Application of GhGLK1 protein and coding gene thereof in regulation and control of growth and differentiation of cotton callus

By constructing the overexpression and knockout vector of GhGLK1 in cotton, the expression of GhGLK1 protein was regulated by Agrobacterium mediating method, the uncertainty of callus growth and differentiation function was solved, efficient growth and differentiation of callus tissue was achieved, and the cultivation cycle of transgenic cotton was shortened.

CN120519508AActive Publication Date: 2025-08-22SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511015329.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-23
Publication Date
2025-08-22
Estimated Expiration
2045-07-23

AI Technical Summary

Technical Problem

In cotton, it is not clear whether the GhGLK1 gene has the function of regulating callus growth and differentiation, and the prior art cannot directly correlate it with plant callus growth and differentiation functions.

Method used

The overexpression vector and knockout vector of GhGLK1 were constructed, and cotton plants were transformed through Agrobacterium mediated method, which increased the expression level of GhGLK1 protein or decreased its expression level, and promoted or inhibited the callus growth and differentiation process.

Benefits of technology

It significantly improves the growth and differentiation efficiency of cotton callus, shortens the cultivation cycle of genetically modified cotton, breaks the dependence on the genotype of receptor materials, and improves plant transformation and regeneration efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519508A_ABST
    Figure CN120519508A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly provides application of GhGLK1 protein and a coding gene thereof in regulation and control of cotton callus growth and differentiation. The protein meets the following conditions: B1) a protein with an amino acid sequence of SEQ ID NO.1; and B2) a fusion protein with the same function obtained by connecting a tag to the N end and / or C end of B1). According to the invention, the GhGLK1 gene is cloned to construct an overexpression vector and a CRISPR (clustered regularly interspaced short palindromic repeats) vector, and then is transformed into cotton to obtain an overexpression plant and a knockout plant. GhGLK1 overexpression plants can significantly improve the growth and differentiation of calluses and greatly shorten the transformation cycle of transgenic crops, which has important significance in breaking the dependence on the genotype of receptor materials and accelerating the circulation of plant transformation and regeneration.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and relates to the application of GhGLK1 protein and its encoding gene in regulating cotton callus growth and differentiation. Background Art

[0002] Transgenic technology uses modern technology to transfer genes that confer known functional traits, such as high yield, stress tolerance, pest and disease resistance, and improved nutritional quality, into target organisms. This allows the recipient organism to acquire new functional traits in addition to its existing genetic characteristics, resulting in new varieties. Generally speaking, factors influencing the selection of gene receptors include the method of gene transfer, the receptor's regenerative capacity, the physiological state and regeneration pathways of the receptor material, and the occurrence of somatic clonal variation. The primary factor limiting gene transfer is the receptor's regenerative capacity, as the establishment of a high-frequency plant regeneration system is a crucial prerequisite for plant genetic transformation. Many genetically modified crops are produced through Agrobacterium-mediated genetic transformation and plant regeneration, a time-consuming and highly genotype-dependent process. As researchers explore the transformation process, they have discovered a class of plant genes that can promote plant regeneration and improve transformation efficiency. By manipulating these genes, materials with high genetic transformation efficiency can be obtained, which has important implications for accelerating plant transformation.

[0003] In recent years, it has been reported that some plant development regulatory factors or complexes, such as WUS / BBM , GRF / GIF , WOX5 It can promote the production of plant somatic embryos or the regeneration of buds, thereby improving the efficiency of gene transformation. GOLDEN2 (G2) is a member of the GARP transcription factor superfamily. It regulates the development of chloroplasts and is also involved in biological processes such as tissue regeneration, biological stress, plant aging, and plant hormone signal transduction. Previous studies have optimized the corn G2 gene with rice codons and synthesized ZGar The callus-specific promoter CSPpro (Callus-specific promoter) was isolated and identified from rice, and a CSPpro-driven ZGar The binary vector pYLTAC380H-CSPpro::rZmG2 carrying the gene was used to transform japonica rice (DongJing and Zhongjia 8), indica rice (Huazhan and Huaguang) and maize (B104). ZGar Rice and corn calli with the gene turned green earlier and had more green spots, with differentiation efficiency increased by 11.6-48.7% and transformation efficiency increased by 8.3-23%. The researchers found through RNA-seq and RT-qPCR analysis of rice calli that ZGarIt mainly improves the differentiation efficiency of rice by promoting the expression of genes related to chloroplast development.

[0004] The present invention technicians isolated a functional gene in cotton GhGLK1 Through homology comparison, it was found that GhGLK1 Regeneration-related genes in maize ZmGOLDEN2 The two have high homology, and the construction of evolutionary tree shows that they have close relationship. However, there has been no clear research report and functional verification in cotton. GhGLK1 It is still unknown whether the gene has the function of regulating callus growth and differentiation. ZmGOLDEN2 In monocots (rice / corn), differentiation efficiency is improved by promoting chloroplast development, but cotton is a monocot and its molecular mechanisms of callus growth and differentiation may be completely different. On the other hand, cotton is an allotetraploid (AtDt genome). GhGLK1 There are functionally redundant copies in the At and Dt subgenomes, and maize ZmGOLDEN2 It is a single copy gene. When applied across species, the functional redundancy / specificity of homologous genes in polyploids cannot be inferred by sequence homology. GLK1 The roles played are not exactly the same. For example: GLK1 Genes related to resistance to biotic and abiotic stresses, e.g. AtGLK1 Can enhance resistance to cucumber mosaic virus (CMV), AtGLK Participates in drought response by regulating ABA-responsive genes (such as WRKY40). GLK1 The gene is related to regulating fruit quality. Therefore, it can be seen that the protein GLK1 does not only have the function of regulating plant callus growth and differentiation. Obviously, there is no unique corresponding relationship between the function of regulating plant callus growth and differentiation and the protein GLK1. Based on this, those skilled in the art cannot GhGLK1 The genes are directly related to the functions of regulating plant callus growth and differentiation, and further research is needed.

[0005] At the same time, the amino acid sequence of the primary structure of a protein is the basis of its spatial structure, and the spatial structure of a protein is the basis of its function. Whether proteins with high homology have similar spatial structures and similar functions mainly depends on the differences in amino acid residues that play a key role in maintaining their spatial structure, function, and activity, and whether these differences are sufficient to change their spatial conformation and corresponding biological functions and activities. If some or even one of the key amino acids in the amino acid sequence of a protein changes, it will lead to great changes in the spatial structure and biological activity or function of the protein.A large number of literature reports have shown that a change in a single base in a gene may lead to significant phenotypic changes (JiaoY, Wang Y, Xue D, Wang J, Yan M, Liu G, Dong G, Zeng D, Lu Z, Zhu X, Qian Q,Li J. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat Genet. 2010 Jun;42(6):541-4;Peng LM, Chen XP, Sun J, Guo YJ, Li L,Mo L, Xie W, Li YJ, Yang TL, Li CC. Influence of ALDH2 Glu504Lys polymorphismon nitroglycerin response in chronic heart failure and involvement ofCalcitonin Gene Related Peptide (CGRP). Int J Clin Pharmacol Ther. 2012 Oct;50(10):701-11;Kobayashi Y, Kuroda K, Kimura K, Southron-Francis JL, FuruzawaA, Kimura K, Iuchi S, Kobayashi M, Taylor GJ, Koyama H. ​​Amino acidpolymorphisms in strictly conserved domains of a P-type ATPase HMA5 are involved in the mechanism of copper tolerance variation in Arabidopsis. PlantPhysiol. 2008 Oct;148(2):969-80).

[0006] In summary, in cotton GhGLK1 Whether the gene has the function of regulating callus growth and differentiation remains to be studied. Summary of the Invention

[0007] The technical problem to be solved by the present invention is how to utilize the above-mentioned GhGLK1 and its encoding gene to regulate the growth and differentiation of cotton callus.

[0008] In order to achieve the above object, the present invention provides the following technical solutions: A first aspect of the present invention provides an application for increasing protein content and / or activity, wherein the application is any one of the following: A1) Application in improving the growth or differentiation of cotton callus; A2) Application in shortening the cultivation cycle of transgenic cotton; The protein is named GhGLK1 and meets the following conditions: B1) a protein having an amino acid sequence of SEQ ID NO. 1; B2) A fusion protein with the same function as B1) is obtained by connecting a tag to the N-terminus and / or C-terminus.

[0009] In the above application, the protein GhGLK1 can be derived from cotton.

[0010] Furthermore, the protein GhGLK1 may be cotton callus growth or differentiation-related protein GhGLK1.

[0011] In order to facilitate the purification or detection of the protein in B1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing.

[0012] The tag protein includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0013] The second aspect of the present invention provides an application of the biomaterial related to the protein GhGLK1, characterized in that the application is any one of the following: D1) Application in improving cotton callus growth or differentiation; D2) Application in shortening the cultivation cycle of transgenic cotton; The biological material is any one of the following E1) to E7): E1) a nucleic acid molecule that promotes or increases the expression of the gene encoding the protein according to claim 1; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

[0014] In the above application, the nucleotide sequence of the protein GhGLK1 encoding gene (CDS) is the nucleotide sequence shown in SEQ ID NO. 2.

[0015] The third aspect of the present invention provides a method for improving plant callus growth or differentiation, which comprises increasing the content and / or activity of the protein GhGLK1 in the target plant to obtain a plant with a higher degree of callus growth or differentiation than the target plant, wherein the plant is cotton.

[0016] In the above method, increasing the content and / or activity of the protein GhGLK1 in the target plant is achieved by increasing the expression level of the gene encoding the protein GhGLK1 in the target plant.

[0017] In the above method, increasing the expression level of the gene encoding the protein GhGLK1 in the target plant is to increase the expression level of the gene encoding the protein GhGLK1 in the genome of the target plant using transgenic technology.

[0018] In the above method, the use of transgenic technology to increase the expression level of the gene encoding the protein GhGLK1 in the genome of the target plant is performed by introducing a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

[0019] Beneficial effects of the present invention:

[0020] The present invention is based on cotton GhGLK1 Gaps in gene function research, building GhGLK1 Overexpression vectors and knockout vectors were used, and it was found that GhGLK1 Overexpression plants can significantly improve callus growth and differentiation, greatly shortening the transformation cycle of transgenic crops. This is of great significance for breaking the dependence on the genotype of the recipient material and accelerating the cycle of plant transformation and regeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the structural and evolutionary analysis of GhGLK1 protein.

[0022] Figure 2 for GhGLK1 Identification of overexpressing material.

[0023] Figure 3 for GhGLK1 Identification of knockout material.

[0024] Figure 4 for GhGLK1 Statistics of callus growth of overexpression lines.

[0025] Figure 5 for GhGLK1 Statistics of callus growth of knockout lines. DETAILED DESCRIPTION

[0026] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0027] Example 1 GhGLK1 Functional identification of genes 1. Materials and Methods 1.1 Plant materials The recipient variety of upland cotton is China Cotton Research Institute 49 (Z49).

[0028] 1.2 Strains and plasmids The vectors used in this experiment were pCBSG015 and pCAMBIA2301 (stored in our laboratory), the competent E. coli DH5α was purchased from Quanshijin (Beijing) Biological Company, and the Agrobacterium tumefaciens LBA4404 was stored in our laboratory.

[0029] 1.3 Main Reagents The high-fidelity 2× Phanta Max Master Mix used in the experiment was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; KpnⅠ enzyme, SalⅠ enzyme, EcoRⅠ enzyme and T4 ligase were purchased from New England Biolabs, and pEASY-T1 simple cloning vector was purchased from Quanshijin (Beijing) Biotechnology Co., Ltd.

[0030] 1.4 GhGLK1 Identification of gene target sites Blast comparison was performed in the cotton database (https: / / cottonfgd.org / search / ), and three homologous sequences of GLK1 were found in the upland cotton database, among which the genes of the At subfamily and the Dt subfamily had high similarity. GhGLK1 To ensure efficient silencing, dual sgRNA genomic target sites were designed at the same position in the At and Dt subfamilies. CCGACGAGTTCCCGGATTTCGCT (SEQ ID NO. 3) and CCCCCCGCCGGCGAGGAATCGGA (SEQ ID NO. 4) were selected as target sites. sg1 and sg2 were ligated to either end of the ATU6-26 promoter via PCR. The PCR fragments were then linked to the digested pCBSG015 vector via seamless cloning, successfully constructing a CRISPR / Cas9 dual-target site vector.

[0031] 1.5 Identification of overexpression lines DNA was extracted from OE-GLK1 overexpressing lines, and primers for the overexpression vector (CaMV 35S promoter + target gene fragment) were designed. PCR and electrophoresis were performed to confirm successful integration of GLK1 into the cotton genome. Total RNA was extracted from the cotton overexpressing lines, and primers for qRT-PCR were designed. Data analysis was performed to detect target gene expression at the mRNA level.

[0032] 1.6 Agrobacterium-mediated genetic transformation of cotton (1) Select mature and plump seeds of the upland cotton variety Zhongmianso 49, remove the shells, soak them in 50% 84 disinfectant for 30 min, and rinse them with sterile water several times to remove the residual 84 disinfectant on the seeds. Incubate the sterilized cotton seeds for 7 days (28°C) to obtain sterile seedlings.

[0033] (2) Activate the Agrobacterium that has been transformed with the target plasmid at -80 °C, expand the culture, collect the bacteria, add 1 / 2 MS solution to resuspend the bacteria, and adjust the OD600 to 0.4-0.5.

[0034] (3) Cut the hypocotyls of sterile seedlings into 0.5-0.7 cm segments and place them in the bacterial infection solution for 5 minutes. Transfer the infected hypocotyl segments to sterile filter paper and air dry them. Then transfer them to the symbiotic culture medium and culture them in the dark at 28°C for 2 days.

[0035] (4) Transfer the hypocotyl segments to the resistant callus culture medium and continue to subculture for three weeks each round. After 3-4 rounds of culture, induce callus formation and screen for resistant calli that have been successfully infected.

[0036] (5) The resistant calli obtained are transferred to differentiation medium and continue to grow for 4-5 months. After that, they are transferred to embryonic callus induction medium again and subcultured once every 30 days until adventitious buds appear.

[0037] (6) Cut off the adventitious buds and transfer them to rooting medium for cultivation until cotton seedlings are obtained.

[0038] 1.7 Identification of mutant materials Hi-tom sequencing (http: / / www.hi-tom.net / hi-tom / ) is a technology that sequences gene editing sites based on second-generation sequencing technology. It has higher sensitivity and accuracy, especially for low-frequency mutations, mosaic mutations, and complex mutations commonly seen in gene editing, as well as for complex situations such as polyploidy, multiple samples, or multiple sites analysis.

[0039] 1.8 Callus induction culture Cotton seeds from control Z49, OE-GLK1, and CR-GLK1 materials were sterilized and cultured in seedling medium for 7 days at 28°C to obtain sterile seedlings. Hypocotyls of the sterile seedlings were cut into 0.5-0.7 cm segments and cultured in callus induction medium. Culture conditions: temperature 28 ± 2°C, photoperiod 16 h / d. Callus growth was recorded every 7 days during the culture period, and the callus induction rate and growth were recorded.

[0040] 2. Results Analysis 2.1 GhGLK1 protein structure and evolutionary analysis GOLDEN2 (G2) is a member of the GARP transcription factor superfamily. It regulates chloroplast development and is also involved in biological processes such as tissue regeneration, biotic stress, plant aging, and plant hormone signaling. ZmG2 It improves rice differentiation efficiency mainly by promoting the expression of chloroplast development-related genes. GhGLK1 belongs to the GARP transcription factor superfamily and contains four different regions: an N-terminal acidic domain, a DNA binding domain, a proline-rich region, and a C-terminal domain containing a conserved GCT box, which acts as a transcriptional activation domain ( Figure 1 a). Sequence alignment of GLK1 / 2 homologs from Arabidopsis, maize, rice, and tomato revealed that GhGLK1 and ZmGOLDEN2 from cotton have high homology, strong conservation in the DNA binding and C-terminal domains, and moderate conservation in the proline-rich region ( Figure 5 b). Phylogenetic analysis showed that GhGLK1 / 2 are evolutionarily distinct from their homologs in other species ( Figure 5 c).

[0041] 2.2 Creation and identification of GhGLK1 overexpression and knockout materials The present invention technicians have constructed GhGLK1 Overexpression vector ( Figure 2 a) and obtained transgenic cotton through Agrobacterium-mediated genetic transformation. 12 positive lines were obtained ( Figure 2 b), 7 strains expressed normally, and OE03, OE02, and OE05 had the highest relative expression levels ( Figure 2 c and d).

[0042] To generate knockout lines, two sgRNAs, sgRNA1 and sgRNA2, targeting exon 1 of GhGLK1 were designed and cloned into the Cas9-sgRNA cassette ( Figure 3 a). The constructed CRISPR vector was transferred into the recipient material Z49 through Agrobacterium-mediated cotton genetic transformation. After a series of culture and screening, four plants with normal growth were finally obtained. Mutation analysis was performed using the Hi-TOM platform, and three independent T0 transgenic upland cotton lines (glk1-cas9-1, glk1-cas9-2, and glk1-cas9-3) were generated ( Figure 3 b and 3c).

[0043] 2.3 GhGLK1 Statistics of callus growth of overexpression materials and knockout materials To explore GLK1 The hypocotyls of control Z49, OE-GLK1-3 and OE-GLK1-4 were cultured in callus induction medium for 30 days, and the number of calli, weight of individual calli and area of ​​individual calli were counted. GLK1 Weight and area of ​​single callus of overexpressing materials were significantly higher than the control ( Figure 4 ad). The results showed GhGLK1 It has the effect of promoting callus growth.

[0044] To further explore GLK1 The function of callus growth was investigated. Z49, glk1-1 and glk1-2 were subjected to callus induction. After 14 days of culture in callus induction medium, the number of calli grown, the weight of individual calli and the area of ​​individual calli were counted. GLK1 The weight and area of ​​single callus of knockout materials were significantly lower than those of control ( Figure 5 ad). GLK1 Overexpression promoted callus growth, while GLK1 Knockout inhibited callus growth, indicating GhGLK1 It plays an important role in callus growth.

[0045] In summary: the present invention has constructed GhGLK1 The overexpression vector and knockout vector were used to transform Z49 recipient cotton plants through Agrobacterium-mediated method to obtain overexpression lines (OE) and knockout lines (CR). GhGLK1 The overexpression materials and knockout materials were cultured with the control receptor (Z49) for callus tissue, and it was found that the callus growth rate of OE-GLK was significantly faster than that of the control Z49; while the callus growth rate of CR-GLK was significantly slower than that of the control Z49. GhGLK1 The gene has the effect of accelerating callus growth.

[0046] The present invention has been described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0047] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0048] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0049] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0050] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, can be equivalent parameters, concentration and conditions, implement the present invention in a wide range. Although the present invention provides special embodiments, it should be understood that the present invention can be further improved. In a word, by the principle of the present invention, the application is intended to include any variation, purposes or improvements to the present invention, including departing from the disclosed range in the application, and the changes performed with conventional techniques known in the art.

Claims

1. Application of increasing protein content and / or activity, characterized in that, The application is any of the following: A1) Application in improving the growth or differentiation of cotton callus; A2) Application in shortening the cultivation cycle of transgenic cotton; The protein meets the following conditions: B1) a protein having an amino acid sequence of SEQ ID NO. 1; B2) A fusion protein with the same function as B1) is obtained by connecting a tag to the N-terminus and / or C-terminus.

2. Use of a biomaterial related to the protein according to claim 1, characterized in that: The application is any of the following: D1) Application in improving cotton callus growth or differentiation; D2) Application in shortening the cultivation cycle of transgenic cotton; The biological material is any one of the following E1) to E7): E1) a nucleic acid molecule that promotes or increases the expression of the gene encoding the protein according to claim 1; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

3. The use according to claim 2, characterized in that The CDS sequence of the gene encoding the protein is shown in SEQ ID NO.

2.

4. A method for improving plant callus growth or differentiation, characterized in that: The method comprises increasing the content and / or activity of the protein of claim 1 in a target plant, thereby obtaining a plant having a callus growth or differentiation degree higher than that of the target plant, wherein the plant is cotton.

5. The method according to claim 4, characterized in that The increasing of the content and / or activity of the protein of claim 1 in the target plant is achieved by increasing the expression level of the gene encoding the protein in the target plant.

6. The method according to claim 5, characterized in that The method of increasing the expression level of the gene encoding the protein in the target plant is to increase the expression level of the gene encoding the protein according to claim 1 in the genome of the target plant using transgenic technology.

7. The method according to claim 6, characterized in that The use of transgenic technology to increase the expression level of the gene encoding the protein of claim 1 in the genome of the target plant is carried out by introducing a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

Citation Information

Patent Citations

  • Cotton MYB transcription factor and encoding gene and application thereof

    CN103288945A

  • Application of ZmGLK1 in improvement of strong light stress resistance and yield of plants

    CN111172188A

  • Cotton fiber length related gene GhMYS1 and application thereof

    CN118773204A