Porcine torovirus N protein monoclonal antibody as well as preparation method and application thereof
By preparing and screening porcine volume virus N protein monoclonal antibodies, the problem of insufficient sensitivity and specificity of existing detection methods is solved, and efficient and specific diagnosis and prevention of porcine volume virus is achieved, providing broad application prospects.
Patent Information
- Application Number
- CN202510507840.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-22
- Publication Date
- 2025-08-22
AI Technical Summary
The existing pig tulu virus detection methods are insufficient in sensitivity and specificity, which cannot meet the needs of efficient diagnosis and epidemic monitoring, and lack efficient and highly specific monoclonal antibody diagnostic kits.
Porcine Virus N protein monoclonal antibody was prepared. By optimizing the PToVN protein gene and expressing recombinant protein, mice were immunized after purification, hybridoma cells that stably secrete monoclonal antibodies were screened, and monoclonal antibodies with high titer were detected using ELISA, which was used for the diagnosis and prevention of porcine Virus.
It provides highly efficient and specific pig tulinum virus N protein monoclonal antibody for kit detection, supports disease diagnosis and prevention and control, and improves the sensitivity and specificity of diagnosis.
Smart Images

Figure CN120518754A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the medical technology field of molecular biology and immunology, and specifically relates to a monoclonal antibody against the N protein of porcine tetanus virus and a preparation method and application thereof. Background Art
[0002] Porcine Torovirus (PToV) is a potential enteric pathogen of swine, frequently detected in diarrheal piglets. First reported in the Netherlands in 1998, the virus has now been found in many countries worldwide. Existing studies suggest that PToV infection alone is generally asymptomatic or mild, and therefore has received relatively little attention. Although PToV has not yet caused significant economic losses, concurrent infection with other pathogens can exacerbate its symptoms. These findings highlight the importance of PToV as a pathogen and the need for basic research on PToV.
[0003] Currently reported methods for detecting the virus include immunoelectron microscopy (IEM), reverse transcription polymerase chain reaction (RT-PCR), real-time quantitative PCR (qPCR), high-throughput sequencing (NGS), and enzyme-linked immunosorbent assay (ELISA). Detecting viral RNA using RT-PCR is a commonly used method for diagnosing PToV. This method uses specific primers to amplify conserved regions of the viral genome to detect the presence of the virus; however, the sensitivity and specificity of RT-PCR are highly dependent on the conserved regions of primer design. Mutations in the viral genome (such as differences in strains between regions) can result in false negatives. NGS uses a high-throughput sequencing platform to perform whole-genome sequencing of different individuals or populations and perform bioinformatics analysis at the individual or population level; however, sequencing is expensive and unsuitable for large-scale serological surveys. These methods are insufficient for epidemiological diagnosis and epidemic monitoring of porcine tetanus virus, which would otherwise be necessary to reduce mortality and control the epidemic.
[0004] ELISA is a commonly used method for serological surveys, which is simple and fast to operate. The methods currently available for PToV serological diagnosis mainly use N protein or S protein as antigen to detect specific antibodies in samples. Qin et al. developed an indirect ELISA method based on PToVS1 protein to detect specific IgG and IgA antibodies in pig serum. This method showed good sensitivity and specificity and conducted a large-scale serological survey in pig herds in eastern China (Qin et al., 2022). However, the purity or conformation of the recombinant antigen affects the accuracy of the detection. Antibody detection only reflects the immune response and cannot distinguish between previous infection and current infection. There is still a lack of PToV diagnostic kits on the market. The development of more sensitive, rapid and specific PToV monoclonal antibodies has important practical significance for the development of PToV-related research. Summary of the Invention
[0005] To address the shortcomings of current technologies, the present invention provides a monoclonal antibody against the PToV N protein, its preparation method, and its application. The PToV-N protein monoclonal antibody prepared by the present invention has a high titer and can be used for PToV diagnosis. Western blot and IFA tests show excellent sensitivity and specificity, making it suitable for use in test kits and drug preparation, providing a research foundation for the mechanism of PToV research, disease diagnosis, and prevention and control.
[0006] In order to achieve the above object, the present invention provides the following technical solutions:
[0007] In the first aspect, the present invention provides a method for preparing a monoclonal antibody against the porcine tetanus virus N protein, the preparation method comprising the following steps: connecting an optimized PToVN protein gene to a vector to form a recombinant plasmid, transforming the recombinant plasmid into competent cells to obtain recombinant protein, purifying the recombinant protein and immunizing mice, collecting mouse spleen cells and mixed culturing with myeloma cells SP2 / 0, screening hybridoma cells that stably secrete PToV-N protein monoclonal antibodies, injecting the hybridoma cells into mice, and obtaining PToV-N protein monoclonal antibodies by an in vivo induction method; the nucleotide sequence of the PToVN protein gene is shown in SEQ ID NO.1.
[0008] Furthermore, in a specific implementation case, the present invention codon-optimizes the gene encoding the PToVN protein, adds a 6×His tag, and clones it into the pET28a(+) vector. After IPTG induction using a prokaryotic expression system, the recombinant His-PToV-N protein is expressed. After purification by Ni-NTA affinity chromatography, the recombinant N protein is used as an immunogen to immunize BALB / c female mice. After three immune stimulations, orbital blood is collected from the mice, and the serum titer is determined by the established ELISA detection method. The cells with a titer of 104 Cell fusion was performed on mice to prepare monoclonal antibodies.
[0009] More preferably, the induction temperature is 16-37°C; most preferably 37°C.
[0010] More preferably, the IPTG concentration is 0.1-1 mM; most preferably 0.25 mM.
[0011] In a specific embodiment of the present invention, the ELISA method was used to screen hybridoma cells that secrete PToV-N protein monoclonal antibodies, and then subcloning was performed to finally obtain two stable monoclonal cell lines, named mAb 6D8 and mAb 7H3. The subtype of the monoclonal antibody was identified using a kit. After antibody subtype identification, the heavy chain was IgG1 and the light chain was kappa. After expanding the culture of the monoclonal cell line, the cells were intraperitoneally injected into mice to prepare ascites. The titer of the cell supernatant and ascites was determined using an indirect ELISA, and the ascites was then purified by protein G affinity. The titer of the purified ascites was 1:204800. The specificity of the N protein monoclonal antibody was identified by protein immunoblotting (Western blot, WB) and indirect immunofluorescence assay (Immunoflourescence assay, IFA) using the eukaryotic expression plasmid PRK5-PToV-N-3Flag. Both mAb 6D8 and mAb 7H3 reacted with the eukaryotic expressed N protein and had good specificity. By peptide scanning, the prokaryotic expressed N protein peptides were gradually shortened, and the linear epitope recognized by one of the monoclonal antibodies was identified by Western blotting. The linear epitope recognized by the N protein monoclonal antibody mAb 7H3 was identified as 108 ATFPPELQ 115 .
[0012] In a second aspect, the present invention provides a monoclonal antibody against the porcine tetanus virus N protein prepared by the above method, wherein the monoclonal antibody recognizes the porcine tetanus virus PToV N protein.
[0013] Furthermore, the PToV-N protein monoclonal antibody is mAb 6D8, the amino acid sequence of its heavy chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of its light chain variable region is shown in SEQ ID NO.3.
[0014] Furthermore, the nucleotide sequence of the gene encoding the heavy chain variable region is shown as SEQ ID NO.4, and the nucleotide sequence of the gene encoding the light chain variable region is shown as SEQ ID NO.5.
[0015] Furthermore, the PToV-N protein monoclonal antibody is mAb 7H3, the amino acid sequence of its heavy chain variable region is shown in SEQ ID NO.6, and the amino acid sequence of its light chain variable region is shown in SEQ ID NO.7.
[0016] Furthermore, the nucleotide sequence of the gene encoding the heavy chain variable region is shown as SEQ ID NO.8, and the nucleotide sequence of the gene encoding the light chain variable region is shown as SEQ ID NO.9.
[0017] Furthermore, the monoclonal antibody mAb 7H3 recognizes a linear epitope of the porcine tetanus virus N protein, the amino acid sequence of which is 108 ATFPPELQ 115 .
[0018] In a specific embodiment of the present invention, the present invention successfully purified recombinant N protein, which can be recognized by a His-tag antibody. The recombinant N protein was coated at a concentration of 2.5 μg / mL, and an indirect ELISA assay with good specificity and ease of use was established.
[0019] In a third aspect, the present invention provides the use of the above-mentioned monoclonal antibody against the N protein of porcine tetanus virus in the preparation of a porcine tetanus virus detection reagent product, such as a detection kit.
[0020] In a fourth aspect, the present invention provides a porcine tetanus virus ELISA detection kit, which includes the above-mentioned PToV-N protein monoclonal antibody.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] The present invention provides monoclonal antibodies against the porcine tetanus virus (PTV) N protein, as well as methods for their preparation and use. The present invention prepared and screened monoclonal antibodies against the PTPV N protein, with two screened monoclonal antibodies, mAb 6D8 and mAb 7H3, exhibiting high titers. ELISA assays were used to test the binding ability of these monoclonal antibodies to the PTPV N protein, confirming strong specific binding to the N protein. The linear epitopes recognized by the monoclonal antibodies were also identified, laying the foundation for mechanistic research on PTPV, disease diagnosis, and prevention and control. The present invention also provides applications and detection kits for the monoclonal antibodies against the PTPV N protein prepared using this method, which have broad application prospects in the detection and diagnosis of PTPV. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 This is an analysis of the effects of different temperatures on the expression level of the recombinant protein His-Tag-PToV-N.
[0024] Figure 2This is the analysis of the effect of different IPTG concentrations on the expression level of recombinant protein His-Tag-PToV-N.
[0025] Figure 3 This is the SDS-PAGE analysis diagram of the recombinant His-tag-PToV-N protein purified by affinity chromatography using a gravity column.
[0026] Figure 4 The results of WB identification of His-tag-PToV-N recombinant protein.
[0027] Figure 5 The results are for the titer determination of serum from immunized mice.
[0028] Figure 6 Hybridoma cell growth and screening results, a: fusion cell growth status diagram; b: indirect ELISA screening of positive cell lines.
[0029] Figure 7 This is the SDS-PAGE analysis of ascites purification.
[0030] Figure 8 The results of ELISA titer determination of cell supernatant and ascites using the established ELISA method.
[0031] Figure 9 The results are for the subtype identification of mouse monoclonal antibodies.
[0032] Figure 10 The results of WB detection of the reactivity of monoclonal antibodies with PToV-N-Flag recombinant protein, lane M: protein marker; lane 1: PRK5 empty load; lane 2: PRK5-PToV-N-3Flag.
[0033] Figure 11 The results of IFA detection of the reactivity of monoclonal antibodies with PToV-N-Flag recombinant protein.
[0034] Figure 12 PCR gel electrophoresis analysis of the colony constructs for the prokaryotic expression of N protein truncated peptides. M: DNA molecular weight standard. (A) 1: N-FL; 2: R1-1; 3: R1-2; 4: R2-1; 5: R2-2; 6: R3-1; 7: R3-2; 8: R3-3; 9: R3-4. (B) 1: R4-1; 2: R4-2; 3: R4-3; 4: R4-4; 5: R4-5; 6: R4-6; 7: R4-7; 8: R4-8; 9: R4-9; 10: R4-10; 11: R4-11; 12: R4-12; 13: R4-13.
[0035] Figure 13This is a graphic representation of the first round of analysis of the epitope recognition by mAb 7H3 using WB and ELISA.
[0036] Figure 14 This is a graphic representation of the results of the second round of identification of the epitope recognized by the antibody mAb 7H3 using WB and ELISA.
[0037] Figure 15 This is a graphic representation of the results of the third round of identification of the epitope recognized by the antibody mAb 7H3 using WB and ELISA.
[0038] Figure 16 This is a graphic representation of the results of the fourth round of identification of the epitope recognized by the antibody mAb 7H3 using WB and ELISA.
[0039] Figure 17 Gel electrophoresis of PCR amplification of the heavy and light chain variable regions of mAb 6D8 and mAb 7H3; Note: Lane M: DNA Marker; 1: mAb 6D8 heavy chain variable region PCR amplification product; 2: mAb 6D8 light chain variable region PCR amplification product; 3: mAb7H3 heavy chain variable region PCR amplification product; 4: mAb 7H3 light chain variable region PCR amplification product. DETAILED DESCRIPTION
[0040] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0041] Unless otherwise specified, the experimental methods used in the examples of the present invention are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.
[0042] Example 1 Preparation of recombinant protein His-tag-PToV-N
[0043] 1.1 Codon Optimization
[0044] First, rare codon replacement and codon synonymous replacement were performed based on the N gene sequence of the PToV-ZJU39 strain published on GenBank (Accession umber: MT684462).
[0045] The sequence before optimization is as follows:
[0046] ATGAATTCTATGCTTAATCCAAATGCTATGCCATTTCAGCCACAGCCACACGTGGTGGCCATGCCCATTCAATATCCTATGGGCTTTCAACCACGGTTTCGAAGGAGGCGTAACCCTGGTTTTAGACCTATGTTTCAGAGGCGTAATAATATAAATCAGAACCGCAGCCGCCAGAATAGATCGCGCCTTCAAAATCAACGACGTGGTCTCAACTCTTCACGCACCCAACAGCGTGCTAATAGGCGTCAGAATACTCAACAGTCGCTGTCTTTGCCATTTGAACAACAGTTACTTATGATGGCAAATGAGACTGCTCTTTCCGCAACATTTCCACCTGAGTTGCAGAGTCTGGCGCCTACTAAGCTAGTGAAGATTGCTAAGAGAGCTGCTATGCAGATAGTTTCTGGTCATGCCACTGTTGAAGTTTCCAATGGTGACCAAGAGACGCCTCACAAAATTGCAACTTTTACAATAAAAGTGGCTTTGAAT
[0047] The optimized sequence is as follows (SEQ ID NO.1):
[0048] ATGAACAGCATGCTGAACCCGAACGCGATGCCGTTTCAGCCGCAGCCGCATGTGGTGGCGATGCCGATTCAGTATCCGATGGGCTTTCAGCCGCGCTTTCGCCGTCGCCGCAACCCGGGCTT TCGCCCGATGTTTCAGCGCCGCAACAACATTAATCAGAATCGCAGCCGTCAGAACCGCAGCCGCCTGCAGAATCAGCGTCGTGGCTTAAACAGCAGCCGTACGCAGCAACGCGCCAATCGCC GTCAGAACACGCAGCAGCCTGAGCCTGCCGTTTGAACAGCAGCTGCTGATGATGGCGAACGAAACCGCGCTGAGCGCGACCTTTCCGCCGGAACTGCAGAGCCTGGCGCCGACCAAACTGGTGAAAATTGCGAAACGCGCGGCGATGCAGATTGTGAGCGGCCATGCGACCGTGGAAGTGAGCAACGGCGATCAAGAAACCCCGCATAAAATTGCGACCTTTACCATTAAAGTGGCGCTGAAC
[0049] 1.2 Target gene synthesis and amplification
[0050] The optimized nucleotide fragment of N protein was handed over to Jinweizhi Biotechnology Co., Ltd. to construct the target fragment and recombinant plasmid pET-28a-PToV-N-opti. The vector of the recombinant plasmid was pET28a(+).
[0051] 1.3 Inducible expression of His-PToV-N protein
[0052] The recombinant plasmid was transformed into BL21 (DE3), single clones were picked and cultured in a 37 °C incubator overnight, and the next day the culture was expanded at a ratio of 1:100 to OD 600nm The expression was then induced with IPTG.
[0053] like Figure 1As shown, expression was induced at 16°C, 20°C, 22°C, 25°C, 30°C, and 37°C with 0.2 mM IPTG for 6 hours. After expression, total protein in whole cells and in the supernatant of lysates were assayed. SDS-PAGE results showed that the recombinant plasmid pET-28a-PToV-N-opti expressed the highest level of protein at 37°C in the E. coli expression system, primarily as soluble protein. T represents total protein in whole cells, and S represents supernatant of lysates. NC indicates the use of empty pET28a (+) as a negative control.
[0054] The expression was induced at 37°C for 6 h at 0.1 mM, 0.25 mM, 0.5 mM, 0.75 mM, and 1 mM IPTG to explore the effect of IPTG on the expression of recombinant N protein. Figure 2 The recombinant His-Tag-PToV-N protein can be induced to express at a concentration of 0.1mM, and the soluble protein expression is highest at 0.25mM.
[0055] 1.4N protein purification and concentration
[0056] After the expression conditions are clarified, the engineered bacteria are cultured in large quantities and induced for purification.
[0057] ① Inoculate the pET28a-PToV-N-opti bacterial solution into 5 ml of liquid LB medium at a ratio of 1:1000, then add kanamycin (10 mg / mL) at a ratio of 1:1000, and culture overnight at 37°C, 220 rpm in a shaker for 14-16 hours.
[0058] ② The next day, inoculate the revived bacterial suspension into 200 ml of LB medium at a ratio of 1:100, and add kanamycin (10 mg / mL) at a ratio of 1:1000. Incubate at 37°C, 220 rpm in a shaker for 4-5 hours.
[0059] ③ Waiting for OD 600nm =0.6-0.8, add IPTG with a final concentration of 0.2 mM, and induce expression for 6 h at 37°C and 220 rpm in a shaking incubator.
[0060] ④ Collect the bacterial solution into a centrifuge tube, centrifuge at 10,000 × g for 10 min at 4°C, and discard the supernatant.
[0061] ⑤ Prepare the equilibration buffer, wash buffer, and elution buffer required for purification, and adjust the pH to 8.
[0062] ⑥ Equilibration: Assemble the gravity column and add an appropriate amount of Ni-NTA (1 mL of nickel per gram of bacterial cells). Open the valve to allow the preservation solution to flow out, and add 5 column volumes of ddH2O to wash. After the nickel has settled, open the valve to allow the ddH2O to flow out. Finally, add 5-10 column volumes of equilibration buffer to activate the column.
[0063] ⑦ Binding: Resuspend the cells in equilibration buffer, disrupt the cells as described above, centrifuge, and collect the supernatant. Add the supernatant to the activated nickel column and incubate at 4°C for 3 hours.
[0064] ⑧ Wash: Open the valve, allow the column to flow naturally, and collect the flow-through. Add 5 column volumes of wash buffer containing 20 mM imidazole and 40 mM imidazole, respectively, to wash the column, and collect the flow-through.
[0065] ⑨ Elution: Add 5 column volumes of elution buffer containing 200 mM imidazole for elution, and collect the eluate in a centrifuge tube.
[0066] ⑩ Proteins eluted with imidazole need to be replaced with PBS for storage. Use a 10 kD ultrafiltration tube to replace and concentrate the eluted protein solution. Finally, determine protein concentration using the BCA assay. Take samples from all of the above and add them to protein buffer. Denature at 100°C for 10 minutes. Perform SDS-PAGE electrophoresis and stain with Coomassie Brilliant Blue.
[0067] The protein was expressed in large quantities under the optimized conditions, and then the recombinant N protein was purified by affinity chromatography using a gravity column. SDS-PAGE results ( Figure 3 ) showed that the recombinant protein His-tag-PToV-N was successfully purified.
[0068] 1.5WB identification of His-tag-PToV-N recombinant protein
[0069] The purified His-tag-PToV-N protein was detected and identified by Western blot. Since the recombinant protein was fused with the His-tag protein, a commercial rabbit anti-His monoclonal antibody was selected as the primary antibody to detect the recombinant N protein. Figure 4 shown.
[0070] Example 2 Preparation of Monoclonal Antibodies to N Protein
[0071] 2.1 Mouse immunization
[0072] Mice were immunized subcutaneously in the back with an equal volume of N protein emulsified in complete Freund's adjuvant (100 μg / mouse) for the first immunization. Two weeks later, a booster immunization was performed subcutaneously in the back with 100 μg / mouse recombinant N protein emulsified in incomplete Freund's adjuvant. After the second immunization, a third immunization was performed two weeks apart, using 50 μg / mouse recombinant N protein as the immunogen. Three days after the third immunization, orbital blood was collected and purified His-tag N protein was used as the antigen to coat an ELISA plate. Immunized mouse sera were serially diluted as the primary antibody, starting at 1:1600 and continuing through 11 dilutions to 1:819,200. Goat anti-mouse IgG / HRP was used as the secondary antibody. Serum titers were determined using an indirect immunoassay.
[0073] According to the results Figure 5 The results showed that the antibody titer of mouse No. 1 was the highest, reaching 1×10 5 , which can be used for subsequent cell fusion.
[0074] 2.2 Preparation of feeder cells
[0075] 6-8 week old BALB / c mice were briefly anesthetized with isoflurane, and orbital blood was collected. The blood was centrifuged and the supernatant removed as a negative serum control. The mice were then sacrificed by cervical dislocation and immersed in 75% alcohol for 10 minutes. The mice were transferred to a clean bench, mounted on a dissecting board, and cut open at the groin with ophthalmic scissors, performing blunt dissection until the peritoneum was completely exposed. 15 mL of HAT medium was drawn into the mouse's peritoneal cavity using a glass syringe and injected. The medium was aspirated several times to remove the medium. The medium was then transferred to a 50 mL centrifuge tube and set aside.
[0076] 2.3 Preparation of immune spleen cells
[0077] Sterilize and dry the homogenizer in advance. Before preparing spleen cells, add 4 mL of DMEM medium to the homogenizer. Take the immunized mouse (mouse No. 1), collect blood from its orbital cavity, and then sacrifice by cervical dislocation. Soak in 75% alcohol solution for 10 minutes. Transfer to a clean bench, fix the mouse, and then use ophthalmic scissors to open the skin and peritoneum. Finally, blunt dissection is performed to remove the spleen. During this process, a new pair of ophthalmic scissors and forceps should be used for each layer opened. Separate the connective and adipose tissue surrounding the spleen and place it in a homogenizer. Then, flush it into the bottom of the homogenizer with 1 mL of DMEM. Finally, use the inner core of the homogenizer to grind the spleen tissue in a circular motion. Finally, pour the cell suspension in the homogenizer into a sterile 50 mL centrifuge tube. Then, repeatedly rinse the bottom and inner core of the homogenizer with 5 mL of DMEM to wash out the remaining cell fluid in the homogenizer.
[0078] 2.4 Cell fusion
[0079] Transfer the prepared spleen cells and feeder cells to a biosafety cabinet and filter them separately using a cell sieve to avoid contamination. Count the filtered feeder cells and adjust the cell number to 1×105 / mL, and plate into a 96-well plate for later use. Blow off the prepared SP2 / 0 cells from the culture flask and resuspend them in 10mL DMEM. Mix the spleen cell resuspension with the SP2 / 0 cells and centrifuge at 1000r / min for 10 minutes. After centrifugation, discard the supernatant and flick the bottom of the centrifuge tube with a pipette tip to loosen the cells. Slowly add 800μL of preheated PEG (fusion agent) along the wall of the tube, stirring while adding. Then slowly add 10mL of DMEM basal culture medium to terminate the reaction while stirring. Centrifuge at 1000r / min for 10 minutes, discard the supernatant, and resuspend the cells in preheated HAT medium. Add the cell suspension to the well plate where the feeder cells have been plated and culture in a 37℃ incubator. After placing in the incubator, avoid frequent movement of the cells and observe the cell status regularly. When 3-5 days after fusion, observe the formation of cell colonies and start half-changing the medium with HAT medium, and then change the medium with HT medium every two days.
[0080] 2.5 Screening of positive hybridoma cells
[0081] (1) Using the established ELISA detection method, the His-Tag-PToV-N protein coating concentration was 2.5 μg / mL, the primary antibody was replaced with the hybridoma cell supernatant, and the OD was measured. 450nm .
[0082] (2) Since the purified protein carries a His tag and the affinity chromatography purification method is only crude, there is still a small amount of bacterial impurity protein in the protein. Therefore, during the first and last screening, empty protein is used for counter-screening to avoid the subsequent screening of antibodies against the tag protein and bacterial protein. The counter-screening is also performed by indirect ELISA method to detect antibodies. After exploration by the research team, the empty protein coating concentration is 10μg / mL, and the other steps are consistent with the above-established method.
[0083] (3) Screening procedures:
[0084] ① Primary screening: One week after cell fusion, perform primary screening and perform indirect ELISA on the cell supernatant. Select cells that react strongly to the target protein and react negatively to the blank carrier protein for subcloning.
[0085] ② Secondary screening: When the subcloned hybridoma cells grow to 1 / 3 of the well bottom area, select the cells with monoclonal growth and perform subcloning until the supernatant positive rate reaches 100%. At this time, the monoclonal cell line is expanded to 12-well plates and frozen for storage;
[0086] ③ Third screening: When cells have expanded to 6-well plates, the supernatant is collected for testing. Plates are coated with recombinant N protein and empty vector protein for testing. Cells that react strongly to the target protein and negative to the empty vector protein are selected for further expansion and cryopreservation.
[0087] (4) Cell subcloning: Positive hybridoma cells screened by ELISA were blown off with HT culture medium and counted. The cell concentration was diluted to 50 / mL, 25 / mL, 5 / mL, and 1 / mL. The cell resuspension was added to a 96-well cell culture plate so that each well contained 10, 5, 2, and 1 cells. After plating, the plate was observed under a microscope and the wells containing only one cell were marked. When the cells grew to 1 / 3, they were detected by indirect ELISA.
[0088] like Figure 6 As shown, when the cell density reached 70%, ELISA screening was started, and eventually two cell lines that stably secreted PToV-N antibodies were screened out and named 6D8 and 7H3.
[0089] 2.4 Ascites preparation and purification
[0090] To mass-produce monoclonal antibodies, we used an in vivo induction method to generate large quantities of monoclonal antibodies in mice. We then took two cell lines that stably secreted antibodies and injected three mice with each cell line to prepare ascites.
[0091] The antibody was purified by Protein G Beads and then electrophoresed by SDS-PAGE. Figure 7 The results showed that heavy and light chains were visible after ascites purification, indicating that the ascites was successfully purified.
[0092] 2.5 Ascites and cell supernatant titer determination
[0093] The titer of cell supernatant and ascites was determined using the established ELISA method, as Figure 8 As shown, the titer of mAb 6D8 cell supernatant was 1:6400; the titer of mAb 7H3 cell supernatant was 1:12800. After ascites preparation, the titer of mAb 6D8 was 1:409600; and the titer of mAb 7H3 was 1:204800.
[0094] 2.6 Monoclonal Antibody Subtype Identification
[0095] The subtypes of the two screened monoclonal antibodies were identified using the BioAolong mouse monoclonal antibody Ig class / subclass identification ELISA kit. Figure 9 As shown, the heavy chains of mAb 6D8 and mAb 7H3 are both IgG1, while the light chains are both kappa.
[0096] 2.7WB detection of monoclonal antibody specificity
[0097] The eukaryotic expression plasmid pRK5-PToV-N-3Flag was transfected into Vero cells, and samples were collected 24 hours later for Western blotting. Figure 10 As shown, overexpressed PToV-N-Flag recombinant cells were detected in the ascites prepared from the two monoclonal hybridomas, with only one band, which was consistent with the expected size of 19.8 kD, indicating that the hybridoma cells can stably secrete antibodies against the PToVN protein.
[0098] 2.8 IFA detection of monoclonal antibody specificity
[0099] Vero cells were transfected with the eukaryotic expression plasmid pRK5-PToV-N-3Flag, fixed and blocked 24 hours later, ascites and commercial Flag tag antibody were mixed at a ratio of 1:5000 and incubated overnight at 4°C. At the same time, pRK5 empty vector was transfected as a negative control. The results are shown in Figure 2. Figure 11 As shown, the Flag rabbit anti-tag antibody detected the PToV-N-Flag recombinant protein overexpressed in Vero cells, and the monoclonal antibodies mAb 6D8 and mAb 7H3 could detect the recombinant N protein and had no reaction with the empty protein.
[0100] Example 3 Epitope Identification
[0101] Using the full-length pPToV-FL plasmid stored in the laboratory as a template (Genbank: MT684462), a truncated N gene fragment was amplified by PCR. The pCold-TF vector stored in this experiment lacks the His tag. To allow subsequent detection of protein expression using a His tag antibody, a 6× His tag was introduced at the C-terminus of the protein, and a linker was inserted between the tag and the protein.
[0102] To identify the epitope recognized by mAb 7H3, the PToVN protein was truncated into overlapping peptides and identified in four rounds of truncation. After expression of the truncated peptides, reactivity of the mAb with the truncated N protein was assessed by Western blotting, confirming its epitope recognition. A His tag was used to verify successful expression of the truncated N protein. Simultaneously, a TF tag (48 kD) was incorporated into the protein to facilitate expression of the N protein and its truncated peptide in prokaryotes and facilitate detection of the truncated peptide in Western blotting.
[0103] 3.1 Construction of truncated peptides
[0104] (1) Linearized vector: The vector was linearized using the inverse PCR method. The plasmid pCold-TF (TAKARA) stored in the laboratory was used as a template to amplify the linearized vector. Finally, the PCR product was subjected to gel electrophoresis and then recovered.
[0105] (2) Amplification of N gene truncation: Using the above-constructed PRK5-PToV-N-3Flag plasmid as a template, PCR was performed with synthesized primers, and finally the product with the correct band size was recovered by gel recovery.
[0106] (3) Ligation and transformation: The vector and fragment were connected using the recombination reaction kit CloneExpress Ultra One Step Cloning Kit V2, and then transformed.
[0107] (4) For R4-2 to R4-3, the Novozymes Mut Express II Fast Mutagenesis Kit V2 was used. After designing primers, the plasmid constructed above was used as a template for amplification, in vitro circularization and transformation, and finally sequencing for screening.
[0108] (5) Identification: After transformation, colonies on the plate were picked for colony PCR identification (see Figure 12 ), expand the colony with the correct band size, extract the plasmid and send it for sequencing, and finally save the correct plasmid with the sequencing result.
[0109] 3.3 Western blotting to identify antibody recognition epitopes
[0110] After inducing expression of the truncated peptide, a commercial His-tagged antibody was used as the primary antibody to detect recombinant protein expression. Separately, a prepared mAb 7H3 was used as the primary antibody, along with pCold-TF empty vector as a negative control, labeled NC, and the full-length pCold-TF-PToV-N plasmid as a positive control, labeled PC. Western blotting was used to detect the epitope recognized by the antibody. The specific Western blotting steps are described above. Finally, based on the Western blotting results, further truncated peptides were designed to precisely locate the epitope recognized by the mAb.
[0111] 3.4 ELISA identification of antibody recognition epitopes
[0112] (1) Determination of protein supernatant concentration: After induction of expression, sample the protein supernatant and determine the protein concentration using the BCA method after gradient dilution.
[0113] (2) Coating antigen: The His-fused recombinant proteins, including the full-length N protein and each truncated peptide, were coated at a concentration of 5 μg / mL, 100 μL / well, and incubated at 37°C for 1 h.
[0114] (3) The sealing steps are the same as above.
[0115] (4) Primary antibody: mAb 7H3 was used as the primary antibody, diluted with 5% skim milk at a ratio of 1:5000, 100 μL / well, and incubated at 37°C for 1.5 h.
[0116] (5) Secondary antibody: Goat anti-mouse IgG (H+L)-HRP was used as the secondary antibody, diluted with 5% skim milk at a ratio of 1:5000, 100 μL / well, and incubated at 37°C for 1 h.
[0117] (6) Color development: After washing, add 100 μL of color development solution to each well. After 15 minutes, add an equal volume of stop solution and measure the OD using a microplate reader. 450mm .
[0118] (7) Judgment standard: P / N value is greater than 2.1, that is, the OD of the test sample 450mm / Negative sample OD 450mm . and OD 450mm A value greater than 1 is positive.
[0119] 3.5 First round of identification and results
[0120] Two overlapping peptides were expressed using a prokaryotic expression system, and Western blotting and ELISA were performed using a His-tag antibody and mAb 7H3 as primary antibodies. The first round of screening showed that two overlapping truncated peptides were successfully expressed. The His-TF-N protein showed a single band at approximately 68 kD, while the truncated peptides R1-1 and R1-2 both showed single, specific bands at approximately 50 kD. Meanwhile, mAb 7H3 did not react with the empty vector. Figure 13 , WB and ELISA results showed that mAb 7H3 recognized R1-2 (55~163aa).
[0121] 3.6 Second round of appraisal and results
[0122] Based on the results of the first round of identification, the polypeptides used for the second round of epitope identification were designed and expressed. Figure 14 In the second round of screening, ELISA and WB results showed that mAb 7H3 recognized two overlapping peptides R2-1 and R2-2 (91-163aa), indicating that mAb 7H3 recognized the overlapping part of the two truncated peptides, namely 91aa-125aa.
[0123] 3.7 Third round of appraisal
[0124] Based on the results of the second round of identification, overlapping peptides were further designed for detection. The overlapping portion 91aa-125aa of R2-1 (55-125aa) and R2-2 (91-163aa) recognized by mAb 7H3 were taken and further designed into two overlapping peptides for identification. Figure 15 The results of ELISA and WB showed that mAb 7H3 reacted with both truncated polypeptides, indicating that the epitope recognized by mAb 7H3 was located in the overlapping part of R3-3 (91-115aa) and R3-4 (101-125aa), that is, 101-115aa.
[0125] 3.8 Fourth round of appraisal
[0126] After three rounds of identification, it was determined that mAb 7H3 recognized a linear epitope, and the recognition region was between 101aa and 115aa. Therefore, in the final round of screening, the truncated peptide was truncated amino acid by amino acid to identify the minimum epitope recognized by mAb 7H3. Figure 16 , WB and ELISA results showed that the minimum region recognized by mAb 7H3 was located at 108aa-115aa, i.e. 108 ATFPPELQ 115 .
[0127] Example 4 Monoclonal Antibody Sequences
[0128] 4.1 RNA extraction
[0129] 1. Resuscitate the hybridoma cells, expand the culture and count them, and take 1×10 5 RNA was extracted from each cell.
[0130] 2. Add 800 μL Trizol to lyse the cells, mix by inverting, and place on ice for 5 minutes;
[0131] 3. Add chloroform at a ratio of 1:4, shake vigorously to mix, let stand for 5 minutes, and centrifuge at 12000 rpm at 4°C for 15 minutes.
[0132] 4. Take the supernatant and add an equal volume of isopropanol, mix by inverting several times, and place at -20℃ for 30 minutes;
[0133] Centrifuge at 12,000 rpm at 5.4°C for 15 min.
[0134] 6. Discard the supernatant and add 1 mL of 70% ethanol;
[0135] Centrifuge at 7.4°C, 12,000 rpm, for 10 min. Discard the supernatant and repeat step 68. Discard the supernatant and centrifuge again for 5 min. Aspirate the supernatant with a 10 µL pipette tip, taking care not to poke the pellet. Air-dry the tube until no liquid remains.
[0136] 9. Add 20 μL of DEPC, gently blow off the precipitate, and aliquot. Transfer 16 μL to a new EP tube (store at -80°C) and use the rest for reverse transcription.
[0137] 4.2 cDNA acquisition
[0138] The above-mentioned RNA was reverse transcribed to obtain cDNA.
[0139] The specific steps of reverse transcription were as follows: 16 μL RNA solution was added with 1 μL 100 mM oligo dT, and the reaction was carried out at 70°C for 5 min; the reaction was immediately placed on ice; 1 μL RNase inhibitor, 1 μL dNTPs (10 mM concentration), 1 μL MLV reverse transcriptase, and 5 μL buffer were added, and the reaction was carried out at 42°C for 60 min; and the reaction was carried out at 72°C for 5 min.
[0140] 4.3 PCR amplification and sequencing
[0141] The obtained cDNA was used as a template, and PCR amplification was performed using heavy chain primer F and heavy chain primer R, and light chain primer F and light chain primer R, respectively, to obtain fragments encoding the heavy chain and the light chain, respectively, and sequenced.
[0142] Heavy chain primer F: GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG
[0143] Heavy chain primer R: GCTCAGGGAAATAGCCCTTGAC
[0144] Light chain primer F: GATATTGTGATGACTCAGTCTCCA
[0145] Light chain primer R: CCGTTTTATTTCCAAGCTTGGTCCC
[0146] PCR reaction conditions: pre-denaturation, 95°C, 2 min; denaturation, 95°C, 30 s; annealing, 56°C, 30 s; extension, 72°C, 40 s, for a total of 25 cycles; and a final extension cycle of 10 min.
[0147] Sequencing results:
[0148] The heavy chain variable region nucleotide and amino acid sequences of mAb 6D8 are shown in SEQ ID NOs. 4 and 2, respectively; the light chain variable region nucleotide and amino acid sequences are shown in SEQ ID NOs. 5 and 3, respectively. The heavy chain variable region nucleotide and amino acid sequences of mAb 7H3 are shown in SEQ ID NOs. 8 and 6, respectively; the light chain variable region nucleotide and amino acid sequences are shown in SEQ ID NOs. 9 and 7, respectively.
[0149] Obviously, the specific implementation scheme described above is only a further detailed description of the purpose, technical solutions and beneficial effects of the present invention. It should be understood that the above is only a specific example of the present invention and is not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A method for preparing a monoclonal antibody against porcine tetanus virus N protein, characterized in that: The method comprises the following steps: adding a 6×His tag to an optimized PToV N protein gene, connecting the tag with a vector to form a recombinant plasmid, transforming the recombinant plasmid into competent cells, obtaining His-PToV-N recombinant protein through IPTG induction, purifying the recombinant protein and immunizing mice, collecting mouse spleen cells and mixing them with myeloma cells SP2 / 0 for culture, screening hybridoma cells that stably secrete PToV-N protein monoclonal antibodies, injecting the hybridoma cells into mice, and obtaining PToV-N protein monoclonal antibodies through an in vivo induction method; the nucleotide sequence of the PToVN protein gene is shown in SEQ ID NO.
1.
2. The method according to claim 1, characterized in that The vector is pET28a(+), the temperature for IPTG induction is 16-37° C., and the concentration of IPTG is 0.1-1 mM.
3. A monoclonal antibody against porcine tetanus virus N protein, characterized in that: Prepared by the method according to any one of claims 1-2, the monoclonal antibody can recognize the porcine tetanus virus (PToV) N protein.
4. The monoclonal antibody according to claim 3, characterized in that The PToV-N protein monoclonal antibody is mAb6D8, the amino acid sequence of its heavy chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of its light chain variable region is shown in SEQ ID NO.
3.
5. The monoclonal antibody according to claim 4, characterized in that The nucleotide sequence of the gene encoding the heavy chain variable region is shown in SEQ ID NO.4, and the nucleotide sequence of the gene encoding the light chain variable region is shown in SEQ ID NO.
5.
6. The monoclonal antibody according to claim 3, characterized in that The PToV-N protein monoclonal antibody is mAb7H3, the amino acid sequence of its heavy chain variable region is shown in SEQ ID NO.6, and the amino acid sequence of its light chain variable region is shown in SEQ ID NO.
7.
7. The monoclonal antibody according to claim 6, characterized in that The nucleotide sequence of the gene encoding the heavy chain variable region is shown in SEQ ID NO.8, and the nucleotide sequence of the gene encoding the light chain variable region is shown in SEQ ID NO.
9.
8. The monoclonal antibody according to claim 6, characterized in that The monoclonal antibody mAb 7H3 recognizes a linear epitope of the porcine tetanus virus N protein, the amino acid sequence of which is 108 ATFPPELQ 115 .
9. Use of the monoclonal antibody against the N protein of porcine tetanus virus according to any one of claims 3 to 8 in the preparation of a detection kit, characterized in that: The kit is used for detecting porcine tetanus virus.
10. A porcine tetanus virus ELISA detection kit, characterized in that: The invention comprises the monoclonal antibody against the N protein of porcine tetanus virus according to any one of claims 3 to 8.
Citation Information
Patent Citations
Porcine torque teno virus vaccines and diagnosis
CN107522775A
Multiple RT-PCR (reverse transcription-polymerase chain reaction) detection primer group and kit for rapidly distinguishing PEDV (porcine epidemic diarrhea virus), PDCoV (porcine deltacoronavirus) and PReoV (porcine reovirus)
CN109439797A
Novel serology assay for the detection of porcine viruses
US20240353409A1
Porcine torovirus proteins n, m and he, method for production thereof and uses thereof in diagnosis and treatment of porcine torovirus
WO2009053512A1