment, the capsular saccharide is linked to the protein via a spacer / linker.

[0102] Carrier protein

[0103] In a preferred embodiment, the carrier protein of the glycoconjugate is selected from the group consisting of: DT (diphtheria toxoid); TT (tetanus toxoid) or fragment C of TT; CRM 197 (a nontoxic but antigenically identical variant of diphtheria toxin); other DT mutants (such as CRM 176 , CRM 228 , CRM 45 (Uchida et al. (1973) J. Biol. Chem. 218: 3838-3844), CRM9, CRM 102 , CRM 103 or CRM 107); and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, ed.: Frankel, Maecel Dekker Inc. (1992); deletion or mutation of Glu-148 to Asp, Gln, or Ser and / or deletion or mutation of Ala 158 to Gly and other mutations disclosed in U.S. Pat. Nos. 4,709,017 and 4,950,740; at least one or more residues Lys 516, Lys 526, Phe 530, and / or Lys Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Pat. No. 5,843,711, pneumolysin (ply) of Streptococcus pneumoniae (Kuo et al. (1995) Infect Immun 63:2706-2713), including ply that has been detoxified in some manner, for example, dPLY-GMBS (WO 2004 / 081515, WO 2006 / 032499) or dPLY-formol; PhtX (including PhtA, PhtB, PhtD, PhtE (the sequences of PhtA, PhtB, PhtD or PhtE are disclosed in WO 00 / 37105 and WO 2006 / 032499); 00 / 39299)) and fusions of Pht proteins, e.g., PhtDE fusions, PhtBE fusions, Pht AE (WO 01 / 98334, WO 03 / 054007, WO 2009 / 000826); OMPC (meningococcal outer membrane protein), which is typically extracted from Neisseria meningitidis serogroup B (EP0372501); PorB (from Neisseria meningitidis serogroup B);meningitidis); PD (Haemophilus influenzae protein D; see, e.g., EP 0 594 610 B) or an immunologically functional equivalent thereof; synthetic peptides ( EP 0 378 881 , EP 0 427 347 ); heat shock proteins ( WO 93 / 17712 , WO 94 / 03208 ); pertussis proteins ( WO 98 / 58668 , EP 0 471 177 ); cytokines, lymphokines, growth factors or hormones ( WO 91 / 01146 ); artificial proteins comprising multiple human CD4+ T cell epitopes of antigens from various pathogenic sources ( Falugi et al. (2001) Eur J Immunol 31 :3816-3824), such as N19 protein ( Baraldoi et al. (2004) Infect Immunol 72:4884-4887) pneumococcal surface protein PspA (WO 02 / 091998), iron uptake protein (WO 01 / 72337), Clostridium difficile toxin A or B (WO 00 / 61761), transferrin binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa ( aeruginosa exotoxin A (particularly a non-toxic mutant thereof, such as exotoxin A with a substitution at glutamic acid 553 (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivative of tuberculin (PPD) can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins, such as cholera toxin (e.g., as described in WO 2004 / 083251), Escherichia coli LT, E. coli ST, and exotoxin A from Pseudomonas aeruginosa. Another suitable carrier protein is C5a peptidase (SCP) from Streptococcus. Another suitable carrier protein is rhizobium avidin protein [aa 45-179J-GGGGSSS-SP1500-AAA-SP0785](CP1). .

[0104] In a preferred embodiment, the carrier protein of the glycoconjugate is independently selected from the group consisting of TT, DT, DT mutants (such as CRM 197), H. influenzae protein D, PhtX, PhtD, PhtDE fusions (particularly those described in WO 01 / 98334 and WO 03 / 054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, toxin A or B of Clostridium difficile, PsaA, C5a peptidase (SCP) from Streptococcus, and biotin-streptavidin.

[0105] In one embodiment, the carrier protein of the glycoconjugate of the present invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the present invention is TT (tetanus toxoid). In one embodiment, the carrier of the glycoprotein is C5a peptidase (SCP) from Streptococcus. In another embodiment, the carrier protein of the glycoconjugate of the present invention is PD (Haemophilus influenzae protein D; see, e.g., EP0594610 B).

[0106] In a preferred embodiment, the capsular saccharide of the invention is conjugated to a CRM 197 Protein. CRM 197 The protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. 197 Produced by Corynebacterium diphtheriae infected with the avirulent bacteriophage β197tox, generated by nitrosoguanidine mutagenesis of virulent coryneform phage β (Uchida et al. (1971) Nature New Biology 233:8-11). CRM 197 The protein has the same molecular weight as diphtheria toxin, but differs from it by a single base change in the structural gene (guanine to adenine). This single base change causes an amino acid substitution in the mature protein (glutamic acid to glycine) and eliminates the toxicity of diphtheria toxin. 197 Proteins are safe and effective T-cell dependent carriers of sugars. About CRM 197 Further details of its production can be found in, for example, US Pat. No. 5,614,382.

[0107] In one embodiment, the capsular saccharide of the invention is conjugated to a CRM 197 Protein or CRM 197 In one embodiment, the capsular saccharide of the present invention is conjugated to a CRM obtained by genetic recombinant E. coli expression. 197 In one embodiment, the capsular saccharides of the present invention are conjugated to the CRM 197In one embodiment, the capsular saccharides of the present invention are conjugated to CRM 197 A chain.

[0108] Thus, in common embodiments, the glycoconjugates of the invention comprise a CRM 197 As a carrier protein in which the capsular polysaccharide is covalently linked to the CRM 197 .

[0109] Capsular sugar

[0110] Throughout the specification, the term "saccharide" may refer to a polysaccharide or an oligosaccharide and includes both. In a common embodiment, the saccharide is a polysaccharide, in particular a Streptococcus pneumoniae capsular polysaccharide.

[0111] Capsular polysaccharides are prepared by standard techniques known to those of ordinary skill in the art.

[0112] In the present invention, capsular polysaccharides can be prepared or derived, for example, from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B of Streptococcus pneumoniae. Typically, capsular polysaccharides are produced by growing each serotype of Streptococcus pneumoniae in culture medium (e.g., soy-based medium) and then preparing the polysaccharide from the bacterial culture. The bacterial strains of Streptococcus pneumoniae used to prepare the respective polysaccharides used in the saccharide conjugates of the present invention can be obtained from established culture collections or clinical samples.

[0113] In one embodiment, the formulation comprises at least 21 different polysaccharides. In one embodiment, the formulation comprises at least 22 different polysaccharides. In one embodiment, the formulation comprises at least 23 different polysaccharides. In one embodiment, the formulation comprises at least 24 different polysaccharides. In one embodiment, the formulation comprises at least 25 different polysaccharides. In one embodiment, the formulation comprises at least 26 different polysaccharides. In one embodiment, the formulation comprises at least 27 different polysaccharides. In one embodiment, the formulation comprises at least 28 different polysaccharides. In one embodiment, the formulation comprises at least 29 different polysaccharides. In one embodiment, the formulation comprises at least 30 different polysaccharides. In one embodiment, the formulation comprises at least 31 different polysaccharides. In one embodiment, the formulation comprises at least 32 different polysaccharides. In one embodiment, the formulation comprises at least 33 different polysaccharides. In one embodiment, the formulation comprises at least 34 different polysaccharides. In one embodiment, the formulation comprises at least 35 different polysaccharides.

[0114] The colony of organism (every kind of Streptococcus pneumoniae serotype) is scaled up to inoculation bottle conventionally from inoculation bottle and is passed down from generation to generation through one or more seed fermentation tanks of volume increment until reaching production scale fermentation volume.At the end of the growth cycle, by cell lysis, then the results lysate nutrient solution is used for downstream (purification) processing (referring to, for example, WO 2006 / 110381, WO 2008 / 118752 and U.S. Patent Application Publication No. 2006 / 0228380, No. 2006 / 0228381, No. 2008 / 0102498 and No. 2008 / 0286838).

[0115] Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752).

[0116] The purified polysaccharide can be activated (eg, chemically activated) to render it reactive (eg, with an eTEC spacer) and then incorporated into a glycoconjugate of the invention, as further described herein.

[0117] The S. pneumoniae capsular polysaccharide comprises repeating oligosaccharide units which may contain up to 8 sugar residues.

[0118] In one embodiment, the capsular saccharide of the invention may be one oligosaccharide unit or shorter than the natural length sugar chain of repeating oligosaccharide units.In one embodiment, the capsular saccharide of the invention is one repeating oligosaccharide unit of the relevant serotype.

[0119] In one embodiment, the capsular saccharide of the invention may be an oligosaccharide. Oligosaccharides have a small number of repeating units (usually 5 to 15 repeating units) and are usually derived synthetically or by hydrolysis of a polysaccharide.

[0120] However, preferably, the capsular saccharides of the present invention and the capsular saccharides in the vaccine formulations of the present invention are polysaccharides. High molecular weight capsular polysaccharides can induce certain antibody immune responses due to the presence of epitopes on the surface of the antigen. It is preferably contemplated that the high molecular weight capsular polysaccharides can be isolated and purified for use in the conjugates, compositions, and methods of the present invention.

[0121] In some embodiments, the purified polysaccharide has a molecular weight of between 10 kDa and 4,000 kDa prior to conjugation. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 4,000 kDa. In another such embodiment, the polysaccharide has a molecular weight of between 50 kDa and 3,500 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 3,000 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 2,500 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 1,750 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 1,500 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 1,250 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 1,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 3,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 3,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 2,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,250 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 1,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 100 kDa and 500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 3,500 kDa.In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 3,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 2,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 2,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,500 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,250 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 1,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 750 kDa. In other such embodiments, the polysaccharide has a molecular weight between 200 kDa and 500 kDa. Any integer within any of the above ranges is contemplated as an embodiment of the present invention.

[0122] The polysaccharide may become slightly reduced in size during normal purification procedures. In addition, as described herein, the polysaccharide may be subjected to sizing techniques prior to conjugation. Mechanical or chemical sizing may be employed. Chemical hydrolysis may be performed using acetic acid. Mechanical sizing may be performed using high pressure homogenization shearing. The molecular weight ranges mentioned above refer to the molecular weight ranges of the purified polysaccharide prior to conjugation (e.g., prior to activation).

[0123] In preferred embodiments, the purified polysaccharide is a capsular polysaccharide from serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F or 35B of S. pneumoniae, wherein the capsular polysaccharide has a molecular weight falling within one of the molecular weight ranges as described above.

[0124] As used herein, the term "molecular weight" of a polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) in combination with a multi-angle laser light scattering detector (MALLS).

[0125] In some embodiments, the saccharides of the invention from serotypes 9V, 18C, 11A, 15B, 22F and / or 33F of Streptococcus pneumoniae are O-acetylated. In some embodiments, the saccharides of the invention from serotypes 9V, 11A, 15B, 22F and / or 33F of Streptococcus pneumoniae are O-acetylated.

[0126] The purified polysaccharides described herein are chemically activated to enable the sugar to react with the carrier protein.These S. pneumoniae conjugates are prepared by separate processes and formulated into single dose formulations, as described below and briefly in the art.

[0127] Polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F

[0128] Capsular saccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F can be prepared by standard techniques known to those skilled in the art (see, for example, WO 2006 / 110381). Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture; at the end of the growth period, lysing the cells and harvesting the lysate broth for downstream (purification) processing. Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the present invention.

[0129] Polysaccharide from Streptococcus pneumoniae serotype 8

[0130] The polysaccharide repeating unit of serotype 8 consists of a linear tetrasaccharide unit with one glucuronic acid (GlcpA), two glucopyranoses (Glcp), and one galactopyranose (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787-2793). All four monosaccharides are linked via 1,4-linkages.

[0131] Serotype 8 saccharides can be obtained directly from bacteria using isolation procedures known to those of ordinary skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). In addition, they can be produced using synthetic methods.

[0132] Serotype 8 S. pneumoniae strains can be obtained from established culture collections, such as, for example, the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or clinical specimens.

[0133] Polysaccharide from Streptococcus pneumoniae serotype 10A

[0134] The polysaccharide repeating unit of serotype 10A consists of two galactofuranose (Gal f ), three galactopyranose (Gal p ), an N-acetylgalactosamine (Gal p NAc) and a main chain of pyridoxine phosphate branched chain hexasaccharide repeating unit (Jones, C. (2005) Carbohydrate Research 269 (1): 175-181). In the β-GalpNAc part, there are two branched chain monosaccharides (β-3-Galp and β-6-Galf).

[0135] Serotype 10A saccharides can be obtained directly from bacteria using isolation procedures known to those of ordinary skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). In addition, they can be produced using synthetic methods.

[0136] Serotype 10A S. pneumoniae strains can be obtained from established culture collections, such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA), or from clinical specimens.

[0137] Polysaccharide from Streptococcus pneumoniae serotype 11A

[0138] The polysaccharide repeating unit of serotype 11A consists of a linear tetrasaccharide backbone (two galactopyranose (Gal p ) and two glucopyranose (Glc p)) and side chain phosphoglycerol composition (Richards et al. (1988) Adv. Exp. Med. Biol. 228: 595-597), as shown. The polysaccharide is O-acetylated at multiple positions, and based on data reported in the literature (Calix et al. (2011) J Bacteriol. 193 (19): 5271-5278), the total amount of O-acetylation in 11A polysaccharide is approximately 2.6 O-acetyl groups per polysaccharide repeat unit.

[0139] Serotype 11A saccharides can be obtained directly from bacteria using isolation procedures known to those of ordinary skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). In addition, they can be produced using synthetic methods.

[0140] Serotype 11A S. pneumoniae strains can be obtained from established culture collections, such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA), or from clinical specimens.

[0141] Polysaccharide from Streptococcus pneumoniae serotype 12F

[0142] The polysaccharide repeating unit of serotype 12F consists of a linear trisaccharide backbone (one N-acetylfucosamine (Fuc p NAc), an N-acetylgalactosamine (Gal p NAc) and an N-acetylmannuronic acid (Man p NAcA)) with two branched chains (in Fuc p The side chain α-galactopyranose (Gal p ) and in Man p α-Glc linked to C3 of NacA p -(1→2)-α-Glc p It is composed of disaccharide branches) (Leontein et al. (1983) Carbohydrate Research 114(2):257-266).

[0143] Serotype 12F S. pneumoniae strains can be obtained from established culture collections, such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA), or from clinical specimens.

[0144] Polysaccharide from Streptococcus pneumoniae serotype 15A

[0145] Capsular saccharides from Streptococcus pneumoniae serotype 15A can be prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2019 / 139692). Isolates of Streptococcus pneumoniae serotype 15A are available from the American Type Culture Collection (Manassas). Capsular polysaccharides can be produced by growing each Streptococcus pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed and the lysate culture fluid is harvested for downstream (purification) processing. Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharide can be further processed as further described herein to prepare the glycoconjugates of the present invention.

[0146] Polysaccharide from Streptococcus pneumoniae serotype 15B

[0147] The polysaccharide repeating unit of serotype 15B consists of a branched trisaccharide backbone (one N-acetylglucosamine (Glc p NAc), a galactopyranose (Gal p ) and a glucopyranose (Glc p )) and connected to Glc p αGal on the C4 hydroxyl group of Nac p -βGal p Disaccharide branch chain. Glycerol phosphate is connected to βGal of disaccharide branch chain. p The C3 hydroxyl group of the residue (Jones et al. (2005) Carbohydrate Research 340(3):403-409). The capsular polysaccharide from serotype 15C has the same backbone structure as serotype 15B, but lacks O-acetylation.

[0148] Serotype 15B polysaccharide can be obtained directly from bacteria using isolation procedures known to those of ordinary skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). It can also be produced using synthetic methods known to those of skill in the art.

[0149] Serotype 15B S. pneumoniae strains can be obtained from established culture collections, such as, for example, the American Type Culture Collection (ATCC, Manassas, VA USA) (e.g., strain deposited as ATCC 10354) or the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA USA) or clinical specimens.

[0150] Polysaccharide from Streptococcus pneumoniae serotype 22F

[0151] The polysaccharide repeating unit of serotype 22F consists of a branched pentasaccharide backbone (one glucuronic acid (Glc p A), a pyranose glucose (Glc p ), a galactofuranose (Gal f ) and two rhamnopyranose (Rha p )) and linked to βRha p C3 hydroxyl group of αGlc p Branched chain composition (Richards et al. (1989) Canadian Journal of Chemistry 67(6):1038-1050). p About 80% of the C2 hydroxyl groups of the residues are O-acetylated.

[0152] Serotype 22F polysaccharide can be obtained directly from bacteria using isolation procedures known to those of ordinary skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO 2008 / 118752). In addition, it can be produced using synthetic methods.

[0153] Serotype 22F S. pneumoniae strains can be obtained from established culture collections, such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA), or from clinical specimens.

[0154] Polysaccharides from Streptococcus pneumoniae serotypes 23A and 23B

[0155] Capsular saccharides from Streptococcus pneumoniae serotypes 23A and 23B can be prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2019 / 050814). Isolates of Streptococcus pneumoniae serotype 23A are available from Merck Culture Collection, and isolates of serotype 23B are available from the Centers for Disease Control and Prevention (Atlanta, GA). Capsular polysaccharides can be produced by growing each Streptococcus pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed and the lysate culture fluid is harvested for downstream (purification) processing. Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharide can be further processed as further described herein to prepare the glycoconjugates of the present invention.

[0156] Polysaccharide from Streptococcus pneumoniae serotype 24F

[0157] Capsular saccharides from Streptococcus pneumoniae serotype 24F can be prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2019 / 050815). Isolates of Streptococcus pneumoniae serotype 24F are available from the Merck Culture Collection. Capsular polysaccharides can be produced by growing each Streptococcus pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed and the lysate culture fluid is harvested for downstream (purification) processing. Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharide can be further processed as further described herein to prepare the glycoconjugates of the present invention.

[0158] Polysaccharide from Streptococcus pneumoniae serotype 33F

[0159] The polysaccharide repeating unit of serotype 33F consists of a branched pentasaccharide backbone (two galactopyranose (Gal p ), two galactofuranose (Gal f ) and a glucopyranose (Glc p )) and αGal linked to the main chain p The C2 hydroxyl group of the terminal αGal p composition (Lemercinier et al. (2006) Carbohydrate Research 341(1):68-74). It has been reported in the literature that the main chain 3-β-Gal f The C2 hydroxyl group of the residue is O-acetylated.

[0160] Serotype 33F polysaccharide can be obtained directly from bacteria using isolation procedures known to those of ordinary skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). In addition, it can be produced using synthetic methods.

[0161] Serotype 33F S. pneumoniae strains can be obtained from established culture collections, such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or from clinical specimens.

[0162] Polysaccharide from Streptococcus pneumoniae serotype 35B

[0163] Capsular saccharides from Streptococcus pneumoniae serotype 35B can be prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2020 / 247299). Isolates of Streptococcus pneumoniae serotype 35B are available from the Merck Culture Collection. Capsular polysaccharides can be produced by growing each Streptococcus pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed and the lysate culture fluid is harvested for downstream (purification) processing. Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharide can be further processed as further described herein to prepare the glycoconjugates of the present invention.

[0164] Glycoconjugates

[0165] The purified saccharides are chemically activated to enable the saccharides to react with the carrier protein (ie, activated saccharides). Once activated, each capsular saccharide is individually conjugated to the carrier protein to form a glycoconjugate.

[0166] In the present invention, the saccharide conjugates can be prepared or derived, for example, from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B of S. pneumoniae.

[0167] In one embodiment, the formulation comprises at least 21 different glycoconjugates. In one embodiment, the formulation comprises at least 22 different glycoconjugates. In one embodiment, the formulation comprises at least 23 different glycoconjugates. In one embodiment, the formulation comprises at least 24 different glycoconjugates. In one embodiment, the formulation comprises at least 25 different glycoconjugates. In one embodiment, the formulation comprises at least 26 different glycoconjugates. In one embodiment, the formulation comprises at least 27 different glycoconjugates. In one embodiment, the formulation comprises at least 28 different glycoconjugates. In one embodiment, the formulation comprises at least 29 different glycoconjugates. In one embodiment, the formulation comprises at least 30 different glycoconjugates. In one embodiment, the formulation comprises at least 31 different glycoconjugates. In one embodiment, the formulation comprises at least 32 different glycoconjugates. In one embodiment, the formulation comprises at least 33 different glycoconjugates. In one embodiment, the formulation comprises at least 34 different glycoconjugates. In one embodiment, the formulation comprises at least 35 different glycoconjugates.

[0168] In one embodiment, each capsular saccharide is conjugated to the same carrier protein.Chemical activation of the saccharide and subsequent conjugation to the carrier protein can be achieved by activation and conjugation methods known in the art and described briefly below.

[0169] Glycoconjugates from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F

[0170] Capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of S. pneumoniae are prepared by standard techniques known to those of ordinary skill in the art (see, e.g., WO 2006 / 110381, WO 2008 / 118752, WO 2006 / 110352, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0171] In a preferred embodiment, at least one of the capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of S. pneumoniae is conjugated to a carrier protein by reductive amination, such as described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 0231340, 2007 / 0184071, and 2007 / 0184072, WO 2006 / 110381, WO 2008 / 079653, and WO 2008 / 143709. In a preferred embodiment, the capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of S. pneumoniae are all conjugated to a carrier protein by reductive amination.

[0172] Glycoconjugates from Streptococcus pneumoniae serotypes 8, 11A, 15B, and 22F

[0173] In one embodiment, serotype 8, 11A, 15B and 22F saccharide conjugates are obtained by activating the polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate. The activated polysaccharide can be coupled directly or via a spacer (linker) group to an amino group on a carrier protein. For example, the spacer can be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA or SBAP). Preferably, the cyanate (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is conjugated to the carrier protein using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0174] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation can involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This can involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.

[0175] In a preferred embodiment, the serotype 8, 11A, 15B and 22F glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from the vicinal diols in the individual hexasaccharide units, and (2) the reaction of the activated polysaccharide with a carrier protein (e.g., CRM). 197 Methods for preparing saccharide conjugates from serotypes 8, 11A, 15B and 22F of Streptococcus pneumoniae are known and described in WO2015110941.

[0176] Glycoconjugates from Streptococcus pneumoniae serotype 12F

[0177] In the saccharide conjugates from Streptococcus pneumoniae serotype 12F of the present invention, the saccharide is selected from polysaccharides and oligosaccharides, and the carrier protein is selected from any suitable carrier as described herein or known to those skilled in the art. In some preferred embodiments, the saccharide is a polysaccharide from serotype 12F Streptococcus pneumoniae.

[0178] In one embodiment, a saccharide conjugate from Streptococcus pneumoniae serotype 12F is prepared using CDAP. The polysaccharide is activated using 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled to a carrier protein (preferably CRM) directly or via a spacer (linker) group. 197). For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimidate, SIB, SIAB, sulfo-SIAB, SIA or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is conjugated to the carrier protein (e.g., CRM) via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. 197 ).

[0179] Other conjugation techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation can involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This can involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.

[0180] In one embodiment, capsular polysaccharide from serotype 12F S. pneumoniae is conjugated to a carrier protein via reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate. Methods for preparing glycoconjugates from serotype 12F S. pneumoniae are known and described in WO2015110941.

[0181] Glycoconjugates from Streptococcus pneumoniae serotype 15A

[0182] Capsular polysaccharide from serotype 15A of Streptococcus pneumoniae is prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2019 / 139692).

[0183] In a preferred embodiment, the serotype 15A glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from the vicinal diols in the individual hexasaccharide units, and (2) the reaction of the activated polysaccharide with a carrier protein (e.g., CRM). 197) to form the conjugate. Methods for preparing saccharide conjugates from serotype 15A Streptococcus pneumoniae are known and described in WO 2019 / 139692.

[0184] Glycoconjugates from Streptococcus pneumoniae serotypes 23A and 23B

[0185] Capsular polysaccharides from serotypes 23A and 23B of Streptococcus pneumoniae are prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2019 / 050814).

[0186] In a preferred embodiment, the serotype 23A and 23B glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from the vicinal diols in the individual hexasaccharide units, and (2) the reaction of the activated polysaccharide with a carrier protein (e.g., CRM). 197 ) to form the conjugate. Methods for preparing saccharide conjugates from serotypes 23A, 23B and 24F S. pneumoniae are known and described in WO 2019 / 050814.

[0187] Glycoconjugates from Streptococcus pneumoniae serotype 24F

[0188] Capsular polysaccharide from serotype 24F of Streptococcus pneumoniae is prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2019 / 050815).

[0189] In a preferred embodiment, the serotype 24F glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from the vicinal diols in the individual hexasaccharide units, and (2) the reaction of the activated polysaccharide with a carrier protein (e.g., CRM). 197 ) to form the conjugate. Methods for preparing saccharide conjugates from serotype 24F Streptococcus pneumoniae are known and described in WO 2019 / 050815.

[0190] Glycoconjugates from Streptococcus pneumoniae serotype 33F

[0191] In one embodiment, serotype 33F saccharide conjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate. The activated polysaccharide can be coupled to the amino group on the carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reacting with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA or SBAP). Preferably, cyanate (optionally, prepared chemically by CDAP) is coupled to hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derived sugar is conjugated to the carrier protein using carbodiimide (e.g., EDAC or EDC) chemistry via the carboxyl group on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0192] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation can involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This can involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.

[0193] In certain embodiments, the serotype 33F glycoconjugates of the present invention are prepared using reductive amination. In this embodiment, the serotype 33F glycoconjugates of the present invention can be prepared using reductive amination in an aqueous phase (RAC / aqueous solution). Reductive amination in an aqueous phase has been successfully used to produce a conjugate vaccine for Streptococcus pneumoniae (see, for example, WO 2006 / 110381). However, preferably, when reductive amination is used, the serotype 33F glycoconjugate is prepared via reductive amination in DMSO (RAC / DMSO). Given the challenges associated with retaining O-acetyl functional groups using the RAC / aqueous solution process, reductive amination in DMSO is preferred. RAC / DMSO has been successfully used to produce a conjugate vaccine for Streptococcus pneumoniae (see, for example, WO 2006 / 110381).

[0194] In a preferred embodiment, the serotype 33F glycoconjugates of the invention are prepared using eTEC conjugation (hereinafter "serotype 33F eTEC-linked glycoconjugates"), such as described in Examples 1, 2 and 3 and WO 2014 / 027302.

[0195] Glycoconjugates from Streptococcus pneumoniae serotype 35B

[0196] Capsular polysaccharide from serotype 35B of Streptococcus pneumoniae is prepared by standard techniques known to those of ordinary skill in the art (see, for example, WO 2020 / 247299).

[0197] In a preferred embodiment, the serotype 35B glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from the vicinal diols in the individual hexasaccharide units, and (2) the reaction of the activated polysaccharide with a carrier protein (e.g., CRM). 197 ) to form the conjugate. Methods for preparing saccharide conjugates from serotype 35B Streptococcus pneumoniae are known and described in WO 2020 / 247299.

[0198] Combinations of glycoconjugates

[0199] In one embodiment, the vaccine formulation of the invention comprises any one or a combination of glycoconjugates disclosed herein.

[0200] In one embodiment, the formulation comprises at least 25 glycoconjugates. In one embodiment, the formulation comprises at least 21 glycoconjugates. In one embodiment, the formulation comprises at least 22 glycoconjugates. In one embodiment, the formulation comprises at least 23 glycoconjugates. In one embodiment, the formulation comprises at least 24 glycoconjugates. In one embodiment, the formulation comprises at least 25 glycoconjugates. In one embodiment, the formulation comprises at least 26 glycoconjugates. In one embodiment, the formulation comprises at least 27 glycoconjugates. In one embodiment, the formulation comprises at least 28 glycoconjugates. In one embodiment, the formulation comprises at least 29 glycoconjugates. In one embodiment, the formulation comprises at least 30 glycoconjugates. In one embodiment, the formulation comprises at least 31 glycoconjugates. In one embodiment, the formulation comprises at least 32 glycoconjugates. In one embodiment, the formulation comprises at least 33 glycoconjugates. In one embodiment, the formulation comprises at least 34 glycoconjugates. In one embodiment, the formulation comprises at least 35 glycoconjugates.

[0201] In one embodiment, the formulation of the invention comprises saccharide conjugates derived from at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.

[0202] In one embodiment, the formulation of the invention comprises glycoconjugates derived from at least S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F.

[0203] In one embodiment, the formulation of the invention comprises glycoconjugates derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 33F.

[0204] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F.

[0205] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F.

[0206] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 3, 5, 4, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0207] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F.

[0208] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F.

[0209] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 24F, 33F, and 35B.

[0210] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0211] In one embodiment, the formulation of the invention comprises a glycoconjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B.

[0212] In one embodiment, the formulation of the present invention comprises at least one saccharide conjugate derived from Streptococcus pneumoniae serotype 1, saccharide conjugates of Streptococcus pneumoniae serotype 3, saccharide conjugates of Streptococcus pneumoniae serotype 4, saccharide conjugates of Streptococcus pneumoniae serotype 5, saccharide conjugates of Streptococcus pneumoniae serotype 6A, saccharide conjugates of Streptococcus pneumoniae serotype 6B, saccharide conjugates of Streptococcus pneumoniae serotype 7F, saccharide conjugates of Streptococcus pneumoniae serotype 8, saccharide conjugates of Streptococcus pneumoniae serotype 9V, saccharide conjugates of Streptococcus pneumoniae serotype 10A, saccharide conjugates of Streptococcus pneumoniae serotype 11A, saccharide conjugates of Streptococcus pneumoniae serotype 12F, saccharide conjugates of Streptococcus pneumoniae serotype 1 Saccharide conjugates of Streptococcus pneumoniae serotype 14, saccharide conjugates of Streptococcus pneumoniae serotype 15A, saccharide conjugates of Streptococcus pneumoniae serotype 15B, saccharide conjugates of Streptococcus pneumoniae serotype 18C, saccharide conjugates of Streptococcus pneumoniae serotype 19A, saccharide conjugates of Streptococcus pneumoniae serotype 19F, saccharide conjugates of Streptococcus pneumoniae serotype 22F, saccharide conjugates of Streptococcus pneumoniae serotype 23A, saccharide conjugates of Streptococcus pneumoniae serotype 23B, saccharide conjugates of Streptococcus pneumoniae serotype 23F, saccharide conjugates of Streptococcus pneumoniae serotype 24F, saccharide conjugates of Streptococcus pneumoniae serotype 33F, saccharide conjugates of Streptococcus pneumoniae serotype 35B, and combinations thereof.

[0213] In one embodiment, the formulation comprises a saccharide conjugate derived from Streptococcus pneumoniae serotype 1, a saccharide conjugate of Streptococcus pneumoniae serotype 3, a saccharide conjugate of Streptococcus pneumoniae serotype 4, a saccharide conjugate of Streptococcus pneumoniae serotype 5, a saccharide conjugate of Streptococcus pneumoniae serotype 6A, a saccharide conjugate of Streptococcus pneumoniae serotype 6B, a saccharide conjugate of Streptococcus pneumoniae serotype 7F, a saccharide conjugate of Streptococcus pneumoniae serotype 8, a saccharide conjugate of Streptococcus pneumoniae serotype 9V, a saccharide conjugate of Streptococcus pneumoniae serotype 10A, a saccharide conjugate of Streptococcus pneumoniae serotype 11A, a saccharide conjugate of Streptococcus pneumoniae serotype 12F, a saccharide conjugate of Streptococcus pneumoniae serotype 12B, a saccharide conjugate of Streptococcus pneumoniae serotype 10A, a saccharide conjugate of Streptococcus pneumoniae serotype 11B, a saccharide conjugate of Streptococcus pneumoniae serotype 12C, a saccharide conjugate of Streptococcus pneumoniae serotype 12D, a saccharide conjugate of Streptococcus pneumoniae serotype 12A, a saccharide conjugate of Streptococcus pneumoniae serotype 12B, a saccharide conjugate of Streptococcus pneumoniae serotype 1 serotype 14, saccharide conjugates of Streptococcus pneumoniae serotype 15A, saccharide conjugates of Streptococcus pneumoniae serotype 15B, saccharide conjugates of Streptococcus pneumoniae serotype 18C, saccharide conjugates of Streptococcus pneumoniae serotype 19A, saccharide conjugates of Streptococcus pneumoniae serotype 19F, saccharide conjugates of Streptococcus pneumoniae serotype 22F, saccharide conjugates of Streptococcus pneumoniae serotype 23A, saccharide conjugates of Streptococcus pneumoniae serotype 23B, saccharide conjugates of Streptococcus pneumoniae serotype 23F, saccharide conjugates of Streptococcus pneumoniae serotype 24F, saccharide conjugates of Streptococcus pneumoniae serotype 33F, and saccharide conjugates of Streptococcus pneumoniae serotype 35B.

[0214] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and the saccharide conjugate is conjugated to a CRM. 197 .

[0215] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F. In one embodiment, the saccharide conjugate of S. pneumoniae serotypes 1, 4, 5, 7F, 9V and / or 23F is conjugated to PD, the saccharide conjugate of S. pneumoniae serotype 18C is conjugated to TT, and the saccharide conjugate of S. pneumoniae serotype 19F is conjugated to DT.

[0216] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 33F, and the saccharide conjugate of the S. pneumoniae serotype is conjugated to a CRM. 197 .

[0217] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F, and the saccharide conjugate of the S. pneumoniae serotype is conjugated to a CRM.197 .

[0218] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F, and the saccharide conjugate of the S. pneumoniae serotype is conjugated to a CRM. 197 .

[0219] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F, and the saccharide conjugate of the S. pneumoniae serotype is conjugated to a CRM. 197 .

[0220] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F. In one embodiment, the saccharide conjugate of the S. pneumoniae serotype is conjugated to a CRM. 197 In one embodiment, saccharide conjugates of S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 , glycoconjugates of Streptococcus pneumoniae serotype 3 conjugated to SCP.

[0221] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23B, 24F, 33F and 35B. In one embodiment, the saccharide conjugate of the S. pneumoniae serotype is conjugated to a CRM. 197 In one embodiment, saccharide conjugates of S. pneumoniae serotypes 1, 2, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 , glycoconjugates of Streptococcus pneumoniae serotype 3 conjugated to SCP.

[0222] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 24F, 33F and 35B. In one embodiment, at least two of the saccharide conjugates of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, at least two of the saccharide conjugates of the S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B and 22F. In one embodiment, at least 17 of the saccharide conjugates of the S. pneumoniae serotypes are conjugated to CRM. 197 In one embodiment, at least 17 conjugated to a CRM 197 The saccharide conjugate of a serotype of Streptococcus pneumoniae is selected from the group consisting of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0223] In one embodiment, the formulation of the invention comprises a saccharide conjugate derived from at least S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the saccharide conjugate of S. pneumoniae serotypes 1, 4, 5, 7F, 9V and / or 23F is conjugated to PD, the saccharide conjugate of S. pneumoniae serotype 18C is conjugated to TT, and the saccharide conjugate of S. pneumoniae serotype 19F is conjugated to DT.

[0224] In one embodiment, the formulation of the invention comprises at least one 197 Streptococcus pneumoniae serotype 1, conjugated to CRM 197 Streptococcus pneumoniae serotype 3, conjugated to CRM 197 of Streptococcus pneumoniae serotype 4, conjugated to CRM 197 of S. pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 of Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 Saccharide conjugates of Streptococcus pneumoniae serotype 35B and combinations thereof.

[0225] Preferably, all glycoconjugates of the above vaccine formulations are each conjugated to a carrier protein.

[0226] dose

[0227] The amount of glycoconjugate in each dose is selected to be an amount that induces an immunoprotective response without the significant adverse side effects of typical vaccines. This amount will vary depending on the specific immunogen employed and how it is presented.

[0228] Amount of glycoconjugate

[0229] The amount of a particular saccharide conjugate in a vaccine formulation can be calculated based on the total polysaccharide for that conjugate (conjugated and unconjugated). For example, a saccharide conjugate with 20% free polysaccharide will have approximately 80 μg of conjugated polysaccharide and approximately 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. The amount of saccharide conjugate may vary depending on the S. pneumoniae serotype. Sugar concentrations can be determined by uronic acid analysis.

[0230] The "immunogenic amount" of the different polysaccharide components in the vaccine formulation may vary and each may contain about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 15 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg or about 100 μg of any particular polysaccharide antigen.

[0231] Generally, each dose will contain 0.1 μg to 100 μg of polysaccharide of a given serotype, specifically 0.5 μg to 20 μg, more specifically 1.0 μg to 10 μg, even more specifically 2.0 μg to 5.0 μg.Any integer within any of the above ranges is contemplated as an embodiment of the invention.

[0232] In one embodiment, each dose will contain about 1.0 μg to about 6.0 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 1.5 μg to about 5.0 μg of polysaccharide of each specific glycoconjugate. In a preferred embodiment, each dose will contain about 2.0 μg to about 4.0 μg of polysaccharide of each specific glycoconjugate. In a more preferred embodiment, each dose will contain about 2.0 μg to about 3.0 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 1.0 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 1.2 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 1.4 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 1.6 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 1.8 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 2.0 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 2.2 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 2.4 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 2.6 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 2.8 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 3.0 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 3.2 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 3.4 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 3.6 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 3.8 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 4.0 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 4.2 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 4.4 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 4.6 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 4.8 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 5.0 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 5.2 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 5.4 μg of polysaccharide of each specific glycoconjugate.In one embodiment, each dose will contain about 5.6 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 5.8 μg of polysaccharide of each specific glycoconjugate. In one embodiment, each dose will contain about 6.0 μg of polysaccharide of each specific glycoconjugate.

[0233] In one embodiment, each dose will contain from about 1.0 μg to about 3.0 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain from about 1.5 μg to about 3.0 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In preferred embodiments, each dose will contain from about 2.0 μg to about 3.0 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In more preferred embodiments, each dose will contain from about 2.5 μg to about 3.0 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 1.0 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 1.1 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 1.2 μg of a polysaccharide from a glycoconjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose will contain about 1.3 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 1.4 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 1.5 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose will contain about 1.6 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose will contain about 1.7 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 1.8 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 1.9 μg of a polysaccharide from a glycoconjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose will contain about 2.0 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 2.1 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 2.2 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose will contain about 2.3 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose will contain about 2.4 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 2.5 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 2.6 μg of a polysaccharide from a glycoconjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose will contain about 2.7 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose will contain about 2.8 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose will contain about 2.9 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B. In one embodiment, each dose will contain about 3.0 μg of a polysaccharide from a saccharide conjugate of S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and / or 35B.

[0234] Carrier amount

[0235] Generally, each dose will contain 10 μg to 150 μg of carrier protein, specifically 15 μg to 100 μg of carrier protein, more specifically 25 μg to 75 μg of carrier protein, even more specifically 50 μg to 70 μg of carrier protein. In one embodiment, the carrier protein is CRM 197 In one embodiment, the carrier protein is SCP.

[0236] In one embodiment, each dose will contain about 25 μg of carrier protein. In one embodiment, each dose will contain about 26 μg of carrier protein. In one embodiment, each dose will contain about 27 μg of carrier protein. In one embodiment, each dose will contain about 28 μg of carrier protein. In one embodiment, each dose will contain about 29 μg of carrier protein. In one embodiment, each dose will contain about 30 μg of carrier protein. In one embodiment, each dose will contain about 31 μg of carrier protein. In one embodiment, each dose will contain about 32 μg of carrier protein. In one embodiment, each dose will contain about 33 μg of carrier protein. In one embodiment, each dose will contain about 34 μg of carrier protein. In one embodiment, each dose will contain about 35 μg of carrier protein. In one embodiment, each dose will contain about 36 μg of carrier protein. In one embodiment, each dose will contain about 37 μg of carrier protein. In one embodiment, each dose will contain about 38 μg of carrier protein. In one embodiment, each dose will contain about 39 μg of carrier protein. In one embodiment, each dose will contain about 40 μg of carrier protein. In one embodiment, each dose will contain about 41 μg of carrier protein. In one embodiment, each dose will contain about 42 μg of carrier protein. In one embodiment, each dose will contain about 43 μg of carrier protein. In one embodiment, each dose will contain about 44 μg of carrier protein. In one embodiment, each dose will contain about 45 μg of carrier protein. In one embodiment, each dose will contain about 46 μg of carrier protein. In one embodiment, each dose will contain about 47 μg of carrier protein. In one embodiment, each dose will contain about 48 μg of carrier protein. In one embodiment, each dose will contain about 49 μg of carrier protein. In one embodiment, each dose will contain about 50 μg of carrier protein. In one embodiment, each dose will contain about 51 μg of carrier protein. In one embodiment, each dose will contain about 52 μg of carrier protein. In one embodiment, each dose will contain about 53 μg of carrier protein. In one embodiment, each dose will contain about 54 μg of carrier protein. In one embodiment, each dose will contain about 55 μg of carrier protein. In one embodiment, each dose will contain about 56 μg of carrier protein. In one embodiment, each dose will contain about 57 μg of carrier protein. In one embodiment, each dose will contain about 58 μg of carrier protein. In one embodiment, each dose will contain about 59 μg of carrier protein. In one embodiment, each dose will contain about 60 μg of carrier protein. In one embodiment, each dose will contain about 61 μg of carrier protein. In one embodiment, each dose will contain about 62 μg of carrier protein.In one embodiment, each dose will contain about 63 μg of carrier protein. In one embodiment, each dose will contain about 64 μg of carrier protein. In one embodiment, each dose will contain about 65 μg of carrier protein. In one embodiment, each dose will contain about 66 μg of carrier protein. In one embodiment, each dose will contain about 67 μg of carrier protein. In one embodiment, each dose will contain about 68 μg of carrier protein. In one embodiment, each dose will contain about 69 μg of carrier protein. In one embodiment, each dose will contain about 70 μg of carrier protein. In one embodiment, each dose will contain about 71 μg of carrier protein. In one embodiment, each dose will contain about 72 μg of carrier protein. In one embodiment, each dose will contain about 73 μg of carrier protein. In one embodiment, each dose will contain about 74 μg of carrier protein. In one embodiment, each dose will contain about 75 μg of carrier protein.

[0237] In one embodiment, each dose will contain between about 60 μg and 70 μg of carrier protein.

[0238] Additional antigens

[0239] In some embodiments, the vaccine formulations disclosed herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more antigens. In some embodiments, the vaccine formulation comprises more than one antigen that is specific for a particular viral or bacterial species. In a specific embodiment, the vaccine formulation comprises more than one antigen that is specific for Streptococcus pneumoniae. In other embodiments, the vaccine formulation comprises antigens that are specific for a combination of two or more bacterial species. In other embodiments, the vaccine formulation comprises antigens that are specific for a combination of two or more viral species. In some embodiments, the vaccine formulation comprises antigens that are specific for a combination of at least one viral species and at least one bacterial species.

[0240] In some embodiments, the selected antigens are specific for varicella or shingles, human respiratory syncytial virus infection (RSV), cytomegalovirus infection (CMV), human metapneumovirus, human parainfluenza virus type 1 or type 3, Lyme disease, Streptococcus pneumoniae, Clostridium difficile, coronavirus, Escherichia coli, Klebsiella pneumoniae, influenza, HIV-1, hepatitis A, hepatitis B, human papillomavirus, meningococcal meningitis A, meningococcal meningitis B, meningococcal meningitis C, meningococcal meningitis W, meningococcal meningitis Y, tetanus, diphtheria, pertussis, poliomyelitis, Haemophilus influenzae type b, dengue, hand, foot and mouth disease, typhoid fever, Streptococcus pneumoniae, Japanese encephalitis virus, anthrax, herpes zoster, malaria, norovirus, or cancer.

[0241] The vaccine formulation of the present invention comprises conjugated pneumococcal saccharide antigens (glycoconjugates). It may also further comprise antigens from other pathogens, in particular from bacteria and / or viruses. Preferred additional antigens are selected from the group consisting of: diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P) (which is usually cell-free (Pa)), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular saccharide (Hib), and inactivated poliovirus (IPV).

[0242] In one embodiment, the vaccine formulation of the present invention comprises DT-Pa. In one embodiment, the vaccine formulation of the present invention comprises DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HbsAg. In one embodiment, the vaccine formulation of the present invention comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the vaccine formulation of the present invention comprises DT-Pa-HBsAg-IPV-Hib.

[0243] Pertussis antigens: Bordetella pertussis causes pertussis. The pertussis antigens in the vaccine are either cellular (whole cells, in the form of inactivated B. pertussis cells) or acellular. The preparation of cellular pertussis antigens is well documented (for example, they can be obtained by heat-killing a Phase I culture of B. pertussis). However, preferably, the present invention uses acellular antigens. Where acellular antigens are used, preferably one, two or (preferably) three of the following antigens are used: (1) detoxified pertussis toxin (pertussis toxoid or PT); (2) filamentous hemagglutinin (FHA); (3) pertactin (also known as the 69 kDa outer membrane protein). FHA and pertactin may be formaldehyde-treated prior to use in accordance with the present invention. PT is preferably detoxified by treatment with formaldehyde and / or glutaraldehyde. The acellular pertussis antigen is preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, it may be added in an unadsorbed state. Where pertactin is added, it is preferably adsorbed onto aluminium hydroxide adjuvant. PT and FHA may be adsorbed onto aluminium hydroxide adjuvant or aluminium phosphate. Adsorption of all of PT, FHA and pertactin onto aluminium hydroxide is most preferred.

[0244] Inactivated poliovirus vaccines: Poliovirus causes polio. In addition to using oral poliovirus vaccines, a preferred embodiment of the present invention uses IPV. Before administration to a patient, the poliovirus must be inactivated, which can be achieved by treatment with formaldehyde. Poliomyelitis can be caused by one of three types of poliovirus. The three types are similar and cause the same symptoms, but they are antigenically different, and infection with one type does not protect against infection with the other types. Therefore, three poliovirus antigens are preferably used in the present invention: poliovirus type 1 (e.g., Mahoney strain), poliovirus type 2 (e.g., MEF-1 strain), and poliovirus type 3 (e.g., Saukett strain). The viruses are preferably grown, purified, and individually inactivated, and then combined to obtain the large trivalent mixture used in the present invention.

[0245] Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. The diphtheria toxin can be treated (e.g., using formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific anti-toxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferably, the diphtheria toxoid is prepared by formaldehyde treatment. The diphtheria toxoid can be obtained by growing Corynebacterium diphtheriae in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoid material can then be processed by a method including sterile filtration and / or dialysis. The diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide adjuvant.

[0246] Tetanus Toxoid: Clostridium tetani causes tetanus. Tetanus toxin can be processed to produce a protective toxoid. This toxoid is used in tetanus vaccines. Preferred tetanus toxoids are prepared by treatment with formaldehyde. Tetanus toxoid can be obtained by growing Clostridium tetani in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. This material can then be processed by a method involving sterile filtration and / or dialysis.

[0247] Hepatitis A virus antigen: Hepatitis A virus (HAV) is one of the known agents that cause viral hepatitis. Preferred HAV components are based on inactivated virus, and inactivation can be achieved by formalin treatment.

[0248] Hepatitis B virus (HBV) is one of the known agents that cause viral hepatitis. The main component of the capsid is a protein called HBV surface antigen, or more commonly HBsAg, which is typically a 226-amino acid polypeptide with a molecular weight of approximately 24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to normal vaccine recipients, it stimulates the production of anti-HBsAg antibodies, protecting against HBV infection.

[0249] For vaccine production, HBsAg has been prepared in two ways: by purifying the antigen in particulate form from the plasma of chronic hepatitis B carriers, or by expressing the protein via recombinant DNA methods (e.g., recombinant expression in yeast cells). Unlike native HBsAg (i.e., in plasma purification products), yeast-expressed HBsAg is generally not glycosylated and is the most preferred form of HBsAg for use in the present invention.

[0250] Conjugated Haemophilus influenzae type b antigens: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on capsular saccharide antigens, the preparation of which is well documented. Hib saccharides can be conjugated to carrier proteins to enhance their immunogenicity, especially in children. Typical carrier proteins are tetanus toxoid, diphtheria toxoid, CRM 197 , Haemophilus influenzae protein D, and the outer membrane protein complex from serogroup B meningococci. The sugar portion of the conjugate may comprise, for example, full-length polyribosylribitol phosphate (PRP) prepared from Hib bacteria, and / or fragments of full-length PRP. The Hib conjugate may or may not be adsorbed to an aluminum salt adjuvant.

[0251] In one embodiment, the vaccine formulation of the invention further comprises conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY), and / or conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).

[0252] In one embodiment, the vaccine formulation of the invention further comprises conjugated Neisseria meningitidis serogroup A capsular saccharide (MenA), conjugated Neisseria meningitidis serogroup W135 capsular saccharide (MenW135), conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY), and / or conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).

[0253] In one embodiment, the vaccine formulation of the invention further comprises conjugated Neisseria meningitidis serogroup W135 capsular saccharide (MenW135), conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY), and / or conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).

[0254] preparation

[0255] The formulations of the present invention may be in liquid form (i.e., solutions or suspensions) or lyophilized form. Liquid formulations can advantageously be administered directly from their packaging, and are therefore ideal for injection, without the need for reconstitution in an aqueous medium as would be required for the lyophilized compositions of the present invention.

[0256] The compositions of the present invention can be formulated using methods recognized in the art. For example, individual pneumococcal conjugates can be formulated using physiologically acceptable vehicles to prepare compositions. Examples of such formulations include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextrose solutions.

[0257] The present invention provides formulations comprising any combination of the glycoconjugates disclosed herein and a pharmaceutically acceptable excipient, carrier, or diluent.

[0258] In one embodiment, the vaccine formulation of the invention is in liquid form, preferably in aqueous liquid form.

[0259] The vaccine formulations of the present invention may comprise one or more of a buffer, a salt, a divalent cation, a non-ionic detergent, a cryoprotectant (such as a sugar), and an antioxidant (such as a free radical scavenger or a chelating agent), or any combination thereof.

[0260] In one embodiment, the vaccine formulation of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In one embodiment, the buffer is phosphate, succinate, histidine, or citrate. In certain embodiments, the buffer is succinate at a final concentration of 1 mM to 10 mM. In a specific embodiment, the final concentration of the succinate buffer is about 5 mM.

[0261] In one embodiment, the buffer is a succinate or histidine buffer. In one embodiment, the buffer is at a concentration of about 1mM to 30mM. In a preferred embodiment, the buffer is a succinate buffer with a final concentration of 1mM to 10mM. In a more preferred embodiment, the buffer is a succinate buffer with a final concentration of about 5mM to 9mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 1mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 2mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 3mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 4mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 5mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 6mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 7mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 8mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 9 mM. In one embodiment, the buffer is a succinate buffer with a final concentration of about 10 mM. In a preferred embodiment, the buffer is a succinate buffer with a final concentration of about 5 mM.

[0262] In one embodiment, the buffer is a histidine buffer. In one embodiment, the histidine buffer is a histidine buffer with a final concentration of about 1mM to 30mM. In a preferred embodiment, the buffer is a histidine buffer with a final concentration of about 10mM to 30mM. In a more preferred embodiment, the buffer is a histidine buffer with a final concentration of about 20mM to 30mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 1mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 2mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 3mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 4mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 5mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 6mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 7mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 8mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 9mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 10mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 11mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 12mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 13mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 14mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 15mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 16mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 17mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 18mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 19mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 20mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 21mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 22 mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 23 mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 24 mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 25 mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 26 mM.In one embodiment, the buffer is a histidine buffer with a final concentration of about 27 mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 28 mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 29 mM. In one embodiment, the buffer is a histidine buffer with a final concentration of about 30 mM.

[0263] In a preferred embodiment, the buffer is a histidine buffer with a final concentration of 25mM. In one embodiment, the buffer has a pH of about 5.0 to 7.5. In a preferred embodiment, the buffer has a pH of about 5.0 to 6.5. In a more preferred embodiment, the buffer has a pH of about 5.5 to 6.0. In one embodiment, the buffer has a pH of about 5.0. In one embodiment, the buffer has a pH of about 5.1. In one embodiment, the buffer has a pH of about 5.2. In one embodiment, the buffer has a pH of about 5.3. In one embodiment, the buffer has a pH of about 5.4. In one embodiment, the buffer has a pH of about 5.5. In one embodiment, the buffer has a pH of about 5.6. In one embodiment, the buffer has a pH of about 5.7. In one embodiment, the buffer has a pH of about 5.8. In one embodiment, the buffer has a pH of about 5.9. In one embodiment, the buffer has a pH of about 6.0. In one embodiment, the buffer has a pH of about 6.1. In one embodiment, the buffer has a pH of about 6.2. In one embodiment, the buffer has a pH of about 6.3. In one embodiment, the buffer has a pH of about 6.4. In one embodiment, the buffer has a pH of about 6.5. In one embodiment, the buffer has a pH of about 6.6. In one embodiment, the buffer has a pH of about 6.7. In one embodiment, the buffer has a pH of about 6.8. In one embodiment, the buffer has a pH of about 6.9. In one embodiment, the buffer has a pH of about 7.0. In one embodiment, the buffer has a pH of about 7.1. In one embodiment, the buffer has a pH of about 7.2. In one embodiment, the buffer has a pH of about 7.3. In one embodiment, the buffer has a pH of about 7.4. In one embodiment, the buffer has a pH of about 7.5. In a preferred embodiment, the buffer is a succinate or histidine buffer with a pH of about 5.8.

[0264] In one embodiment, the formulation of the present invention comprises a salt. In some embodiments, the salt is selected from sodium phosphate, calcium chloride, magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In a specific embodiment, the salt is sodium chloride. In a specific embodiment, the vaccine formulation of the present invention comprises 150 mM sodium chloride.

[0265] In one embodiment, the salt is sodium phosphate, calcium chloride, sodium chloride, or a combination thereof. In one embodiment, the salt has a concentration of about 1mM to 300mM. In one embodiment, the salt is sodium chloride. In one embodiment, the salt is sodium chloride with a concentration of about 50mM to 300mM. In one embodiment, the salt is sodium chloride with a concentration of about 100mM to 200mM. In a preferred embodiment, the salt is sodium chloride with a concentration of about 200mM to 300mM. In a more preferred embodiment, the salt is sodium chloride with a concentration of about 150mM to 250mM. In one embodiment, the salt is sodium chloride with a concentration of about 50mM. In one embodiment, the salt is sodium chloride with a concentration of about 75mM. In one embodiment, the salt is sodium chloride with a concentration of about 100mM. In one embodiment, the salt is sodium chloride with a concentration of about 125mM. In one embodiment, the salt is sodium chloride with a concentration of about 150mM. In one embodiment, the salt is sodium chloride with a concentration of about 175mM. In one embodiment, the salt is sodium chloride having a concentration of about 200mM. In one embodiment, the salt is sodium chloride having a concentration of about 225mM. In one embodiment, the salt is sodium chloride having a concentration of about 250mM. In one embodiment, the salt is sodium chloride having a concentration of about 275mM. In one embodiment, the salt is sodium chloride having a concentration of about 300mM. In one embodiment, the salt is sodium chloride having a concentration of about 125mM. In one embodiment, the salt is sodium chloride having a concentration of about 130mM. In one embodiment, the salt is sodium chloride having a concentration of about 135mM. In one embodiment, the salt is sodium chloride having a concentration of about 140mM. In one embodiment, the salt is sodium chloride having a concentration of about 145mM. In one embodiment, the salt is sodium chloride having a concentration of about 150mM. In one embodiment, the salt is sodium chloride having a concentration of about 155mM. In one embodiment, the salt is sodium chloride having a concentration of about 160mM. In one embodiment, the salt is sodium chloride with a concentration of about 165mM. In one embodiment, the salt is sodium chloride with a concentration of about 170mM. In one embodiment, the salt is sodium chloride with a concentration of about 175mM. In one embodiment, the salt is sodium chloride with a concentration of about 225mM. In one embodiment, the salt is sodium chloride with a concentration of about 230mM. In one embodiment, the salt is sodium chloride with a concentration of about 235mM. In one embodiment, the salt is sodium chloride with a concentration of about 240mM. In one embodiment, the salt is sodium chloride with a concentration of about 245mM. In one embodiment, the salt is sodium chloride with a concentration of about 250mM. In one embodiment, the salt is sodium chloride with a concentration of about 255mM.In one embodiment, the salt is sodium chloride having a concentration of about 260 mM. In one embodiment, the salt is sodium chloride having a concentration of about 265 mM. In one embodiment, the salt is sodium chloride having a concentration of about 270 mM. In one embodiment, the salt is sodium chloride having a concentration of about 275 mM. In a specific embodiment, the salt is sodium chloride having a concentration of 150 mM. In a specific embodiment, the salt is sodium chloride having a concentration of 245 mM.

[0266] In one embodiment, the salt is magnesium chloride. In one embodiment, the salt is magnesium chloride having a concentration of about 10mM to 50mM. In a preferred embodiment, the salt is magnesium chloride having a concentration of about 20mM to 50mM. In a more preferred embodiment, the salt is magnesium chloride having a concentration of about 30mM to 50mM. In a specific embodiment, the salt is magnesium chloride having a concentration of about 35mM to 45mM. In one embodiment, the salt is magnesium chloride having a concentration of about 10mM. In one embodiment, the salt is magnesium chloride having a concentration of about 15mM. In one embodiment, the salt is magnesium chloride having a concentration of about 20mM. In one embodiment, the salt is magnesium chloride having a concentration of about 25mM. In one embodiment, the salt is magnesium chloride having a concentration of about 30mM. In one embodiment, the salt is magnesium chloride having a concentration of about 35mM. In one embodiment, the salt is magnesium chloride having a concentration of about 40mM. In one embodiment, the salt is magnesium chloride having a concentration of about 45mM. In one embodiment, the salt is magnesium chloride having a concentration of about 50 mM. In a specific embodiment, the salt is magnesium chloride having a concentration of about 40 mM.

[0267] In one embodiment, the salt is calcium chloride. In one embodiment, the salt is calcium chloride having a concentration of about 1mM to 50mM. In a specific embodiment, the salt is calcium chloride. In a preferred embodiment, the salt is calcium chloride having a concentration of about 10mM to 30mM. In a more preferred embodiment, the salt is calcium chloride having a concentration of about 15mM to 25mM. In one embodiment, the salt is calcium chloride having a concentration of about 5mM. In one embodiment, the salt is calcium chloride having a concentration of about 10mM. In one embodiment, the salt is calcium chloride having a concentration of about 15mM. In one embodiment, the salt is calcium chloride having a concentration of about 20mM. In one embodiment, the salt is calcium chloride having a concentration of about 25mM. In one embodiment, the salt is calcium chloride having a concentration of about 30mM. In one embodiment, the salt is calcium chloride having a concentration of about 35mM. In one embodiment, the salt is calcium chloride having a concentration of about 40mM. In a preferred embodiment, the salt is calcium chloride having a concentration of 20mM.

[0268] In one embodiment, the salt is sodium phosphate. In one embodiment, the salt is sodium phosphate having a concentration of about 1mM to 50mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of about 20mM to 50mM. In a more preferred embodiment, the salt is sodium phosphate having a concentration of about 35mM to 45mM. In one embodiment, the salt is sodium phosphate having a concentration of about 5mM. In one embodiment, the salt is sodium phosphate having a concentration of about 10mM. In one embodiment, the salt is sodium phosphate having a concentration of about 15mM. In one embodiment, the salt is sodium phosphate having a concentration of about 20mM. In one embodiment, the salt is sodium phosphate having a concentration of about 25mM. In one embodiment, the salt is sodium phosphate having a concentration of about 30mM. In one embodiment, the salt is sodium phosphate having a concentration of about 35mM. In one embodiment, the salt is sodium phosphate having a concentration of about 35mM. In one embodiment, the salt is sodium phosphate having a concentration of about 40mM. In one embodiment, the salt is sodium phosphate having a concentration of about 45mM. In one embodiment, the salt is sodium phosphate having a concentration of about 50 mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of 20 mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of 40 mM.

[0269] In one embodiment, the salt is sodium phosphate and sodium chloride. In one embodiment, sodium phosphate has a concentration of about 1mM to 50mM, and sodium chloride has a concentration of about 50mM to 300mM. In one embodiment, sodium phosphate has a concentration of about 10mM to 30mM, and sodium chloride has a concentration of about 100mM to 300mM. In a preferred embodiment, sodium phosphate has a concentration of about 15mM to 25mM, and sodium chloride has a concentration of about 200mM to 300mM. In a preferred embodiment, sodium phosphate has a concentration of about 30mM to 50mM, and sodium chloride has a concentration of about 200mM to 300mM. In one embodiment, sodium phosphate has a concentration of about 5mM. In one embodiment, sodium phosphate has a concentration of about 10mM. In one embodiment, sodium phosphate has a concentration of about 15mM. In one embodiment, sodium phosphate has a concentration of about 20mM. In one embodiment, sodium phosphate has a concentration of about 25mM. In one embodiment, sodium phosphate has a concentration of about . In one embodiment, sodium phosphate has a concentration of about 35 mM. In one embodiment, sodium phosphate has a concentration of about 40 mM. In one embodiment, sodium phosphate has a concentration of about 45 mM. In one embodiment, sodium phosphate has a concentration of about 50 mM. In one embodiment, sodium chlorate has a concentration of about 125 mM. In one embodiment, sodium chlorate has a concentration of about 130 mM. In one embodiment, sodium chlorate has a concentration of about 135 mM. In one embodiment, sodium chlorate has a concentration of about 140 mM. In one embodiment, sodium chlorate has a concentration of about 145 mM. In one embodiment, sodium chlorate has a concentration of about 150 mM. In one embodiment, sodium chlorate has a concentration of about 155 mM. In one embodiment, sodium chlorate has a concentration of about 160 mM. In one embodiment, sodium chlorate has a concentration of about 165 mM. In one embodiment, sodium chlorate has a concentration of about 170 mM. In one embodiment, sodium chlorate has a concentration of about 175 mM. In one embodiment, sodium chlorate has a concentration of about 180 mM. In one embodiment, sodium chlorate has a concentration of about 185 mM. In one embodiment, sodium chlorate has a concentration of about 190 mM. In one embodiment, sodium chlorate has a concentration of about 200 mM. In one embodiment, sodium chlorate has a concentration of about 205 mM. In one embodiment, sodium chlorate has a concentration of about 210 mM. In one embodiment, sodium chlorate has a concentration of about 215 mM. In one embodiment, sodium chlorate has a concentration of about 220 mM. In one embodiment, sodium chlorate has a concentration of about 225 mM. In one embodiment, sodium chlorate has a concentration of about 230 mM. In one embodiment, sodium chlorate has a concentration of about 235 mM. In one embodiment, sodium chlorate has a concentration of about 240 mM.In one embodiment, sodium chlorate has a concentration of about 245mM. In one embodiment, sodium chlorate has a concentration of about 250mM. In one embodiment, sodium chlorate has a concentration of about 255mM. In one embodiment, sodium chlorate has a concentration of about 260mM. In one embodiment, sodium chlorate has a concentration of about 265mM. In one embodiment, sodium chlorate has a concentration of about 270mM. In one embodiment, sodium chlorate has a concentration of about 275mM. In a specific embodiment, sodium phosphate has a concentration of about 20mM, and sodium chloride has a concentration of about 150mM. In a specific embodiment, the salt is sodium phosphate with a concentration of 20mM and sodium chloride with a concentration of 245mM. In a specific embodiment, the salt is sodium phosphate with a concentration of 40mM and sodium chloride with a concentration of 245mM.

[0270] In one embodiment, the salt is sodium chloride and calcium chloride. In one embodiment, sodium chloride has a concentration of about 50 to 300mM, and calcium chloride has a concentration of about 1mM to 50mM. In a preferred embodiment, sodium chloride has a concentration of about 100 to 250mM, and calcium chloride has a concentration of about 20mM to 30mM. In a more preferred embodiment, sodium chloride has a concentration of about 100 to 200mM, and calcium chloride has a concentration of about 15mM to 25mM. In one embodiment, sodium chloride has a concentration of about 125mM. In one embodiment, sodium chloride has a concentration of about 130mM. In one embodiment, sodium chloride has a concentration of about 135mM. In one embodiment, sodium chloride has a concentration of about 140mM. In one embodiment, sodium chloride has a concentration of about 145mM. In one embodiment, sodium chloride has a concentration of about 150mM. In one embodiment, sodium chloride has a concentration of about 155mM. In one embodiment, sodium chloride has a concentration of about 160mM. In one embodiment, sodium chloride has a concentration of about 165mM. In one embodiment, sodium chloride has a concentration of about 170mM. In one embodiment, sodium chloride has a concentration of about 175mM. In one embodiment, calcium chloride has a concentration of about . In one embodiment, calcium chloride has a concentration of about 5mM. In one embodiment, calcium chloride has a concentration of about 10mM. In one embodiment, calcium chloride has a concentration of about 15mM. In one embodiment, calcium chloride has a concentration of about 20mM. In one embodiment, calcium chloride has a concentration of about 25mM. In one embodiment, calcium chloride has a concentration of about 30mM. In one embodiment, calcium chloride has a concentration of about 35mM. In one embodiment, calcium chloride has a concentration of about 40mM. In a specific embodiment, sodium chloride has a concentration of about 150mM and calcium chloride has a concentration of about 20mM.

[0271] In one embodiment, the salt is sodium chloride and magnesium chloride. In one embodiment, sodium chloride has a concentration of about 50 to 300mM, and magnesium chloride has a concentration of 1mM to 50mM. In a preferred embodiment, sodium chloride has a concentration of about 100 to 250mM, and magnesium chloride has a concentration of 10mM to 30mM. In a more preferred embodiment, sodium chloride has a concentration of about 100 to 200mM, and magnesium chloride has a concentration of 15mM to 25mM. In one embodiment, sodium chloride has a concentration of about 125mM. In one embodiment, sodium chloride has a concentration of about 130mM. In one embodiment, sodium chloride has a concentration of about 135mM. In one embodiment, sodium chloride has a concentration of about 140mM. In one embodiment, sodium chloride has a concentration of about 145mM. In one embodiment, sodium chloride has a concentration of about 150mM. In one embodiment, sodium chloride has a concentration of about 155mM. In one embodiment, sodium chloride has a concentration of about 160mM. In one embodiment, sodium chloride has a concentration of about 165mM. In one embodiment, sodium chloride has a concentration of about 170mM. In one embodiment, sodium chloride has a concentration of about 175mM. In one embodiment, magnesium chloride has a concentration of about 5mM. In one embodiment, magnesium chloride has a concentration of about 10mM. In one embodiment, magnesium chloride has a concentration of about 15mM. In one embodiment, magnesium chloride has a concentration of about 20mM. In one embodiment, magnesium chloride has a concentration of about 25mM. In one embodiment, magnesium chloride has a concentration of about 30mM. In one embodiment, magnesium chloride has a concentration of about 35mM. In one embodiment, magnesium chloride has a concentration of about 35mM. In one embodiment, magnesium chloride has a concentration of about 40mM. In a specific embodiment, sodium chloride has a concentration of about 150mM and magnesium chloride has a concentration of about 20mM.

[0272] In one embodiment, the vaccine formulation of the present invention comprises a surfactant. In one embodiment, the surfactant is selected from the group consisting of polysorbate 20 (TWEEN TM 20), Polysorbate 40 (TWEEN TM 40), Polysorbate 60 (TWEEN TM 60), polysorbate 65 (TWEEN TM 65), Polysorbate 80 (TWEEN TM 80), polysorbate 85 (TWEEN TM 85) TRITON TM N-101, TRITON TMX-100, oxtoxynol 40, nonoxynol-9, triethanolamine, triethanolamine oleate polypeptide, polyoxyethylene-660 hydroxystearate (PEG-15, SolutolH 15), polyoxyethylene-35-ricinoleate ( EL), soy lecithin and poloxamer.

[0273] In a specific embodiment, the surfactant is polysorbate 80. In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% weight ratio (w / w) polysorbate 80. In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% weight ratio (w / w) polysorbate 80. In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% weight ratio (w / w) polysorbate 80. In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.02% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.03% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.04% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.05% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.06% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.07% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.08% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.09% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.1% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 1% polysorbate 80 (w / w).

[0274] In a specific embodiment, the surfactant is polysorbate 20. In some such embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.0001% to 10% weight (w / w) polysorbate 20. In some such embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.001% to 1% weight (w / w) polysorbate 20. In some such embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.001% to 1% weight (w / w) polysorbate 20. In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.01% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.02% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.03% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.04% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.05% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.06% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.07% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.08% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.09% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.1% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 1% polysorbate 20 (w / w).

[0275] In one embodiment, the formulation of the present invention comprises an adjuvant. The adjuvant of the formulation is described in detail below.

[0276] In one embodiment, the formulations of the present invention have a total glycoconjugate concentration of about 10 to 500 μg / ml. In one embodiment, the total glycoconjugate concentration is about 20 to 400 μg / ml. In one embodiment, the total glycoconjugate concentration is about 30 to 300 μg / ml. In a preferred embodiment, the total glycoconjugate concentration is about 50 to 200 μg / ml. In a more preferred embodiment, the total glycoconjugate concentration is about 100 to 150 μg / ml.

[0277] In one embodiment, the total glycoconjugate concentration is about 115 μg / ml. In one embodiment, the total glycoconjugate concentration is about 120 μg / ml. In one embodiment, the total glycoconjugate concentration is about 115 μg / ml. In one embodiment, the total glycoconjugate concentration is about 119 μg / ml.

[0278] In certain embodiments, the vaccine formulations of the invention have a pH of 5.5 to 7.5, more preferably a pH of 5.6 to 7.0, even more preferably a pH of 5.8 to 6.0.

[0279] In one embodiment, the present invention provides a formulation comprising: at least 21 different polysaccharide-protein conjugates; a succinate or histidine buffer having a pH in the range of 5.0 to 7.5; calcium chloride, sodium chloride, calcium chloride and / or sodium phosphate; a surfactant; and an adjuvant. In one embodiment, the present invention provides a formulation comprising: at least 21 different polysaccharide-protein conjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; calcium chloride; sodium chloride; a surfactant; and an adjuvant. In one embodiment, the present invention provides a formulation comprising: at least 21 different polysaccharide-protein conjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; sodium chloride; sodium phosphate; a surfactant; and an adjuvant. In one embodiment, the present invention provides a formulation comprising: at least 21 different polysaccharide-protein conjugates; a histidine buffer having a pH in the range of 5.0 to 7.5; sodium chloride; a surfactant; and an adjuvant. In a preferred embodiment, the surfactant is polysorbate 80 or polysorbate 20. In a more preferred embodiment, the surfactant is polysorbate 80.

[0280] In one embodiment, the formulation comprises: 25 polysaccharide-protein conjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80 and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof.

[0281] In one embodiment, the formulation comprises: 25 polysaccharide-protein conjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

[0282] In one embodiment, the formulation comprises: 25 polysaccharide-protein conjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

[0283] In one embodiment, the present invention provides a container filled with any of the vaccine formulations disclosed herein. In one embodiment, the container is selected from a vial, a syringe, a flask, a fermentor, a bioreactor, a bag, a tank, an ampoule, a cartridge, and a disposable pen. In certain embodiments, the container is siliconized.

[0284] In one embodiment, the containers of the present invention are made of glass, metal (eg, steel, stainless steel, aluminum, etc.), and / or polymer (eg, thermoplastics, elastomers, thermoplastic elastomers).

[0285] In one embodiment, the container of the present invention is made of glass.

[0286] stability

[0287] In certain embodiments, it may be difficult to resuspend a composition or formulation containing a significant number of glycoconjugates that has been sitting for a period of time (e.g., sitting on a shelf). Excessive sedimentation or sedimentation that is too dense (e.g., too short a "cake height," as described in detail below) can prevent resuspension of the glycoconjugates, which can render the composition or formulation unstable or inoperable. Additionally, if sedimentation occurs too quickly, it can interfere with manufacturing and the creation of a usable dosage form (e.g., the composition begins to settle before being transferred to a container). As described in detail herein, in compositions or formulations containing a significant number of glycoconjugates, embodiments of the present invention detail sedimentation rates that provide compositions that can be more easily manufactured for sale and / or resuspended for use.

[0288] Sedimentation velocity can be measured as described in the art. One method of measuring sedimentation rate is to use TOWER. TOWER uses static multiple light scattering to detect particle migration in liquid dispersions. The measurement head is equipped with a pulsed near-infrared light source (λ = 880 nm), and synchronized transmission (180° from the light source) and backscatter (45° from the light source) detectors that move along the height of a flat-bottomed cylindrical glass sample unit, collecting data every 20 μm.

[0289] In certain embodiments, measurements are performed using approximately 20 mL of sample at room temperature. The sample is vortexed immediately before measurement for resuspension. In certain embodiments, the measurement occurs after the sample is placed in the scanner after vortexing. The sedimentation start time is defined as the time when the sample reaches 45% clarity at the meniscus and is obtained from transmission data. The sedimentation rate is reported as the slope of the change in the position of the sedimentation front as a function of time.

[0290] In one embodiment, the present invention provides a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant to form a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; at time T2 , another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; and wherein the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in the liquid, wherein the measurement head comprises a pulsed near-infrared light source with a wavelength of about 880 nm and has a synchronous transmission detector at 180° from the light source and a backscattering detector at 45° from the light source, the detectors moving along the height of the flat-bottomed cylindrical glass sample unit, and precipitate data is collected every 20 μm.

[0291] In one embodiment, the composition comprises at least 21 different glycoconjugates. In one embodiment, the composition comprises at least 22 different glycoconjugates. In one embodiment, the composition comprises at least 23 different glycoconjugates. In one embodiment, the composition comprises at least 24 different glycoconjugates. In one embodiment, the composition comprises at least 25 different glycoconjugates. In one embodiment, the composition comprises at least 26 different glycoconjugates. In one embodiment, the composition comprises at least 27 different glycoconjugates. In one embodiment, the composition comprises at least 28 different glycoconjugates. In one embodiment, the composition comprises at least 29 different glycoconjugates. In one embodiment, the composition comprises at least 30 different glycoconjugates. In one embodiment, the composition comprises at least 31 different glycoconjugates. In one embodiment, the composition comprises at least 32 different glycoconjugates. In one embodiment, the composition comprises at least 33 different glycoconjugates. In one embodiment, the composition comprises at least 34 different glycoconjugates. In one embodiment, the composition comprises at least 35 different glycoconjugates.

[0292] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is about 1 hour to 2 hours. In a preferred embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is about 0.1 hours. In one embodiment, T1 is about 0.2 hours. In one embodiment, T1 is about 0.3 hours. In one embodiment, T1 is about 0.4 hours. In one embodiment, T1 is about 0.5 hours. In one embodiment, T1 is about 0.6 hours. In one embodiment, T1 is about 0.7 hours. In one embodiment, T1 is about 0.8 hours. In one embodiment, T1 is about 0.9 hours. In one embodiment, T1 is about 1.0 hours. In one embodiment, T1 is about 1.1 hours. In one embodiment, T1 is about 1.2 hours. In one embodiment, T1 is about 1.3 hours. In one embodiment, T1 is about 1.4 hours. In one embodiment, T1 is about 1.5 hours. In one embodiment, T1 is about 1.6 hours. In one embodiment, T1 is about 1.7 hours. In one embodiment, T1 is about 1.8 hours. In one embodiment, T1 is about 1.9 hours. In one embodiment, T1 is about 2.0 hours. In one embodiment, T1 is about 2.1 hours. In one embodiment, T1 is about 2.2 hours. In one embodiment, T1 is about 2.3 hours. In one embodiment, T1 is about 2.4 hours. In one embodiment, T1 is about 2.5 hours. In one embodiment, T1 is about 2.6 hours. In one embodiment, T1 is about 2.7 hours. In one embodiment, T1 is about 2.8 hours. In one embodiment, T1 is about 2.9 hours. In one embodiment, T1 is about 3.0 hours. In one embodiment, T1 is about 3.1 hours. In one embodiment, T1 is about 3.2 hours. In one embodiment, T1 is about 3.3 hours. In one embodiment, T1 is about 3.4 hours. In one embodiment, T1 is about 3.5 hours. In one embodiment, T1 is about 3.6 hours. In one embodiment, T1 is about 3.7 hours. In one embodiment, T1 is about 3.8 hours. In one embodiment, T1 is about 3.9 hours. In one embodiment, T1 is about 4.0 hours.

[0293] In one embodiment, T2 is about 1 to 5 hours. In a preferred embodiment, T2 is about 1 to 3 hours. In a more preferred embodiment, T2 is about 1 to 2 hours. In a specific embodiment, T2 is about 4 hours. In one embodiment, T2 is about 1.0 hours. In one embodiment, T2 is about 1.1 hours. In one embodiment, T2 is about 1.2 hours. In one embodiment, T2 is about 1.3 hours. In one embodiment, T2 is about 1.4 hours. In one embodiment, T2 is about 1.5 hours. In one embodiment, T2 is about 1.6 hours. In one embodiment, T2 is about 1.7 hours. In one embodiment, T2 is about 1.8 hours. In one embodiment, T2 is about 1.9 hours. In one embodiment, T2 is about 2.0 hours. In one embodiment, T2 is about 2.1 hours. In one embodiment, T2 is about 2.2 hours. In one embodiment, T2 is about 2.3 hours. In one embodiment, T2 is about 2.4 hours. In one embodiment, T2 is about 2.5 hours. In one embodiment, T2 is about 2.6 hours. In one embodiment, T2 is about 2.7 hours. In one embodiment, T2 is about 2.8 hours. In one embodiment, T2 is about 2.9 hours. In one embodiment, T2 is about 3.0 hours. In one embodiment, T2 is about 3.1 hours. In one embodiment, T2 is about 3.2 hours. In one embodiment, T2 is about 3.3 hours. In one embodiment, T2 is about 3.4 hours. In one embodiment, T2 is about 3.6 hours. In one embodiment, T2 is about 3.7 hours. In one embodiment, T2 is about 3.8 hours. In one embodiment, T2 is about 3.9 hours. In one embodiment, T2 is about 4.0 hours. In one embodiment, T2 is about 4.1 hours. In one embodiment, T2 is about 4.2 hours. In one embodiment, T2 is about 4.3 hours. In one embodiment, T2 is about 4.4 hours. In one embodiment, T2 is about 4.5 hours. In one embodiment, T2 is about 4.6 hours. In one embodiment, T2 is about 4.7 hours. In one embodiment, T2 is about 4.8 hours. In one embodiment, T2 is about 4.9 hours. In one embodiment, T2 is about 5 hours.

[0294] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0295] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0296] In one embodiment, at T1, the peak thickness of the sedimentation front is between about 0 mm and 20.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is between about 1 mm and 10.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is between about 1 mm and 5.0 mm. In a more preferred embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.1 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.3 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.4 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.5 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.6 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.7 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.8 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.9 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 1.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 3.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 4.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 5.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 6.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 7.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 8.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 9.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 10.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 12.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 13.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 14.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 15.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 16.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 17.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 18.0 mm.In one embodiment, at T1, the peak thickness of the sedimentation front is about 19.0 mm. In one embodiment, at T1, the peak thickness of the first solid phase precipitate is about 20.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 20.0 mm.

[0297] In one embodiment, at T2, the thickness peak of the sedimentation front is about 2 mm to 25.0 mm. In a preferred embodiment, at T2, the thickness peak of the sedimentation front is about 5 mm to 20.0 mm. In a more preferred embodiment, at T2, the thickness peak of the sedimentation front is about 5 mm to 15.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 10 mm. In one embodiment, at T1, the thickness peak of the sedimentation front is about 0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 2.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 3.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 4.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 5.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 6.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 7.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 8.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 9.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 13.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 14.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 15.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 16.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 17.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 18.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 19.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 20.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 21.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 22.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 23.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 24.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 25.0 mm.

[0298] In one embodiment, the settling rate of the settling front is less than the peak thickness of 10 mm at about 1 hour and greater than the peak thickness of 18 mm at about 4 hours.

[0299] In one embodiment, the present invention further comprises a time T3, wherein at T3, the sedimentation of the saccharide conjugate adsorbed by the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is about 2 hours to 5 hours. In a preferred embodiment, T3 is about 3 hours to 5 hours. In a more preferred embodiment, T3 is about 4 hours to 5 hours. In one embodiment, T3 is about 2.0 hours. In one embodiment, T3 is about 2.1 hours. In one embodiment, T3 is about 2.2 hours. In one embodiment, T3 is about 2.3 hours. In one embodiment, T3 is about 2.4 hours. In one embodiment, T3 is about 2.5 hours. In one embodiment, T3 is about 2.6 hours. In one embodiment, T3 is about 2.7 hours. In one embodiment, T3 is about 2.8 hours. In one embodiment, T3 is about 2.9 hours. In one embodiment, T3 is about 3.0 hours. In one embodiment, T3 is about 3.1 hours. In one embodiment, T3 is about 3.2 hours. In one embodiment, T3 is about 3.3 hours. In one embodiment, T3 is about 3.4 hours. In one embodiment, T3 is about 3.5 hours. In one embodiment, T3 is about 3.6 hours. In one embodiment, T3 is about 3.7 hours. In one embodiment, T3 is about 3.8 hours. In one embodiment, T3 is about 3.9 hours. In one embodiment, T3 is about 4.0 hours. In one embodiment, T3 is about 4.1 hours. In one embodiment, T3 is about 4.2 hours. In one embodiment, T3 is about 4.4 hours. In one embodiment, T3 is about 4.5 hours. In one embodiment, T3 is about 4.6 hours. In one embodiment, T3 is about 4.7 hours. In one embodiment, T3 is about 4.8 hours. In one embodiment, T3 is about 4.9 hours. In one embodiment, T3 is about 5 hours.

[0300] In one embodiment, at T3, the sedimentation front is about 25 mm to 40 mm. In a preferred embodiment, at T3, the sedimentation front is about 30 mm to 40 mm. In a more preferred embodiment, at T3, the sedimentation front is about 35 mm to 40 mm. In one embodiment, the sedimentation front at T3 is about 25.0 mm. In one embodiment, the sedimentation front at T3 is about 26 mm. In one embodiment, the sedimentation front at T3 is about 27 mm. In one embodiment, the sedimentation front at T3 is about 28 mm. In one embodiment, the sedimentation front at T3 is about 29 mm. In one embodiment, the sedimentation front at T3 is about 30 mm. In one embodiment, the sedimentation front at T3 is about 31 mm. In one embodiment, the sedimentation front at T3 is about 32 mm. In one embodiment, the sedimentation front at T3 is about 33 mm. In one embodiment, the sedimentation front at T3 is about 34 mm. In one embodiment, the sedimentation front at T3 is about 35 mm. In one embodiment, the sedimentation front at T3 is about 36 mm. In one embodiment, the sedimentation front at T3 is about 37 mm. In one embodiment, the sedimentation front at T3 is about 38 mm. In one embodiment, the sedimentation front at T3 is about 39 mm. In one embodiment, the sedimentation front at T3 is about 40 mm.

[0301] In one embodiment, the composition has been allowed to stand for about 1 month. In one embodiment, the composition has been allowed to stand for at least 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.

[0302] In one embodiment, after T3, the composition is resuspended using about 1 to 10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended using about 1 to 5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended using about 1 to 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 1 manual shaking. In one embodiment, after T3, the composition is resuspended using about 2 manual shakings. In one embodiment, after T3, the composition is resuspended using about 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 4 manual shakings. In one embodiment, after T3, the composition is resuspended using about 5 manual shakings. In one embodiment, after T3, the composition is resuspended using about 6 manual shakings. In one embodiment, after T3, the composition is resuspended using about 7 manual shakings. In one embodiment, after T3, the composition is resuspended using about 8 manual shakings. In one embodiment, after T3, the composition is resuspended using about 9 manual shakings. In one embodiment, after T3, the composition is resuspended using about 10 manual shakings. In one embodiment, the composition comprises the formulation previously described.

[0303] In one embodiment, the present invention provides a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant to form a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant settles from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; at time During time T2, another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant settles from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; and wherein the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in the liquid, wherein the measurement head comprises a pulsed near-infrared light source with a wavelength of about 880 nm and has a synchronous transmission detector 180° from the light source and a backscattering detector 45° from the light source, the detectors moving along the height of the flat-bottomed cylindrical glass sample unit, and precipitate data is collected every 20 μm.

[0304] In one embodiment, the container comprises at least 21 different glycoconjugates. In one embodiment, the container comprises at least 22 different glycoconjugates. In one embodiment, the container comprises at least 23 different glycoconjugates. In one embodiment, the container comprises at least 24 different glycoconjugates. In one embodiment, the container comprises at least 25 different glycoconjugates. In one embodiment, the container comprises at least 26 different glycoconjugates. In one embodiment, the container comprises at least 27 different glycoconjugates. In one embodiment, the container comprises at least 28 different glycoconjugates. In one embodiment, the container comprises at least 29 different glycoconjugates. In one embodiment, the container comprises at least 30 different glycoconjugates. In one embodiment, the container comprises at least 31 different glycoconjugates. In one embodiment, the container comprises at least 32 different glycoconjugates. In one embodiment, the container comprises at least 33 different glycoconjugates. In one embodiment, the container comprises at least 34 different glycoconjugates. In one embodiment, the container comprises at least 35 different glycoconjugates.

[0305] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In a preferred embodiment, T1 is about 1 hour to 3 hours. In a more preferred embodiment, T1 is about 1 hour to 2 hours. In one embodiment, T1 is about 0.1 hours. In one embodiment, T1 is about 0.2 hours. In one embodiment, T1 is about 0.3 hours. In one embodiment, T1 is about 0.4 hours. In one embodiment, T1 is about 0.5 hours. In one embodiment, T1 is about 0.6 hours. In one embodiment, T1 is about 0.7 hours. In one embodiment, T1 is about 0.8 hours. In one embodiment, T1 is about 0.9 hours. In one embodiment, T1 is about 1.0 hours. In one embodiment, T1 is about 1.1 hours. In one embodiment, T1 is about 1.2 hours. In one embodiment, T1 is about 1.3 hours. In one embodiment, T1 is about 1.4 hours. In one embodiment, T1 is about 1.5 hours. In one embodiment, T1 is about 1.6 hours. In one embodiment, T1 is about 1.7 hours. In one embodiment, T1 is about 1.8 hours. In one embodiment, T1 is about 1.9 hours. In one embodiment, T1 is about 2.0 hours. In one embodiment, T1 is about 2.1 hours. In one embodiment, T1 is about 2.2 hours. In one embodiment, T1 is about 2.3 hours. In one embodiment, T1 is about 2.4 hours. In one embodiment, T1 is about 2.5 hours. In one embodiment, T1 is about 2.6 hours. In one embodiment, T1 is about 2.7 hours. In one embodiment, T1 is about 2.8 hours. In one embodiment, T1 is about 2.9 hours. In one embodiment, T1 is about 3.0 hours. In one embodiment, T1 is about 3.1 hours. In one embodiment, T1 is about 3.2 hours. In one embodiment, T1 is about 3.3 hours. In one embodiment, T1 is about 3.4 hours. In one embodiment, T1 is about 3.5 hours. In one embodiment, T1 is about 3.6 hours. In one embodiment, T1 is about 3.7 hours. In one embodiment, T1 is about 3.8 hours. In one embodiment, T1 is about 3.9 hours. In one embodiment, T1 is about 4.0 hours.

[0306] In one embodiment, T2 is about 1 hour to 5 hours. In a preferred embodiment, T2 is about 1 hour to 3 hours. In a more preferred embodiment, T2 is about 1 hour to 2 hours. In a specific embodiment, T2 is about 4 hours. In one embodiment, T2 is about 1.0 hour. In one embodiment, T2 is about 1.1 hours. In one embodiment, T2 is about 1.2 hours. In one embodiment, T2 is about 1.3 hours. In one embodiment, T2 is about 1.4 hours. In one embodiment, T2 is about 1.5 hours. In one embodiment, T2 is about 1.6 hours. In one embodiment, T2 is about 1.7 hours. In one embodiment, T2 is about 1.8 hours. In one embodiment, T2 is about 1.9 hours. In one embodiment, T2 is about 2.0 hours. In one embodiment, T2 is about 2.1 hours. In one embodiment, T2 is about 2.2 hours. In one embodiment, T2 is about 2.3 hours. In one embodiment, T2 is about 2.4 hours. In one embodiment, T2 is about 2.5 hours. In one embodiment, T2 is about 2.6 hours. In one embodiment, T2 is about 2.7 hours. In one embodiment, T2 is about 2.8 hours. In one embodiment, T2 is about 2.9 hours. In one embodiment, T2 is about 3.0 hours. In one embodiment, T2 is about 3.1 hours. In one embodiment, T2 is about 3.2 hours. In one embodiment, T2 is about 3.3 hours. In one embodiment, T2 is about 3.4 hours. In one embodiment, T2 is about 3.6 hours. In one embodiment, T2 is about 3.7 hours. In one embodiment, T2 is about 3.8 hours. In one embodiment, T2 is about 3.9 hours. In one embodiment, T2 is about 4.0 hours. In one embodiment, T2 is about 4.1 hours. In one embodiment, T2 is about 4.2 hours. In one embodiment, T2 is about 4.3 hours. In one embodiment, T2 is about 4.4 hours. In one embodiment, T2 is about 4.5 hours. In one embodiment, T2 is about 4.6 hours. In one embodiment, T2 is about 4.7 hours. In one embodiment, T2 is about 4.8 hours. In one embodiment, T2 is about 4.9 hours. In one embodiment, T2 is about 5 hours.

[0307] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0308] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0309] In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm to 20.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is about 1 mm to 10.0 mm. In a more preferred embodiment, at T1, the peak thickness of the sedimentation front is about 1 mm to 5.0 mm. In a specific embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.1 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.3 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.4 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.5 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.6 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.7 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.8 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.9 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 1.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 3.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 4.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 5.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 6.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 7.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 8.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 9.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 10.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 12.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 13.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 14.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 15.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 16.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 17.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 18.0 mm.In one embodiment, at T1, the peak thickness of the sedimentation front is about 19.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 20.0 mm.

[0310] In one embodiment, at T2, the thickness peak of the sedimentation front is between about 2 mm and 25.0 mm. In a preferred embodiment, at T2, the thickness peak of the sedimentation front is between about 5 mm and 20.0 mm. In a more preferred embodiment, at T2, the thickness peak of the sedimentation front is between about 5 mm and 15.0 mm. In a specific embodiment, at T2, the thickness peak of the sedimentation front is at least 10 mm. In one embodiment, at T1, the thickness peak of the sedimentation front is about 0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 2.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 3.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 4.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 5.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 6.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 7.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 8.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 9.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 13.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 14.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 15.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 16.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 17.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 18.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 19.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 20.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 21.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 22.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 23.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 24.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 25.0 mm.

[0311] In one embodiment, the settling rate of the settling front is less than the peak thickness of 10 mm at about 1 hour and greater than the peak thickness of 18 mm at about 4 hours.

[0312] In one embodiment, the present invention further comprises a time T3, wherein at T3, the sedimentation of the saccharide conjugate adsorbed by the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is about 2 hours to 5 hours. In a preferred embodiment, T3 is about 3 hours to 5 hours. In a more preferred embodiment, T3 is about 4 hours to 5 hours. In one embodiment, T3 is about 2.0 hours. In one embodiment, T3 is about 2.1 hours. In one embodiment, T3 is about 2.2 hours. In one embodiment, T3 is about 2.3 hours. In one embodiment, T3 is about 2.4 hours. In one embodiment, T3 is about 2.5 hours. In one embodiment, T3 is about 2.6 hours. In one embodiment, T3 is about 2.7 hours. In one embodiment, T3 is about 2.8 hours. In one embodiment, T3 is about 2.9 hours. In one embodiment, T3 is about 3.0 hours. In one embodiment, T3 is about 3.1 hours. In one embodiment, T3 is about 3.2 hours. In one embodiment, T3 is about 3.3 hours. In one embodiment, T3 is about 3.4 hours. In one embodiment, T3 is about 3.5 hours. In one embodiment, T3 is about 3.6 hours. In one embodiment, T3 is about 3.7 hours. In one embodiment, T3 is about 3.8 hours. In one embodiment, T3 is about 3.9 hours. In one embodiment, T3 is about 4.0 hours. In one embodiment, T3 is about 4.1 hours. In one embodiment, T3 is about 4.2 hours. In one embodiment, T3 is about 4.4 hours. In one embodiment, T3 is about 4.5 hours. In one embodiment, T3 is about 4.6 hours. In one embodiment, T3 is about 4.7 hours. In one embodiment, T3 is about 4.8 hours. In one embodiment, T3 is about 4.9 hours. In one embodiment, T3 is about 5 hours.

[0313] In one embodiment, at T3, the sedimentation front is about 25 mm to 40 mm. In a preferred embodiment, at T3, the sedimentation front is about 30 mm to 40 mm. In a more preferred embodiment, at T3, the sedimentation front is about 35 mm to 40 mm. In one embodiment, the sedimentation front at T3 is about 25.0 mm. In one embodiment, the sedimentation front at T3 is about 26 mm. In one embodiment, the sedimentation front at T3 is about 27 mm. In one embodiment, the sedimentation front at T3 is about 28 mm. In one embodiment, the sedimentation front at T3 is about 29 mm. In one embodiment, the sedimentation front at T3 is about 30 mm. In one embodiment, the sedimentation front at T3 is about 31 mm. In one embodiment, the sedimentation front at T3 is about 32 mm. In one embodiment, the sedimentation front at T3 is about 33 mm. In one embodiment, the sedimentation front at T3 is about 34 mm. In one embodiment, the sedimentation front at T3 is about 35 mm. In one embodiment, the sedimentation front at T3 is about 36 mm. In one embodiment, the sedimentation front at T3 is about 37 mm. In one embodiment, the sedimentation front at T3 is about 38 mm. In one embodiment, the sedimentation front at T3 is about 39 mm. In one embodiment, the sedimentation front at T3 is about 40 mm.

[0314] In one embodiment, the composition has been allowed to stand for about 1 month. In one embodiment, the composition has been allowed to stand for at least 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.

[0315] In one embodiment, after T3, the composition is resuspended using about 1 to 10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended using about 1 to 5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended using about 1 to 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 1 manual shaking. In one embodiment, after T3, the composition is resuspended using about 2 manual shakings. In one embodiment, after T3, the composition is resuspended using about 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 4 manual shakings. In one embodiment, after T3, the composition is resuspended using about 5 manual shakings. In one embodiment, after T3, the composition is resuspended using about 6 manual shakings. In one embodiment, after T3, the composition is resuspended using about 7 manual shakings. In one embodiment, after T3, the composition is resuspended using about 8 manual shakings. In one embodiment, after T3, the composition is resuspended using about 9 manual shakings. In one embodiment, after T3, the composition is resuspended using about 10 manual shakings. In one embodiment, the composition comprises the formulation previously described.

[0316] In one embodiment, the present invention provides a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum adjuvant as a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; at time T2, Another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; and wherein the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in the liquid, wherein the measurement head comprises a pulsed near-infrared light source with a wavelength of about 880 nm, and has a synchronous transmission detector at 180° from the light source and a backscattering detector at 45° from the light source, the detectors moving along the height of the flat-bottomed cylindrical glass sample unit, and precipitate data is collected every 20 μm.

[0317] In one embodiment, the composition comprises at least 21 different glycoconjugates. In one embodiment, the composition comprises at least 22 different glycoconjugates. In one embodiment, the composition comprises at least 23 different glycoconjugates. In one embodiment, the composition comprises at least 24 different glycoconjugates. In one embodiment, the composition comprises at least 25 different glycoconjugates. In one embodiment, the composition comprises at least 26 different glycoconjugates. In one embodiment, the composition comprises at least 27 different glycoconjugates. In one embodiment, the composition comprises at least 28 different glycoconjugates. In one embodiment, the composition comprises at least 29 different glycoconjugates. In one embodiment, the composition comprises at least 30 different glycoconjugates. In one embodiment, the composition comprises at least 31 different glycoconjugates. In one embodiment, the composition comprises at least 32 different glycoconjugates. In one embodiment, the composition comprises at least 33 different glycoconjugates. In one embodiment, the composition comprises at least 34 different glycoconjugates. In one embodiment, the composition comprises at least 35 different glycoconjugates.

[0318] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.1 hour after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.3 hours. In one embodiment, T1 is about 0.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.5 hours after the sample reaches 45% clarity at the meniscus.In one embodiment, T1 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 4.0 hours after the sample reaches 45% clarity at the meniscus.

[0319] In one embodiment, T2 is about 1 to 5 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T2 is about 1 to 3 hours after the sample reaches 45% clarity at the meniscus. In a more preferred embodiment, T2 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In a specific embodiment, T2 is about 4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.0 hour after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.3 hours after the sample reaches 45% clarity at the meniscus.In one embodiment, T2 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 5 hours after the sample reaches 45% clarity at the meniscus.

[0320] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0321] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0322] In one embodiment, at T1, the peak thickness of the sedimentation front is between about 0 mm and 20.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is between about 1 mm and 10.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is between about 1 mm and 5.0 mm. In a more preferred embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.1 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.3 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.4 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.5 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.6 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.7 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.8 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.9 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 1.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 3.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 4.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 5.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 6.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 7.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 8.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 9.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 10.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 12.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 13.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 14.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 15.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 16.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 17.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 18.0 mm.In one embodiment, at T1, the peak thickness of the sedimentation front is about 19.0 mm. In one embodiment, at T1, the peak thickness of the first solid phase precipitate is about 20.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 20.0 mm.

[0323] In one embodiment, at T2, the thickness peak of the sedimentation front is about 2 mm to 25.0 mm. In a preferred embodiment, at T2, the thickness peak of the sedimentation front is about 5 mm to 20.0 mm. In a more preferred embodiment, at T2, the thickness peak of the sedimentation front is about 5 mm to 15.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 10 mm. In one embodiment, at T1, the thickness peak of the sedimentation front is about 0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 2.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 3.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 4.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 5.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 6.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 7.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 8.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 9.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 13.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 14.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 15.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 16.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 17.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 18.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 19.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 20.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 21.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 22.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 23.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 24.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 25.0 mm.

[0324] In one embodiment, the settling rate of the settling front is less than a peak thickness of 10 mm about 1 hour after the sample reaches 45% clarity at the meniscus and greater than a peak thickness of 18 mm about 4 hours after the sample reaches 45% clarity at the meniscus.

[0325] In one embodiment, the present invention further comprises a time T3, wherein at T3, the sedimentation of the saccharide conjugate adsorbed by the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is about 2 to 5 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T3 is about 3 to 5 hours after the sample reaches 45% clarity at the meniscus. In a more preferred embodiment, T3 is about 4 to 5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.2 hours after the sample reaches 45% clarity at the meniscus.In one embodiment, T3 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 5 hours after the sample reaches 45% clarity at the meniscus.

[0326] In one embodiment, at T3, the sedimentation front is about 25 mm to 40 mm. In a preferred embodiment, at T3, the sedimentation front is about 30 mm to 40 mm. In a more preferred embodiment, at T3, the sedimentation front is about 35 mm to 40 mm. In one embodiment, the sedimentation front at T3 is about 25.0 mm. In one embodiment, the sedimentation front at T3 is about 26 mm. In one embodiment, the sedimentation front at T3 is about 27 mm. In one embodiment, the sedimentation front at T3 is about 28 mm. In one embodiment, the sedimentation front at T3 is about 29 mm. In one embodiment, the sedimentation front at T3 is about 30 mm. In one embodiment, the sedimentation front at T3 is about 31 mm. In one embodiment, the sedimentation front at T3 is about 32 mm. In one embodiment, the sedimentation front at T3 is about 33 mm. In one embodiment, the sedimentation front at T3 is about 34 mm. In one embodiment, the sedimentation front at T3 is about 35 mm. In one embodiment, the sedimentation front at T3 is about 36 mm. In one embodiment, the sedimentation front at T3 is about 37 mm. In one embodiment, the sedimentation front at T3 is about 38 mm. In one embodiment, the sedimentation front at T3 is about 39 mm. In one embodiment, the sedimentation front at T3 is about 40 mm.

[0327] In one embodiment, the composition has been allowed to stand for about 1 month. In one embodiment, the composition has been allowed to stand for at least 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.

[0328] In one embodiment, after T3, the composition is resuspended using about 1 to 10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended using about 1 to 5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended using about 1 to 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 1 manual shaking. In one embodiment, after T3, the composition is resuspended using about 2 manual shakings. In one embodiment, after T3, the composition is resuspended using about 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 4 manual shakings. In one embodiment, after T3, the composition is resuspended using about 5 manual shakings. In one embodiment, after T3, the composition is resuspended using about 6 manual shakings. In one embodiment, after T3, the composition is resuspended using about 7 manual shakings. In one embodiment, after T3, the composition is resuspended using about 8 manual shakings. In one embodiment, after T3, the composition is resuspended using about 9 manual shakings. In one embodiment, after T3, the composition is resuspended using about 10 manual shakings. In one embodiment, the composition comprises the formulation previously described.

[0329] In one embodiment, the present invention provides a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum phosphate adjuvant as a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; at time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant settles from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; at time During time T2, another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant settles from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; and wherein the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in the liquid, wherein the measurement head comprises a pulsed near-infrared light source with a wavelength of about 880 nm and has a synchronous transmission detector 180° from the light source and a backscattering detector 45° from the light source, the detectors moving along the height of the flat-bottomed cylindrical glass sample unit, and precipitate data is collected every 20 μm.

[0330] In one embodiment, the container comprises at least 21 different glycoconjugates. In one embodiment, the container comprises at least 22 different glycoconjugates. In one embodiment, the container comprises at least 23 different glycoconjugates. In one embodiment, the container comprises at least 24 different glycoconjugates. In one embodiment, the container comprises at least 25 different glycoconjugates. In one embodiment, the container comprises at least 26 different glycoconjugates. In one embodiment, the container comprises at least 27 different glycoconjugates. In one embodiment, the container comprises at least 28 different glycoconjugates. In one embodiment, the container comprises at least 29 different glycoconjugates. In one embodiment, the container comprises at least 30 different glycoconjugates. In one embodiment, the container comprises at least 31 different glycoconjugates. In one embodiment, the container comprises at least 32 different glycoconjugates. In one embodiment, the container comprises at least 33 different glycoconjugates. In one embodiment, the container comprises at least 34 different glycoconjugates. In one embodiment, the container comprises at least 35 different glycoconjugates.

[0331] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T1 is about 0.01 to 4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.1 hour after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.3 hours. In one embodiment, T1 is about 0.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 0.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 1.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.5 hours after the sample reaches 45% clarity at the meniscus.In one embodiment, T1 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T1 is about 4.0 hours after the sample reaches 45% clarity at the meniscus.

[0332] In one embodiment, T2 is about 1 to 5 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T2 is about 1 to 3 hours after the sample reaches 45% clarity at the meniscus. In a more preferred embodiment, T2 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus. In a specific embodiment, T2 is about 4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.0 hour after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 1.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.3 hours after the sample reaches 45% clarity at the meniscus.In one embodiment, T2 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T2 is about 5 hours after the sample reaches 45% clarity at the meniscus.

[0333] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0334] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.

[0335] In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm to 20.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is about 1 mm to 10.0 mm. In a more preferred embodiment, at T1, the peak thickness of the sedimentation front is about 1 mm to 5.0 mm. In a specific embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.1 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.3 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.4 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.5 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.6 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.7 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.8 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 0.9 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 1.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 3.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 4.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 5.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 6.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 7.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 8.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 9.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 10.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 12.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 13.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 14.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 15.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 16.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 17.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 18.0 mm.In one embodiment, at T1, the peak thickness of the sedimentation front is about 19.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is about 20.0 mm.

[0336] In one embodiment, at T2, the thickness peak of the sedimentation front is between about 2 mm and 25.0 mm. In a preferred embodiment, at T2, the thickness peak of the sedimentation front is between about 5 mm and 20.0 mm. In a more preferred embodiment, at T2, the thickness peak of the sedimentation front is between about 5 mm and 15.0 mm. In a specific embodiment, at T2, the thickness peak of the sedimentation front is at least 10 mm. In one embodiment, at T1, the thickness peak of the sedimentation front is about 0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 2.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 3.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 4.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 5.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 6.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 7.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 8.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 9.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 13.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 14.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 15.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 16.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 17.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 18.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 19.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 20.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 21.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 22.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 23.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 24.0 mm. In one embodiment, at T2, the thickness peak of the sedimentation front is at least 25.0 mm.

[0337] In one embodiment, the settling rate of the settling front is less than a peak thickness of 10 mm about 1 hour after the sample reaches 45% clarity at the meniscus and greater than a peak thickness of 18 mm about 4 hours after the sample reaches 45% clarity at the meniscus.

[0338] In one embodiment, the present invention further comprises a time T3, wherein at T3, the sedimentation of the saccharide conjugate adsorbed by the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is about 2 to 5 hours after the sample reaches 45% clarity at the meniscus. In a preferred embodiment, T3 is about 3 to 5 hours after the sample reaches 45% clarity at the meniscus. In a more preferred embodiment, T3 is about 4 to 5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 2.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.2 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 3.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.0 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.1 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.2 hours after the sample reaches 45% clarity at the meniscus.In one embodiment, T3 is about 4.3 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.4 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.5 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.6 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.7 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.8 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 4.9 hours after the sample reaches 45% clarity at the meniscus. In one embodiment, T3 is about 5 hours after the sample reaches 45% clarity at the meniscus.

[0339] In one embodiment, at T3, the sedimentation front is about 25 mm to 40 mm. In a preferred embodiment, at T3, the sedimentation front is about 30 mm to 40 mm. In a more preferred embodiment, at T3, the sedimentation front is about 35 mm to 40 mm. In one embodiment, the sedimentation front at T3 is about 25.0 mm. In one embodiment, the sedimentation front at T3 is about 26 mm. In one embodiment, the sedimentation front at T3 is about 27 mm. In one embodiment, the sedimentation front at T3 is about 28 mm. In one embodiment, the sedimentation front at T3 is about 29 mm. In one embodiment, the sedimentation front at T3 is about 30 mm. In one embodiment, the sedimentation front at T3 is about 31 mm. In one embodiment, the sedimentation front at T3 is about 32 mm. In one embodiment, the sedimentation front at T3 is about 33 mm. In one embodiment, the sedimentation front at T3 is about 34 mm. In one embodiment, the sedimentation front at T3 is about 35 mm. In one embodiment, the sedimentation front at T3 is about 36 mm. In one embodiment, the sedimentation front at T3 is about 37 mm. In one embodiment, the sedimentation front at T3 is about 38 mm. In one embodiment, the sedimentation front at T3 is about 39 mm. In one embodiment, the sedimentation front at T3 is about 40 mm.

[0340] In one embodiment, the composition has been allowed to stand for about 1 month. In one embodiment, the composition has been allowed to stand for at least 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.

[0341] In one embodiment, after T3, the composition is resuspended using about 1 to 10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended using about 1 to 5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended using about 1 to 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 1 manual shaking. In one embodiment, after T3, the composition is resuspended using about 2 manual shakings. In one embodiment, after T3, the composition is resuspended using about 3 manual shakings. In one embodiment, after T3, the composition is resuspended using about 4 manual shakings. In one embodiment, after T3, the composition is resuspended using about 5 manual shakings. In one embodiment, after T3, the composition is resuspended using about 6 manual shakings. In one embodiment, after T3, the composition is resuspended using about 7 manual shakings. In one embodiment, after T3, the composition is resuspended using about 8 manual shakings. In one embodiment, after T3, the composition is resuspended using about 9 manual shakings. In one embodiment, after T3, the composition is resuspended using about 10 manual shakings. In one embodiment, the composition comprises the formulation previously described.

[0342] Figures 1 to 3 Provide sedimentation curves for comparative formulations and formulations of the present invention. In one embodiment, the sedimentation rate of the first solid phase sediment is less than the sedimentation rate of the second solid phase sediment. The formulations of the present invention settle at an appropriate rate to allow for manufacture, resuspension, and use. In specific embodiments, the formulations of the present invention have a faster sedimentation rate than the 20 serotype control formulations. In certain embodiments, the formulations of the present invention have a sedimentation rate that falls between 7 serotype control formulations and 20 serotype control formulations ( Figure 1 and Figure 2 In certain embodiments, the formulations of the present invention have a sedimentation velocity that falls between the sedimentation curves of the 7 serotype control formulations and the 25 serotype control formulations ( Figure 1 and Figure 3 In certain embodiments, the formulations of the present invention have a sedimentation velocity between the sedimentation curves of Figure 2 or Figure 3 Sedimentation velocity within the shaded area of , the formulations being exemplified by a number of matrices detailed in Table 1 below.

[0343] In one embodiment, the invention provides a syringe filled with any of the vaccine formulations disclosed herein.In certain embodiments, the syringe is siliconized and / or made of glass.

[0344] A typical dose of the vaccine formulation of the present invention for injection has a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, even more preferably a volume of about 0.5 mL.

[0345] Thus, the container or syringe as defined above is filled with a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, even more preferably a volume of about 0.5 mL of any of the vaccine formulations defined herein.

[0346] adjuvant

[0347] In some embodiments, the vaccine formulation disclosed herein may further include at least one, two or three adjuvants. In some embodiments, the vaccine formulation disclosed herein may further include at least one adjuvant. In some embodiments, the vaccine formulation disclosed herein may further include one adjuvant. In some embodiments, the vaccine formulation disclosed herein may further include two adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. Antigens may primarily serve as a delivery system, primarily as an immunomodulator, or have a strong combination of the two. Suitable adjuvants include those suitable for mammals (including humans).

[0348] Examples of known suitable delivery system adjuvants that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.

[0349] In one embodiment, the formulations disclosed herein comprise an aluminum salt (alum) as an adjuvant (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide). In a preferred embodiment, the vaccine formulations disclosed herein comprise aluminum phosphate or aluminum hydroxide as an adjuvant. In a preferred embodiment, the vaccine formulations disclosed herein comprise aluminum phosphate as an adjuvant.

[0350] Additional exemplary adjuvants that enhance the effectiveness of the vaccine formulations disclosed herein include, but are not limited to: (1) oil-in-water emulsion formulations (with or without other specific immunostimulants, such as muramyl peptides (see below) or bacterial cell wall components), such as, for example, (a) SAF, which contains 10% squalene, 0.4% Tween 80, 5% pluronic block polymer L121 and thr-MDP, microfluidized into a submicron emulsion or vortexed to produce an emulsion of larger particle size, and (b) RIBI TMAdjuvant system (RAS), (Ribi Immunochem, Hamilton, MT) containing 2% squalene, 0.2% Tween 80 and one or more bacterial cell wall components, such as monophosphoryl lipid A (MPL), trehalose dimycolate (TDM) and cell wall skeleton (CWS), preferably MPL + CWS (DETOX TM ); (2) Saponin adjuvants such as QS21, STIMULON TM (Cambridge Bioscience, Worcester, MA), (Isconova, Sweden) or (Commonwealth Serum Laboratories, Australia) or particles produced therefrom, such as ISCOMs (immunostimulating complexes), which may be free of additional detergents (e.g., WO 00 / 07621); (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO 99 / 44636)), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or 3-O-deacetylated MPL (3dMPL) (see, e.g., GB-2220221, EP0689454), optionally in the substantial absence of alum when Streptococcus pneumoniae saccharide is used (see, e.g., WO 00 / 56358); (6) 3dMPL in combination with, for example, QS21 and / or in oil-in-water emulsions (see, for example, EP0835318, EP0735898, EP0761231); (7) polyoxyethylene ethers or polyoxyethylene esters (see, for example, WO 99 / 52549); (8) polyoxyethylene sorbitan ester surfactants in combination with octoxynol (e.g., WO 01 / 21207) or polyoxyethylene alkyl ether or ester surfactants in combination with at least one additional nonionic surfactant (such as octoxynol) (e.g., WO 01 / 21152); (9) saponins and immunostimulatory oligonucleotides (e.g., CpG oligonucleotides) (e.g., WO 00 / 62800); (10) particles of immunostimulatory agents and metal salts (see, for example, WO 00 / 23105); (11) saponins and oil-in-water emulsions (e.g., WO 99 / 11241); (12) saponin (e.g., QS21) + 3dMPL + IM2 (optionally, + sterol) (e.g., WO 98 / 57659); (13) other substances that act as immunostimulants to enhance the efficacy of the composition. Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutamyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphinoyl)-ethylamine MTP-PE), etc. In one embodiment of the present invention, the vaccine formulation as disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotide refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and therefore, unless otherwise specified, these terms are used interchangeably.Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally within certain preferred base contexts. The methylation state of a CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide that contains a 5' unmethylated cytosine linked to a 3' guanine by a phosphate bond and activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system through TLR9, but not as strongly as one or more CpG motifs that are unmethylated. A CpG immunostimulatory oligonucleotide may comprise one or more palindromes, which in turn may comprise CpG dinucleotides. CpG oligonucleotides are described in numerous issued patents, published patent applications, and other publications, including U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, and 6,339,068.

[0351] In one embodiment of the invention, the vaccine formulation as disclosed herein comprises any one of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO 2010 / 125480.

[0352] Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as classes A, B, C and P, and are described in more detail on page 3, line 22 to page 12, line 36 of WO 2010 / 125480. The methods of the present invention encompass the use of these different classes of CpG immunostimulatory oligonucleotides.

[0353] In one embodiment of the present invention, the vaccine formulation as disclosed herein comprises a class A CpG oligonucleotide. Preferably, the "class A" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of class A oligonucleotides include: 5'G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO: 2); wherein "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.

[0354] In one embodiment of the invention, the vaccine formulation as disclosed herein comprises a Class B CpG oligonucleotide. In one embodiment, the CpG oligonucleotide used in the present invention is a Class B CpG oligonucleotide represented by at least the following formula:

[0355] 5'X1X2CGX3X4 3', wherein X1, X2, X3 and X4 are nucleotides. In one embodiment, X2 is adenine, guanine or thymine. In another embodiment, X3 is cytosine, adenine or thymine.

[0356] The B-class CpG oligonucleotide sequences of the present invention are those disclosed in the above broad descriptions and in WO 96 / 02555, WO 98 / 18810, and U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, and 6,339,068. Exemplary sequences include, but are not limited to, those disclosed in these latter applications and patents.

[0357] In one embodiment, a "class B" CpG oligonucleotide of the invention has the following nucleic acid sequence:

[0358] 5'TCGTCGTTTTTCGGTGCTTT 3' (SEQ ID NO:3), or

[0359] 5'TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO:4), or

[0360] 5'TCGTCGTTTTGTCGTTTTGTCGTT 3' (SEQ ID NO:5), or

[0361] 5'TCGTCGTTTCGTCGTTTTGTCGTT 3' (SEQ ID NO:6), or

[0362] 5'TCGTCGTTTTGTCGTTTTTTTCGA 3' (SEQ ID NO:7).

[0363] In any of these sequences, all bonds may be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more of the bonds may be phosphodiester, preferably between the "C" and "G" of the CpG motif for preparing semi-soft CpG oligonucleotides. In any of these sequences, ethyl-uridine or a halogen may replace the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0364] Some non-limiting examples of B-class oligonucleotides include: 5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3' (SEQ ID NO: 8), or

[0365] 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3'(SEQ ID NO:9), or

[0366] 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:10), or

[0367] 5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:11), or

[0368] 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A 3' (SEQ ID NO: 12),

[0369] Wherein “*” refers to a phosphorothioate bond.

[0370] In one embodiment of the invention, the vaccine formulation as disclosed herein comprises a C-class CpG oligonucleotide. In one embodiment, the "C-class" CpG oligonucleotide of the invention has the following nucleic acid sequence:

[0371] 5'TCGCGTCGTTCGGCGCGCGCCG 3' (SEQ ID NO:13), or

[0372] 5'TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:14), or

[0373] 5'TCGGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:15), or

[0374] 5'TCGGACGTTCGGCGCGCCG 3' (SEQ ID NO:16), or

[0375] 5'TCGCGTCGTTCGGCGCGCCG 3' (SEQ ID NO:17), or

[0376] 5'TCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:18), or

[0377] 5'TCGACGTTCGGCGCGCCG 3' (SEQ ID NO:19), or

[0378] 5'TCGCGTCGTTCGGCGCCG 3' (SEQ ID NO:20), or

[0379] 5'TCGCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:21), or

[0380] 5'TCGTCGTTTTCGGCGCGCGCCG 3' (SEQ ID NO:22), or

[0381] 5'TCGTCGTTTTCGGCGGCCGCCG 3' (SEQ ID NO:23), or

[0382] 5'TCGTCGTTTTACGGCGCCGTGCCG 3'(SEQ ID NO:24)), or

[0383] 5'TCGTCGTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 25).

[0384] In any of these sequences, all bonds may be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more of the bonds may be phosphodiester, preferably between the "C" and "G" of the CpG motif for preparing a semi-soft CpG oligonucleotide.

[0385] Some non-limiting examples of C-class oligonucleotides include:

[0386] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 26), or

[0387] 5'T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 27), or

[0388] 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 28), or

[0389] 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3' (SEQ ID NO: 29), or

[0390] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3' (SEQ ID NO:30), or

[0391] 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 31), or

[0392] 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3' (SEQ ID NO: 32), or

[0393] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3' (SEQ ID NO: 33), or

[0394] 5'T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 34), or

[0395] 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G 3'(SEQ ID NO:35), or

[0396] 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G 3'(SEQ ID NO:36), or

[0397] 5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G 3' (SEQ ID NO: 37), or

[0398] 5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3' (SEQ ID NO: 38),

[0399] Wherein “*” refers to a phosphorothioate bond and “_” refers to a phosphodiester bond.

[0400] In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0401] In one embodiment of the invention, the vaccine formulation as disclosed herein comprises a P-class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide used in the present invention is a P-class CpG oligonucleotide containing a 5'TLR activation domain and at least two palindromes, one palindrome being a 5' palindrome of at least 6 nucleotides in length and directly or via a spacer connected to a 3' palindrome of at least 8 nucleotides in length, wherein the oligonucleotide comprises at least one YpR dinucleotide. In one embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO: 27). In one embodiment, the P-class CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT or TTTT. In another embodiment, the TLR activation domain is within the 5' palindrome. In another embodiment, the TLR activation domain is immediately 5' of the 5' palindrome.

[0402] In one embodiment, the "P-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).

[0403] In the described sequences, all bonds may be phosphorothioate bonds. In another embodiment, one or more of the bonds may be phosphodiester bonds, preferably between the "C" and "G" of the CpG motif for preparing semi-soft CpG oligonucleotides. In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0404] Non-limiting examples of P-class oligonucleotides include:

[0405] 5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:40)

[0406] Wherein “*” refers to a phosphorothioate bond and “_” refers to a phosphodiester bond.

[0407] In one embodiment, the oligonucleotide comprises at least one phosphorothioate bond. In another embodiment, all internucleotide bonds of the oligonucleotide are phosphorothioate bonds. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like bond. In another embodiment, the phosphodiester-like bond is a phosphodiester bond. In another embodiment, the lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

[0408] In one embodiment, all internucleotide bonds of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides, as described in WO 2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are made resistant to degradation (e.g., stabilized). "Stabilized oligonucleotides" refer to oligonucleotides that are relatively resistant to degradation in vivo (e.g., degradation via exonucleases or endonucleases). Nucleic acid stabilization can be achieved via backbone modifications. Oligonucleotides with phosphorothioate bonds provide maximum activity and protect the oligonucleotide from degradation by intracellular exonucleases and endonucleases.

[0409] Immunostimulatory oligonucleotides can have a chimeric backbone having a combination of a phosphodiester and a thiophosphate bond. For purposes of the present invention, a chimeric backbone refers to a partially stabilized backbone wherein at least one internucleotide bond is a phosphodiester or phosphodiester-like bond, and wherein at least another other internucleotide bond is a stabilized internucleotide bond wherein at least one phosphodiester or phosphodiester-like bond is different from at least one stabilized bond. When the phosphodiester bond is preferably located within a CpG motif, such molecules are referred to as "semi-soft," as described in WO 2007 / 026190.

[0410] Other modified oligonucleotides include combinations of phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, and / or p-ethoxy linkages.

[0411] Mixed backbone modified ODNs can be synthesized as described in WO 2007 / 026190.

[0412] In some embodiments, the CpG oligonucleotide is a CpG oligonucleotide having a length of 6 to 100 nucleotides, preferably 8 to 30 nucleotides. ...

[0413] In one embodiment, the CpG oligonucleotides disclosed herein comprise substitutions or modifications, such as in the base and / or sugar, as described in paragraphs 134 to 147 of WO 2007 / 026190.

[0414] In one embodiment, the CpG oligonucleotides of the present invention are chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990) Chem. Rev. 90: 543; S. Agrawal, ed., Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36: 107-129; and Hunziker et al. (1995) Mod. Synth. Methods 7: 331-417. The oligonucleotides according to the present invention may have one or more modifications, wherein each modification is located at a specific phosphodiester internucleoside bridge and / or a specific β-D-ribose unit and / or a specific natural nucleobase position compared to an oligonucleotide of the same sequence consisting of natural DNA or RNA.

[0415] In some embodiments of the invention, the CpG-containing nucleic acid can be simply mixed with the immunogenic carrier according to methods known to those skilled in the art (see, for example, WO 03 / 024480).

[0416] In a specific embodiment of the present invention, any one of the vaccine formulations disclosed herein comprises 2 μg to 100mg CpG oligonucleotides. In a specific embodiment of the present invention, the vaccine formulation of the present invention comprises 0.1mg to 50mg CpG oligonucleotides, preferably 0.2mg to 10mg CpG oligonucleotides, more preferably 0.3mg to 5mg CpG oligonucleotides. In a specific embodiment of the present invention, the vaccine formulation of the present invention comprises 0.3mg to 5mg CpG oligonucleotides. Even preferably, the vaccine formulation of the present invention may comprise 0.5 to 2mg CpG oligonucleotides. Most preferably, the vaccine formulation of the present invention may comprise 0.75 to 1.5mg CpG oligonucleotides. In a preferred embodiment, any one of the vaccine formulations disclosed herein may comprise approximately 1mg CpG oligonucleotides.

[0417] Liposomal adjuvants

[0418] In one embodiment, the adjuvant comprises a liposome. As used herein, "liposome" refers to a closed bilayer membrane containing a trapped aqueous solution volume. Liposomes can also be unilamellar vesicles having a single membrane bilayer or multilamellar vesicles having multiple membrane bilayers, each separated from the next by an aqueous layer. The resulting membrane bilayer is structured so that the hydrophobic (non-polar) tails of the lipids are oriented toward the center of the bilayer, while the hydrophilic (polar) heads of the lipids are oriented toward the aqueous phase. Suitable hydrophilic polymers for surrounding liposomes include, but are not limited to, PEG, polyvinyl pyrrolidone, polyvinyl methyl ether, polymethyl oxazoline, polyethyl oxazoline, polyhydroxypropyl oxazoline, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, polyhydroxypropyl methacrylate, polyhydroxyethyl acrylate, hydroxymethyl cellulose, hydroxyethyl cellulose, polyethylene glycol, polyasparagine, and the hydrophilic peptide sequences described in U.S. Patents 6,316,024, 6,126,966, 6,056,973 and 6,043,094. Liposomes can be prepared without hydrophilic polymers. Therefore, liposome adjuvants may or may not contain hydrophilic polymers. Liposomes may comprise any lipid or lipid combination known in the art. For example, the vesicle-forming lipids can be naturally occurring or synthetic lipids, including phospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, and sphingomyelin, as disclosed in U.S. Pat. Nos. 6,056,973 and 5,874,104.

[0419] Liposomal adjuvants include liposomes. When liposomal adjuvants are used in vaccine formulations, water-soluble antigens (such as proteins, peptides, nucleic acids or carbohydrates) are encapsulated in the internal aqueous solution volume of the liposome (see Tretiakova et al., Liposomes as Adjuvants and Vaccine Delivery Systems.Biochem (Mosc) Suppl Ser AM Embbr Cell Biol.2022; 16 (1): 1-20). Alternatively, when liposomal adjuvants are combined with lipophilic / amphiphilic substances (such as lipopeptides and glycolipids), these agents are embedded in the lipid bilayer (ibid). Depending on the type of molecule combined with the liposomal adjuvant, additional interactions may include association with the liposome surface by adsorption or covalent bonding (ibid). Therefore, in some embodiments, liposomal adjuvants include water-soluble antigens, which are encapsulated in the internal aqueous solution volume of the liposome. In some embodiments, the water-soluble antigen is a protein, peptide, nucleic acid or carbohydrate. In some embodiments, the liposomal adjuvant is combined with a lipophilic or amphiphilic molecule, and these molecules are embedded in the lipid bilayer. In some embodiments, the lipophilic or amphiphilic molecule embedded in the lipid bilayer of the liposome comprises cholesterol, a fatty acid, or a lipid. In some embodiments, the lipophilic or amphiphilic molecule embedded in the lipid bilayer is lipidated.

[0420] The use of any liposomal adjuvant is contemplated herein. In one embodiment, the liposomal adjuvant is AS01. AS01 includes 3-O-deacetylated monophosphonyl lipid A (3D-MPL) and QS21 and cholesterol in a "quenched form" (see U.S. Patent No. 10,039,823). In AS01, the lipid bilayer comprises natural lipids that are "non-crystalline" at room temperature, such as dioleoylphosphatidylcholine, cholesterol, MPLA and QS-21 (see U.S. Patent No. 10,039,823 and WO 1996 / 033739). During the manufacture of AS01, small unilamellar vesicles (SUVs) are first created, and then purified QS-21 is added to the SUVs. QS-21 confers unique properties because it binds to liposomal cholesterol, where it causes perforations (pores) or other permanent structural changes in the liposomes (see, e.g., Paepenmuller et al., 2014, Int. J. Pharm., 475: 138-46). The reduced amount of free QS-21 is likely to result in a reduction in the local injection pain typically caused by free QS-21 (see, e.g., Waite et al., 2001, Vaccine, 19: 3957-67; Mbawuike et al., 2007, Vaccine, 25: 3263-69). In some embodiments, AS01 contains cholesterol (sterol) at a molar % concentration of between about 1 and about 50% (mol / mol), preferably between about 20 and about 25% (mol / mol) (see U.S. Patent No. 10,039,823). In some embodiments, AS01 (including, for example, AS01A, AS01B, AS01C, AS01D, AS01E, and AS015) comprises dioleoylphosphatidylcholine (DOPC), cholesterol, MPLA (e.g., 3D-MPL), and QS-21. In further embodiments, the liposomal adjuvant is selected from AS01A, AS01B, AS01C, AS01D, AS01E, and AS015. In one embodiment, the liposomal adjuvant is AS01A. In some embodiments, AS01A comprises 3D-MPL, a Toll-like receptor 4 agonist, and QS-21. In one embodiment, the liposomal adjuvant is AS01B. In some embodiments, AS01B comprises 1000 μg DOPC per dose, 250 μg cholesterol per dose, 50 μg 3D-MPL per dose, 50 μg QS21 per dose, phosphate NaCl buffer, and water in a volume of 0.5 ml (see U.S. Patent No. 10,039,823). In one embodiment, the liposomal adjuvant is AS01E. In some embodiments, AS01E comprises the same components as AS01B, but at lower concentrations.In some embodiments, AS01E comprises 500 μg dioleoylphosphatidylcholine (DOPC) per dose, 125 μg cholesterol per dose, 25 μg 3D-MPL per dose, 25 μg QS21 per dose, phosphate NaCl buffer, and 0.5 ml of water (see U.S. Patent No. 10,039,823). In one embodiment, the liposomal adjuvant is AS015. In some embodiments, AS015 comprises dioleoylphosphatidylcholine (DOPC), cholesterol, 3D-MPL, QS-21, and CpG.

[0421] In one embodiment, the liposomal adjuvant is LiNA-1. In some embodiments, LiNA-1 comprises MPLA and saponin. In some embodiments, LiNA-1 comprises MPLA and QS-21. In other embodiments, LiNA-1 comprises a phosphorylated hexaacyl disaccharide. (i.e., purchased from Monophosphono lipid A (synthetic) of polar lipids) and QS-21. In another specific embodiment, LiNA-1 comprises QS-21, cholesterol and DOPC. In another specific embodiment, LiNA-1 comprises 3D- QS-21, cholesterol, and DOPC. In another specific embodiment, LiNA-1 comprises the following components per 0.5 mL dose: (i) 50 μg MPLA (i.e., 3D- ), (ii) 250 μg cholesterol, (iii) 50 μg QS-21, and (iv) 1000 μg DOPC. In another specific embodiment, LiNA-1 comprises the following components per 0.5 mL dose: (i) 50 μg MPLA (i.e., ), (ii) 250 μg cholesterol, (iii) 50 μg QS-21, and (iv) 1000 μg DOPC. In some embodiments, the LiNA-1 formulation can be a 0.0625X concentration of LiNA-1 (0.0625XLiNA-1), a 0.125X concentration of LiNA-1 (0.125XLiNA-1), a 0.25X concentration of LiNA-1 (0.25XLiNA-1), a 0.5X concentration of LiNA-1 (0.5XLiNA-1), a 1X concentration of LiNA-1 (1XLiNA-1), a 2X concentration of LiNA-1 (2XLiNA-1), a 3X concentration of LiNA-1 (3XLiNA-1), or a 4X concentration of LiNA-1 (4XLiNA-1).

[0422] In specific embodiments, the liposomal adjuvant is ALFQ. In some embodiments, ALFQ comprises MPLA and saponin (see U.S. Patent No. 10,434,167). In some embodiments, ALFQ comprises a lipid bilayer comprising phospholipids, wherein the hydrocarbon chains have a melting temperature in water of ≥23°C. In other embodiments, ALFQ comprises cholesterol at a molar % concentration greater than about 50% (mol / mol). In certain embodiments, ALFQ comprises between about 55% and about 71% (mol / mol) cholesterol. In specific embodiments, ALFQ comprises about 55% (mol / mol) cholesterol. In some embodiments, ALFQ comprises MPLA and QS-21. In other embodiments, ALFQ comprises monophosphono 3-deacylated lipid A phosphorylated hexaacyl disaccharide (3D- That is, purchased from Monophosphono 3-deacylated lipid A (synthetic) of polar lipids and saponin. In another specific embodiment, ALFQ comprises 3D- QS-21, dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG) and cholesterol. In another specific embodiment, ALFQ comprises: (i) 7.0 mg / mL DMPC, (ii) 0.78 mg / ml DMPG, (iii) 5.4 mg / ml cholesterol, (iv) 0.2 mg / mL MPLA (3D- ), and (v) 0.1 mg / ml QS-21.

[0423] In specific embodiments, the liposomal adjuvant is LiNA-2. In some embodiments, LiNA-2 comprises MPLA and saponin. In some embodiments, LiNA-2 comprises a lipid bilayer comprising phospholipids, wherein the hydrocarbon chains have a melting temperature in water of ≥23°C. In other embodiments, LiNA-2 comprises cholesterol at a molar % concentration greater than about 50% (mol / mol). In certain embodiments, LiNA-2 comprises cholesterol at about 55% to about 71% (mol / mol). In specific embodiments, LiNA-2 comprises about 55% (mol / mol) cholesterol. In some embodiments, LiNA-2 comprises MPLA and QS-21. In other embodiments, LiNA-2 comprises monophosphoryl 3-deacylated lipid A phosphorylated hexaacyl disaccharide (3D- In another specific embodiment, LiNA-2 comprises 3D- QS-21, dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), and cholesterol.

[0424] In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer at a concentration between about 1 mM and about 100 mM. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer between about 1 mM and 10 mM. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer of about 5 mM, about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, or about 50 mM. In a specific embodiment, the LiNA-2 adjuvant comprises about 10 mM phosphate buffer. In another specific embodiment, the LiNA-2 adjuvant comprises 3D- QS-21, DMPC, DMPG, cholesterol and phosphate buffer. In another specific embodiment, the LiNA-2 adjuvant comprises 3D- QS-21, DMPC, DMPG, cholesterol and 10 mM phosphate buffer.

[0425] In some embodiments, the LiNA-2 adjuvant comprises sodium chloride. In some embodiments, the LiNA-2 adjuvant comprises between about 50 mM and about 500 mM sodium chloride. In other embodiments, the LiNA-2 adjuvant comprises about 25 mM, about 50 mM, about 75 mM, about 100 mM, about 125 mM, about 150 mM, about 175 mM, about 200 mM, about 225 mM, or about 250 mM sodium chloride. In a specific aspect, the LiNA-2 adjuvant comprises about 150 mM sodium chloride. In one embodiment, the LiNA-2 adjuvant comprises 3D- QS-21, DMPC, DMPG, cholesterol, sodium chloride and phosphate buffer. In another specific embodiment, the LiNA-2 adjuvant comprises 3D- QS-21, DMPC, DMPG, cholesterol, 150 mM sodium chloride, and 10 mM phosphate buffer.

[0426] In one embodiment, the adjuvant formulation is 0.5XLiNA-2 (also known as ALFQ), wherein 0.5XLiNA-2 can be homogeneous or heterogeneous and comprises: (i) 7.0 mg / mL DMPC, (ii) 0.78 mg / ml DMPG, (iii) 5.4 mg / ml cholesterol, (iv) 0.2 mg / mL MPLA (3D- ), and (v) 0.1 mg / ml QS-21. In another embodiment, the adjuvant formulation is 1XLiNA-2, wherein 1XLiNA-2 can be homogeneous or heterogeneous and comprises: (i) 14±7 mg / mL DMPC, (ii) 1.6±0.8 mg / ml DMPG, (iii) 11±6 mg / ml cholesterol, (iv) 0.40±0.20 mg / mL MPLA (3D- ), and (v) 0.20±0.10 mg / ml QS-21. In another embodiment, the adjuvant formulation is 2XLiNA-2, wherein 2XLiNA-2 can be homogeneous or heterogeneous and comprises: (i) 28±14 mg / mL DMPC, (ii) 3.2±1.6 mg / ml DMPG, (iii) 22±11 mg / ml cholesterol, (iv) 0.80±0.40 mg / mL MPLA (3D- ), and (v) 0.40±0.20 mg / ml QS-21. In some embodiments, the LiNA-2 homogeneous or heterogeneous adjuvant formulation can be 0.0625X concentration of LiNA-2 (0.0625XLiNA-2), 0.125X concentration of LiNA-2 (0.125XLiNA-2), 0.25X concentration of LiNA-2 (0.25XLiNA-2), 0.5X concentration of LiNA-2 (0.5XLiNA-2), 1X concentration of LiNA-2 (1XLiNA-2), 2X concentration of LiNA-2 (2XLiNA-2), 3X concentration of LiNA-2 (3XLiNA-2), or 4X concentration of LiNA-2 (4XLiNA-2).

[0427] In some embodiments, the liposomal adjuvant is CAF09 (see Korsholm et al., Induction of CD8+ T-cell responses against subunit antigens by the novel cationic liposomal CAF09 adjuvant, Vaccine, Vol. 32, No. 31, 2014, pp. 3927-3935). In some embodiments, the liposomal adjuvant CAF09 comprises dimethyloctadecyl ammonium (DDA), monomycin (MMG)-1, and polyinosinic-polycytidylic acid (poly I:C).

[0428] Phosphatidylcholine phospholipids (PC) / phosphatidylglycerol phospholipids (PG): In one embodiment, the adjuvant comprises liposomes, and the liposomes comprise phosphatidylcholine phospholipids (PC). In some embodiments, the PC is selected from the group consisting of dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), and distearoylphosphatidylcholine (DSPC). In one embodiment, the adjuvant comprises liposomes, and the liposomes comprise phosphatidylglycerol phospholipids (PG). In some embodiments, the PG is selected from the group consisting of dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), and distearoylphosphatidylglycerol (DSPG). In another embodiment, the adjuvant comprises a combination of (i) a phosphatidylcholine phospholipid (PC) selected from dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), and distearoylphosphatidylcholine (DSPC), and (ii) a phosphatidylglycerol phospholipid (PG) selected from dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), and distearoylphosphatidylglycerol (DSPG). In some embodiments, the liposome composition of the adjuvant has a PC / PG ratio (mol / mol) of about 0.5:1, about 1:1, about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, or about 15:1. In a specific embodiment, the liposomal composition of the adjuvant comprises PC and PG, wherein PC is dimyristoylphosphatidylcholine (DMPC) and PG is dimyristoylphosphatidylglycerol (DMPG), with a PC / PG molar ratio (mol / mol) of about 9:1.

[0429] Cholesterol: In some embodiments, wherein the adjuvant comprises liposomes, the liposomes of the adjuvant comprise cholesterol. In one embodiment, the liposome composition of the adjuvant formulation comprises cholesterol at a molar % concentration of greater than 50% (mol / mol), such as from about 55% to about 71% (mol / mol). In a specific embodiment, the adjuvant comprises liposomes comprising about 55% (mol / mol) cholesterol.

[0430] Cholesterol and phospholipids: In some embodiments, wherein the adjuvant comprises liposomes, the liposomes of the adjuvant comprise cholesterol and phospholipids. In some embodiments, the molar ratio of cholesterol (b) to phospholipid (a) is from about 55:45 to about 71:29. In one embodiment, the molar ratio of cholesterol (b) to phospholipid (a) is from about 55:50, about 55:45, about 55:40, about 55:35, or about 55:30. In a specific embodiment, the molar ratio of cholesterol (b) to phospholipid (a) is about 55:45.

[0431] Vesicular material: In some embodiments, wherein the adjuvant comprises liposomes, the liposomes comprise multilamellar vesicles (MLVs) or small unilamellar vesicles (SUVs), wherein the small unilamellar vesicles have a diameter of about 50 to about 100 nm, and wherein the multilamellar vesicles have a diameter of about 1 to about 4 μm.

[0432] MPLA: In another embodiment, wherein the adjuvant comprises liposomes, the liposome composition comprises lipid A. In another embodiment, wherein the adjuvant comprises liposomes, the liposome composition comprises monophosphono lipid A (MPLA). In one embodiment, the liposome composition comprises penta-acylated MPLA (P-MPLA). In another embodiment, the liposome composition comprises monophosphono lipid A phosphorylated hexaacyl disaccharide. In a specific embodiment, the MPLA is a monophosphono 3-deacylated lipid A phosphorylated hexaacyl disaccharide (3D- In one embodiment, the liposome composition comprises about 5 mg or less, about 4 mg or less, about 3 mg or less, about 2 mg or less, about 1 mg or less, about 0.9 mg or less, about 0.8 mg or less, about 0.7 mg or less, about 0.6 mg or less, about 0.5 mg or less, about 0.4 mg or less, about 0.3 mg or less, about 0.2 mg or less, about 0.1 mg or less, about 0.09 mg or less, about 0.08 mg or less, about 0.07 mg or less, about 0.06 mg or less, about 0.05 mg or less, about 0.04 mg or less, about 0.03 mg or less, about 0.02 mg or less, or about 0.01 mg or less of MPLA, or 3D- etc. (total weight / ml liposome suspension).

[0433] MPLA and phospholipids: In one embodiment, wherein the adjuvant comprises liposomes, the liposomes comprise MPLA and phospholipids. In another embodiment, wherein the adjuvant comprises liposomes, the liposomes comprise or 3D- In one embodiment, the adjuvanted liposome composition has a MPLA:phospholipid molar ratio of about 1:5.6 to about 1:880, or about 1:88 to about 1:220. In one embodiment, the adjuvanted liposome composition comprises PC and PG, wherein PC is dimyristoylphosphatidylcholine (DMPC) and PG is dimyristoylphosphatidylglycerol (DMPG), having a MPLA:phospholipid molar ratio of about 1:220, about 1:88 or about 1:5.6, specifically 1:88. In one embodiment, the adjuvanted liposome composition comprises DMPC, DMPG and 3D- and having a 3D- In one embodiment, the liposome composition of the adjuvant comprises DMPC, DMPG and 3D- and having a 3D- In another embodiment, the liposome composition of the adjuvant comprises DMPC, DMPG and 3D- and has a 3D ratio between about 1:80 and about 1:95. In another specific embodiment, the liposome composition of the adjuvant formulation comprises DMPC, DMPG and 3D- And has a 3D- Phospholipid molar ratio.

[0434] Saponin: In another embodiment, the adjuvant comprises liposomes containing a saponin. In some embodiments, the saponin is Quil A, a derivative thereof, or any purified component thereof (e.g., QS-7, QS-18, QS-21, or a mixture thereof). In a specific embodiment, the adjuvant comprises liposomes containing QS-21. In some embodiments, the adjuvant formulation has a saponin content (total weight per ml of liposomal suspension) of about 1 mg or less, about 0.9 mg or less, about 0.8 mg or less, about 0.7 mg or less, about 0.6 mg or less, about 0.5 mg or less, about 0.4 mg or less, about 0.3 mg or less, about 0.2 mg or less, about 0.1 mg or less, about 0.09 mg or less, about 0.08 mg or less, about 0.07 mg or less, about 0.06 mg or less, about 0.05 mg or less, about 0.04 mg or less, about 0.03 mg or less, about 0.02 mg or less, or about 0.01 mg or less. In a specific embodiment, the adjuvant formulation comprises a saponin content of about 0.15 to 0.4 mg / ml.

[0435] MPLA and Saponin: In another embodiment, wherein the adjuvant comprises liposomes, the adjuvant comprises a liposome composition comprising MPLA and at least one saponin (e.g., QS-21). In another embodiment, the adjuvant comprises a liposome composition comprising monophosphonyl lipid A (MPLA) and at least one saponin, wherein the liposome composition comprises: i) a lipid bilayer comprising phospholipids and ii) cholesterol at a molar % concentration...

Claims

1. A preparation comprising: (i) at least 21 different glycoconjugates; (ii) a succinate or histidine buffer having a pH in the range of 5.0 to 7.5; (iii) calcium chloride, sodium chloride, calcium chloride and / or sodium phosphate; (iv) surfactant; and (v) Adjuvant.

2. A preparation comprising: (i) at least 21 different glycoconjugates; (ii) a succinate buffer having a pH in the range of 5.0 to 7.5; (iii) calcium chloride; (iv) sodium chloride; (v) surfactants; and (vi) Adjuvant.

3. A preparation comprising: (i) at least 21 different glycoconjugates; (ii) a succinate buffer having a pH in the range of 5.0 to 7.5; (iii) sodium chloride; (iv) sodium phosphate; (v) surfactants; and (vi) Adjuvant.

4. A preparation comprising: (i) at least 21 different glycoconjugates; (ii) a histidine buffer having a pH in the range of 5.0 to 7.5; (iii) sodium chloride; (iv) surfactant; and (v) Adjuvant.

5. The formulation of any one of claims 1 to 4 comprising 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 different glycoconjugates.

6. The formulation according to any one of claims 1 to 5, wherein the formulation comprises 24 different glycoproteins.

7. The formulation according to any one of claims 1 to 6, wherein the formulation comprises 25 different glycoproteins.

8. The formulation according to any one of claims 1 to 7, wherein the glycoconjugate is a glycoconjugate of Streptococcus pneumoniae polysaccharide.

9. The formulation of any one of claims 1 to 8, wherein the saccharide conjugate comprises at least one saccharide conjugate derived from a S. pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

10. The formulation of any one of claims 1 to 9, wherein the glycoconjugate comprises a diphtheria cross-reactive substance (CRM) 197 ), diphtheria toxin (DT), tetanus toxoid (TT), sterol carrier protein (SCP), Haemophilus influenzae (H.influenzae) protein D (PD) or rhizobium avidin protein (CP1).

11. The formulation of any one of claims 1 to 10, wherein the at least 21 saccharide conjugates include at least saccharide conjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.

12. The formulation of claim 11, wherein the S. pneumoniae serotype is conjugated to a CRM 197 .

13. The formulation of claim 11, wherein the at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 5, and 7F.

14. The formulation of claim 13, wherein S. pneumoniae serotype 1, 4, 5, 7F, 9V and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT, and S. pneumoniae serotype 19F is conjugated to DT.

15. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, and 19A.

16. The formulation of claim 15, wherein the S. pneumoniae serotype is conjugated to a CRM 197 .

17. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F, and 33F.

18. The formulation of claim 17, wherein the S. pneumoniae serotype is conjugated to a CRM 197 .

19. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F.

20. The formulation of claim 19, wherein the S. pneumoniae serotype is conjugated to a CRM 197 .

21. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.

22. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.

23. The formulation of claim 22, wherein the S. pneumoniae serotype is conjugated to a CRM 197 .

24. The formulation of claim 11, wherein the at least 25 glycoconjugates further include glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B.

25. The formulation of claim 24, wherein the S. pneumoniae serotype is conjugated to a CRM 197 .

26. The formulation of claim 24, wherein S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to a CRM. 197 , and S. pneumoniae serotype 3 conjugated to SCP.

27. The formulation of claim 11, wherein the at least 25 saccharide conjugates further include saccharide conjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F, and 33F.

28. The formulation of claim 27, wherein at least two of the S. pneumoniae serotypes are conjugated to TT.

29. The formulation of claim 28, wherein the at least two S. pneumoniae serotypes conjugated to TT are selected from S. pneumoniae serotypes 1, 3, 5, 15B, and 22F.

30. The formulation of claim 28, wherein at least 17 of the S. pneumoniae serotypes are conjugated to a CRM 197 .

31. The formulation of claim 28, wherein conjugated to a CRM 197 The at least 17 S. pneumoniae serotypes are selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

32. The formulation of any one of claims 1 to 10, wherein the saccharide conjugate of S. pneumoniae is selected from saccharide conjugates derived from: 197 Streptococcus pneumoniae serotype 1, conjugated to CRM 197 Streptococcus pneumoniae serotype 3, conjugated to CRM 197 Streptococcus pneumoniae serotype 4, conjugated to CRM 197 Streptococcus pneumoniae serotype 5, conjugated to CRM 197 Streptococcus pneumoniae serotype 6A, conjugated to CRM 197 Streptococcus pneumoniae serotype 6B, conjugated to CRM 197 Streptococcus pneumoniae serotype 7F, conjugated to CRM 197 Streptococcus pneumoniae serotype 8, conjugated to CRM 197 Streptococcus pneumoniae serotype 9V, conjugated to CRM 197 Streptococcus pneumoniae serotype 10A, conjugated to CRM 197 Streptococcus pneumoniae serotype 11A, conjugated to CRM 197 Streptococcus pneumoniae serotype 12F, conjugated to CRM 197 Streptococcus pneumoniae serotype 14, conjugated to CRM 197 Streptococcus pneumoniae serotype 15A, conjugated to CRM 197 Streptococcus pneumoniae serotype 15B, conjugated to CRM 197 Streptococcus pneumoniae serotype 18C, conjugated to CRM 197 Streptococcus pneumoniae serotype 19A, conjugated to CRM 197 Streptococcus pneumoniae serotype 19F, conjugated to CRM 197 Streptococcus pneumoniae serotype 22F, conjugated to CRM 197 Streptococcus pneumoniae serotype 23A, conjugated to CRM 197 Streptococcus pneumoniae serotype 23B, conjugated to CRM 197 Streptococcus pneumoniae serotype 23F, conjugated to CRM 197 Streptococcus pneumoniae serotype 24F, conjugated to CRM 197 Streptococcus pneumoniae serotype 33F, conjugated to CRM 197 Streptococcus pneumoniae serotype 35B, and combinations thereof.

33. The formulation of any one of claims 1 to 32, wherein the total glycoconjugate concentration is in the range of 1 to 100 μg.

34. The formulation of any one of claims 1 to 33, wherein the concentration of each polysaccharide-protein conjugate is in the range of 1 to 10 μg.

35. The formulation of any one of claims 1 to 33, wherein the buffer has a concentration in the range of 1 to 50 mM.

36. The formulation of any one of claims 1 to 32, wherein sodium chloride has a concentration of 1 to 300 mM.

37. The formulation of any one of claims 1 to 2 and 5 to 36, wherein calcium chloride has a concentration of 1 to 50 mM.

38. The formulation of any one of claims 1 to 3 and 5 to 37, wherein the sodium phosphate has a concentration of 1 to 50 mM.

39. The formulation of any one of claims 1 to 36, wherein the surfactant is a polysorbate or poloxamer having a molecular weight in the range of 1100 Da to 17400 Da.

40. The formulation of any one of claims 1 to 39, wherein the surfactant is polysorbate 80.

41. The formulation of any one of claims 1 to 40, wherein the concentration of surfactant is in the range of 0.001% to 1%.

42. The formulation of any one of claims 1 to 41 , wherein the adjuvant is aluminum phosphate.

43. The formulation of any one of claims 1 to 42, wherein the concentration of the adjuvant is in the range of 0.01% to 0.1%.

44. The formulation of claim 1, wherein the formulation comprises 25 glycoconjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate.

45. The formulation of claim 1, wherein the formulation comprises 25 glycoconjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate.

46. The formulation of claim 1, wherein the formulation comprises 25 glycoconjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / ml aluminum phosphate.

47. The formulation of any one of claims 44 to 46, wherein the 25 saccharide conjugates include saccharide conjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

48. A composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: At time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum adjuvant to form a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; At time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; At time T2, another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; Furthermore, the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in a liquid, wherein the measuring head includes a pulsed near-infrared light source with a wavelength of approximately 880 nm, and has a synchronous transmission detector 180° from the light source and a backscattering detector 45° from the light source, the detectors move along the height of a flat-bottomed cylindrical glass sample unit, collecting sedimentation data every 20 μm.

49. The composition of claim 48, wherein T0 is 0 hours.

50. The composition of claim 48, wherein T1 is from about 0.01 hours to 4 hours.

51. The composition of claim 50, wherein T1 is about 1 to 2 hours.

52. The composition of claim 48, wherein T2 is from about 1 hour to 5 hours.

53. The composition of claim 52, wherein T2 is about 4 hours.

54. The composition of claim 48, wherein C0 is greater than C1 and C2.

55. The composition of claim 48, wherein C1 is greater than C2.

56. The composition of claim 48, wherein at T1, the peak thickness of the sedimentation front is between about 0 mm and 20 mm.

57. The composition of claim 56, wherein at T1, the peak thickness of the sedimentation front is at least 2 mm.

58. The composition of claim 48, wherein at T2, the peak thickness of the sedimentation front is about 2 mm to 25 mm.

59. The composition of claim 58, wherein at T2, the peak thickness of the sedimentation front is at least 10 mm.

60. The composition of claim 48, wherein the settling velocity of the settling front is less than a peak thickness of 10 mm at about 1 hour and greater than a peak thickness of 18 mm at about 4 hours.

61. The composition of claim 48, further comprising a time T3, wherein at T3, the insoluble aluminum phosphate-adsorbed glycoconjugate sediment is in equilibrium with the liquid phase.

62. The composition of claim 61, wherein T3 is about 2 hours to 5 hours.

63. The composition of claim 61 , wherein at T3, the peak thickness of the sedimentation front is about 25 mm to 35 mm.

64. The composition of claim 48, wherein the composition has been allowed to stand for about 1 month.

65. The composition of claim 48, wherein the composition has been allowed to stand for at least 2 weeks.

66. The composition of claim 48, wherein the composition is stored in a container.

67. The composition of claim 66, wherein the container is a syringe.

68. The composition according to claim 61, wherein after T3, the composition is resuspended using 1 to 10 manual shakings.

69. The composition of claim 68, wherein after T3, the composition is resuspended using 1 manual shaking.

70. The composition of claim 48, wherein the composition comprises the formulation of any one of claims 1 to 47.

71. A liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: At time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum adjuvant to form a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; At time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; At time T2, another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; Furthermore, the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in a liquid, wherein the measuring head includes a pulsed near-infrared light source with a wavelength of approximately 880 nm, and has a synchronous transmission detector 180° from the light source and a backscattering detector 45° from the light source, the detectors move along the height of a flat-bottomed cylindrical glass sample unit, collecting sedimentation data every 20 μm.

72. The container of claim 71, wherein T0 is 0 hours.

73. The container of claim 71, wherein T1 is from about 0.01 hours to 4 hours.

74. The container of claim 73, wherein T1 is about 1 hour to 2 hours.

75. The container of claim 71, wherein T2 is about 1 hour to 5 hours.

76. The container of claim 75, wherein T2 is about 4 hours.

77. The container of claim 71, wherein C0 is greater than C1 and C2.

78. The container of claim 71, wherein C1 is greater than C2.

79. The container of claim 71, wherein at T1, the peak thickness of the sedimentation front is about 0 mm to 20 mm.

80. The container of claim 79, wherein at T1 the peak thickness of the sedimentation front is at least 2 mm.

81. The container of claim 71, wherein at T2, the peak thickness of the sedimentation front is about 2 mm to 25 mm.

82. The container of claim 81 , wherein at T2, the peak thickness of the sedimentation front is at least 10 mm.

83. The container of claim 71 , wherein the settling velocity of the settling front is less than the peak thickness of 10 mm at about 1 hour and greater than the peak thickness of 18 mm at about 4 hours.

84. The container of claim 71, further comprising a time T3, wherein at T3, the insoluble aluminum phosphate-adsorbed glycoconjugate sediments in equilibrium with the liquid phase.

85. The container of claim 84, wherein T3 is from about 2 hours to 5 hours.

86. The container of claim 85, wherein at T3 the settling front is about 25 mm to 35 mm.

87. The container of claim 71, wherein the container has been undisturbed for about 1 month.

88. The container of claim 71, wherein the container has been undisturbed for at least 2 weeks.

89. The container of claim 88, wherein the container is a syringe.

90. The container of claim 84, wherein after T3, the composition is resuspended using 1 to 10 manual shakings.

91. The container of claim 90, wherein after T3, the composition is resuspended using 1 manual shaking.

92. The container of claim 71 , wherein the liquid comprises a formulation according to any one of claims 1 to 47.

93. A composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: At time T0, substantially all of the at least 25 different glycoconjugates are dissolved in the liquid phase or adsorbed to the insoluble aluminum adjuvant to form a completely dispersed liquid suspension, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C0; At time T1, a portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C1; At time T2, another portion of the at least 25 different glycoconjugates adsorbed to the insoluble adjuvant precipitates from the liquid phase to form a precipitate, and the concentration of the at least 25 different glycoconjugates in the liquid phase is C2; Furthermore, the sedimentation velocity is measured over time via static multiple light scattering to detect particle migration in a liquid, wherein the measuring head includes a pulsed near-infrared light source with a wavelength of approximately 880 nm, and has a synchronous transmission detector 180° from the light source and a backscattering detector 45° from the light source, the detectors move along the height of a flat-bottomed cylindrical glass sample unit, collecting sedimentation data every 20 μm.

94. The composition of claim 93, wherein T0 is 0 hours.

95. The composition of any one of claims 93 to 94, wherein T1 is from about 0.01 hours to 4 hours after the sample reaches 45% clarity at the meniscus.

96. The composition of claim 95, wherein T1 is about 1 to 2 hours after the sample reaches 45% clarity at the meniscus.

97. The composition of claim 95, wherein T2 is about 1 hour to 5 hours after the sample reaches 45% clarity at the meniscus.

98. The composition of claim 95, wherein T2 is about 4 hours after the sample reaches 45% clarity at the meniscus.

99. The composition of any one of claims 93 to 98, wherein C0 is greater than C1 and C2.

100. The composition of any one of claims 93 to 98, wherein C1 is greater than C2.

101. The composition of any one of claims 93 to 98, wherein at T1, the peak thickness of the sedimentation front is about 0 mm to 20 mm.

102. The composition of claim 101, wherein at T1, the peak thickness of the sedimentation front is at least 2 mm.

103. The composition of any one of claims 93 to 102, wherein at T2, the peak thickness of the sedimentation front is about 2 mm to 25 mm.

104. The composition of claim 103, wherein at T2, the peak thickness of the sedimentation front is at least 10 mm.

105. The composition of claim 103, wherein the settling velocity of the settling front is less than a peak thickness of 10 mm at about 1 hour and greater than a peak thickness of 18 mm at about 4 hours.

106. The composition of any one of claims 93 to 105, further comprising a time T3, wherein at T3, the insoluble aluminum phosphate-adsorbed glycoconjugate sedimentation is in equilibrium with the liquid phase.

107. The composition of claim 106, wherein T3 is about 2 hours to 5 hours after the sample reaches 45% clarity at the meniscus.

108. The composition of claim 106 or 107, wherein at T3, the peak thickness of the sedimentation front is about 25 mm to 35 mm.

109. The composition of any one of claims 93 to 108, wherein the composition has been allowed to stand for about 1 month.

110. The composition of any one of claims 93 to 108, wherein the composition has been left to stand for at least 2 weeks.

111. The composition of any one of claims 93 to 110, wherein the composition is stored in a container.

112. The composition of claim 111, wherein the container is a syringe.

113. The composition of any one of claims 106 to 112, wherein after T3, the composition is resuspended using 1 to 10 manual shakings.

114. The composition of claim 113, wherein after T3, the composition is resuspended using 1 manual shaking.

115. The composition of any one of claims 93 to 114, wherein the composition comprises the formulation of any one of claims 1 to 47.

116. The formulation of any one of claims 1 to 47, further comprising a liposomal adjuvant.

117. A liposomal adjuvant for resuspending components of an immunogenic composition, wherein the suspended components of the immunogenic composition settle over time.

118. The adjuvant of claim 117, wherein the immunogenic composition comprises a formulation according to any one of claims 1 to 47.

119. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises MPLA and saponin.

120. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises MPLA, dioleoylphosphatidylcholine (DOPC), cholesterol and QS-21.

121. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises LiNA-1.

122. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises monophosphoryl 3-deacylated lipid A phosphorylated hexaacyl disaccharide and saponins.

123. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises QS-21, 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dimyristoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DMPG), and cholesterol.

124. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant comprises LiNA-2.

125. The formulation of claim 116 or the adjuvant of claim 117 or 118, wherein the liposomal adjuvant is 0.0625XLiNA-2, 0.125XLiNA-2, 0.25XLiNA-2, 0.5XLiNA-2, 1XLiNA-2, or 2XLiNA-2.

126. The adjuvant of any one of claims 117 to 125, wherein the immunogenic composition is stored in a syringe.

127. The adjuvant of any one of claims 117 to 126, wherein at time T0, substantially all components of the immunogenic composition are suspended, substantially all components of the immunogenic composition are completely dispersed, and / or the immunogenic composition is substantially completely homogenous.

128. The adjuvant of claim 127, wherein the composition comprises aluminum.

129. The adjuvant of claim 127 or 128, wherein at time T1, at least about 80%, about 85%, about 90% or about 95% of the components of the immunogenic composition settle out of suspension.

130. The adjuvant of claim 129, wherein T1 is from about 1 day to about 30 days, or longer.

131. The adjuvant of claim 129, wherein T1 is about 2 days, and wherein the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 by about 20 to about 30 or more manual agitations compared to a composition without the adjuvant.

132. The adjuvant of claim 129, wherein T1 is about 7 days, and wherein the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 by about 2 to about 45 or more manual agitations compared to a composition without the adjuvant.

133. The adjuvant of claim 129, wherein T1 is about 7 days, the adjuvant is LiNA-1, and the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 by about 3 or about 4 manual agitations.

134. The adjuvant of claim 129, wherein T1 is about 7 days, the adjuvant is LiNA-2B, and the adjuvant reduces the number of manual shaking required to resuspend the immunogenic composition at T1 by about 6 to about 8 manual shakings.

135. The adjuvant of claim 129, wherein T1 is about 7 days, the adjuvant is LiNA-2A, and the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 from about 41 to about 43 manual agitations.

136. The adjuvant of claim 129, wherein T1 is about 30 days, and wherein the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 by about 15 to about 70 or more manual agitations compared to a composition without the adjuvant.

137. The adjuvant of claim 129, wherein T1 is about 30 days, the adjuvant is LiNA-1, and the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 by about 19 or about 20 manual agitations.

138. The adjuvant of claim 129, wherein T1 is about 30 days, the adjuvant is LiNA-2B, and the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 by about 27 to about 29 manual agitations.

139. The adjuvant of claim 129, wherein T1 is about 30 days, the adjuvant is LiNA-2A, and the adjuvant reduces the number of manual agitations required to resuspend the immunogenic composition at T1 by about 64 or about 65 manual agitations.

140. The adjuvant of any one of claims 117 to 139, wherein the resuspended immunogenic composition is homogeneous, fully dispersed and / or uniform in color.

141. The adjuvant of any one of claims 117 to 140, wherein the immunogenic composition comprises a bacterial immunogen or a viral immunogen.

142. The adjuvant of claim 141, wherein the immunogen is selected from the group consisting of proteins, nucleic acids, and sugars.

143. The adjuvant of claim 141, wherein the immunogen is a saccharide conjugate and the immunogenic composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 different saccharide conjugates.

144. The adjuvant of claim 143, wherein the saccharide conjugate is a saccharide conjugate of a Streptococcus pneumoniae polysaccharide.

145. The adjuvant of claim 144, wherein the saccharide conjugate comprises at least one saccharide conjugate selected from the group consisting of Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.

146. The adjuvant of claim 144, wherein the saccharide conjugate comprises each of the following S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B.

Images