Primer pair for identifying gender of sturgeons and application of primer pair

By designing specific primer pairs combined with PCR amplification technology, the problems of low accuracy and damage in the phased gender identification of sturgeon juvenile fish were solved, and non-invasive identification with high accuracy was achieved, and the efficient development of the sturgeon breeding industry was promoted.

CN120519561APending Publication Date: 2025-08-22YANGTZE UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510900321.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

The existing technology is difficult to quickly and accurately identify the gender of sturgeons in the juvenile stage. The traditional methods have great damage or are limited by maturity. The existing primers have low accuracy, making it difficult to meet the economic needs of sturgeon breeding.

Method used

Specific primer pairs were designed, combined with PCR amplification technology, and female-specific DNA fragments were used to identify sturgeons with an accuracy rate of 98%.

Benefits of technology

The gender identification of sturgeons during the non-invasive, rapid and full growth cycle has been achieved, with high accuracy, reduced the risk of misjudgment, and optimized the allocation of breeding resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519561A_ABST
    Figure CN120519561A_ABST
Patent Text Reader

Abstract

The invention discloses a primer pair for identifying genders of sturgeons and application of the primer pair, and relates to the technical field of biological detection. The primer pair comprises an upstream primer of which the nucleotide sequence is shown as SEQ ID NO.2 and a downstream primer of which the nucleotide sequence is shown as SEQ ID NO.3. The primer pair is combined with a PCR amplification technology, molecular identification of sturgeon genders can be rapidly and accurately achieved in the juvenile fish stage, and the accuracy rate reaches 98%. Compared with a traditional method, the method has the advantages that damage to fish bodies or limitation to mature individuals is avoided, and noninvasive sex identification suitable for the whole growth cycle is achieved. In addition, compared with other low-accuracy molecular identification methods, the primer pair has higher identification accuracy, and can effectively reduce the risk of misjudgment. The method is of great significance in promoting the sturgeon breeding industry to develop towards the efficient and accurate direction, and a solid foundation is laid for technical research and development in related fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, in particular to a primer pair for identifying the sex of sturgeons and application thereof. Background Art

[0002] Male and female sturgeons lack distinct secondary sexual characteristics, making them difficult to distinguish. Traditional identification methods, such as puncture and ultrasound, have significant drawbacks, especially at the juvenile stage. Puncture is highly damaging to the fish, while ultrasound is only suitable for mature sturgeons, failing to meet the needs of early sex identification. Furthermore, female sturgeons can produce high-value caviar (commonly known as "black gold") after 5-10 years of farming, while male sturgeons are primarily sold as commercial fish with relatively low economic value. Therefore, rapid and accurate sex identification of sturgeons at the juvenile stage is crucial, effectively saving farming costs and optimizing resource allocation.

[0003] In recent years, with the advancement of genome sequencing technology and the analysis of the complete genome sequences of sturgeons such as the Chinese sturgeon, the small-bodied sturgeon, and the Siberian sturgeon, bioinformatics methods have enabled the identification of female-specific DNA fragments. Primers designed based on these fragments, combined with PCR amplification, enable rapid molecular identification of sturgeon sex. However, the accuracy of existing primers varies widely, with some achieving only 70% accuracy, making them insufficient for practical applications. Therefore, developing a highly accurate and reliable primer pair for precise sturgeon sex identification has become an urgent technical challenge. Summary of the Invention

[0004] The present invention aims to provide a primer pair for identifying the sex of sturgeons and its application to address the above-mentioned problems in the prior art. The primer pair can quickly and accurately perform molecular identification of the sex of sturgeons with an accuracy rate of 98%.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a primer pair for identifying the sex of sturgeons, comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0007] The present invention also provides the use of the primer pair in preparing a sturgeon sex identification product.

[0008] Furthermore, the sturgeons include Chinese sturgeon, Acipenser schrenckii ...siberianus, Acipenser russianus, Acipenser yangtze or Acipenser spp.

[0009] Furthermore, the product is a kit.

[0010] The present invention also provides a product for sturgeon sex identification, comprising the above primer pair.

[0011] Furthermore, the sturgeons include Chinese sturgeon, Acipenser schrenckii ...siberianus, Acipenser russianus, Acipenser yangtze or Acipenser spp.

[0012] Furthermore, the product is a kit.

[0013] The present invention also provides an application of a molecular marker in identifying the sex of sturgeons, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1.

[0014] The present invention also provides the use of the primer pair or product in identifying the sex of sturgeons.

[0015] The present invention also provides a method for identifying the sex of sturgeons, comprising the following steps:

[0016] Extracting genomic DNA of the sample to be tested;

[0017] Using the genomic DNA as a template, PCR amplification is performed using the above primer pair to obtain a PCR amplification product;

[0018] The PCR amplification product was subjected to electrophoresis detection, and when a specific band of 865 bp appeared, it was determined to be female.

[0019] The present invention discloses the following technical effects:

[0020] This study has developed a primer pair for identifying the sex of sturgeons. Combined with PCR amplification technology, this primer pair enables rapid and accurate molecular sex identification of sturgeons at the juvenile stage, with an accuracy rate of 98%. The primer pair is designed based on female-specific DNA fragments, and through in-depth bioinformatics analysis and experimental validation, its specificity and stability during the amplification process are ensured.

[0021] Compared to traditional methods such as puncture and ultrasound, this method avoids damaging the fish or limiting the use of mature individuals, achieving non-invasive sex identification that is applicable throughout the entire growth cycle. Furthermore, compared to other molecular identification methods with lower accuracy rates, the primer pairs of this invention have a higher identification accuracy rate, effectively reducing the risk of misidentification.

[0022] The present invention is of great significance in promoting the development of sturgeon farming towards high efficiency and precision, and lays a solid foundation for technological research and development in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 The electrophoresis detection diagram of PCR amplification of a pair of female sturgeons using primers; among them, lanes 1-7 are female individuals; 9-15 are male individuals; and 8 is a marker. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] The primer information involved in the present invention is shown in Table 1.

[0031] Table 1 Primer information

[0032]

[0033] Example 1

[0034] A female-specific DNA fragment (SEQ ID NO. 1) was identified by genome-wide analysis of the Chinese sturgeon (Acipenser sinensis). Specific primer pair 1 (see Table 1) was designed and used for sex identification via PCR amplification. The PCR amplification reaction system consisted of: Ex Taq (0.125 μL); 10× Ex Taq Buffer (2.5 μL); dNTP Mixture (2.0 μL); DNA (2.0 μL); F / R (2.0 μL); and ddH2O (16.375 μL). The PCR amplification protocol consisted of 30 cycles of initial denaturation at 98°C for 2 min, followed by denaturation at 98°C for 10 s, annealing at 53°C for 50 s, and extension at 72°C for 90 s. The final extension was at 72°C for 5 min, followed by a 16°C incubation period.

[0035] Amplification was performed using specific primer pair 1 for each of the Chinese sturgeon, Acipenser schrenckii, Acipenser swinhoei, Acipenser siberianus, Acipenser russianus, Acipenser yangtze, and Acipenser sterletus. The internal reference primer pair inner 300 on the mitochondria served as a positive control. The results showed that two bands were amplified in the female genomic DNA of each sturgeon: one specific band (865 bp) amplified by primer pair 1 and the other a band amplified by the internal reference primer pair inner 300. However, only the band amplified by the internal reference primer pair inner 300 was amplified in the male genomic DNA of each sturgeon. Figure 1 , indicating that primer pair 1 can be used for sex identification of sturgeons.

[0036] SEQ ID NO.1:

[0037] ACTTTAGCAGAGAAACTGTAGGAAGAGGATTAGATTGCACAGCAAGAGAGATTTACCATTAAAGCCATGCAATGTAATAGTTTTAGCAGAAGCGTTGGGAGGTGAGTCAGAATGTACAATAGTTAATGATGCACCTGTGTTTACTAAACACATGCTGGTCTGACCTCCTAGACTAGCTTCAACAATCGGGCAACCAAAAGAATCTCTAAGTATATATGCCACCTTATCCGATGTCTGACCCCTTCATTGTTTTTCTGTTCTTGTAATTTTTTTACGCAAGTCTCTATATGAGACATGAGGCTCTGGGCAGTCTTTATAGCCGTGCACTGGTTGTAAAACACTCCCTTCAGTGATTATTTTATTACAAATGACTGCTAAAATACTGTAATCTTTCGTATAGTGCAAAAATACTGTAATTTTTCGTATACTCACCGTAATAAAATACTCATGTCTGGCACACAGACACGGTTAACTGTCTGCTGTAATGTTTAGAGACAGTCTGTTCCTAACCATAAATGCAACCCATTTCCTCTTTTGGCACATACATCTAGGTTGTTTCTACTTCATAAAATACTGTAATCTTTCGTATATTCACCAAGTCAACCTGGCCTCAGGAAAAGGGATTTTCTTCAGATGTCCAGTTGTCCTGCCCGAAGGTGTTTTCTGGTCGGGGGTCGACATCTTCTGGCTGGCTCACCAAAAATGTAGAGGTTCGATTTCTTCTTAAAAATAATTAATCTTTTTCAGGTAAAGTTAATCAAAAATAGTTTATTCAGTAATCAAAATGCAAACAGGAACAAAGCAAATCAAAGGTGATACATCAGGGATCTCACATACAAGTCTGATGGTGTTCTGAGCTGGCATC.

[0038] Example 2

[0039] The sex of 50 Chinese sturgeons was determined by PCR amplification using primer pairs 2-5 and the primer pair 1 designed by the present invention. When a specific band of 865 bp appeared in the electrophoresis test results of the PCR amplification using primer pair 1, the sturgeon was determined to be female.

[0040] The identification results are shown in Table 2. Among them, the PCR amplification effect of primer pair 2 was very poor and could not accurately identify the gender. The identification accuracy of primer pair 1 designed by the present invention reached 98%.

[0041] Table 2 Sex identification results

[0042]

[0043]

[0044] Note: The gold standard is the puncture identification method.

[0045] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A primer pair for identifying the sex of sturgeons, characterized in that: It includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

3.

2. Use of the primer pair according to claim 1 in preparing a product for sex identification of sturgeons.

3. The use according to claim 2, characterized in that The sturgeons include the Chinese sturgeon, the Acipenser schrenckii ... Siberian sturgeon, the Russian sturgeon, the Yangtze sturgeon or the small-bodied sturgeon.

4. The use according to claim 2, characterized in that The product is a test kit.

5. A product for sex identification of sturgeons, characterized in that: Comprising the primer pair according to claim 1.

6. The product according to claim 5, characterized in that The sturgeons include the Chinese sturgeon, the Acipenser schrenckii ... Siberian sturgeon, the Russian sturgeon, the Yangtze sturgeon or the small-bodied sturgeon.

7. The product according to claim 5, characterized in that The product is a test kit.

8. An application of a molecular marker in identifying the sex of sturgeons, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1.

9. Use of the primer pair according to claim 1 or the product according to any one of claims 5 to 7 in identifying the sex of sturgeons.

10. A method for identifying the sex of sturgeons, characterized in that: The following steps are involved: Extracting genomic DNA of the sample to be tested; Using the genomic DNA as a template, PCR amplification is performed using the primer pair of claim 1 to obtain a PCR amplification product; The PCR amplification product was subjected to electrophoresis detection, and when a specific band of 865 bp appeared, it was determined to be female.