Muskmelon SNP marker combination based on KASP technology and application thereof
By developing melon SNP tag combination and KASP primer combination, the problems of low efficiency and insufficient polymorphism in melon variety identification were solved, and efficient and accurate variety identification and DNA fingerprint construction were achieved, which was suitable for melon variety identification and germplasm resource management.
Patent Information
- Application Number
- CN202510176742.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-18
- Publication Date
- 2025-08-22
AI Technical Summary
The prior art is difficult to identify melon varieties efficiently and accurately. The traditional methods are inefficient and susceptible to environmental factors. The conventional isoenzyme marker has low polymorphism identification and lacks a high-throughput KASP molecular marker technology system.
A set of melon SNP tag combinations based on KASP technology, including 24 SNP sites and corresponding KASP primer combinations, were developed to prepare detection kits, identify varieties consistency, and construct DNA fingerprints to detect genotypes by fluorescence quantitative PCR or ArrayTape platform.
It realizes accurate and convenient identification of melon varieties, with stable and reliable test results, simple and fast operation, and is suitable for large-scale and standardized applications.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a melon SNP marker combination based on KASP technology and an application thereof. Background Art
[0002] Muskmelon (Cucumis melo L.) is one of my country's major fruit crops. With the increasing number of melon varieties, the difficulty of variety identification and protection has increased dramatically. Traditional field variety identification methods are inefficient and susceptible to environmental factors. Conventional isozyme marker identification techniques have low polymorphism and limited available enzyme types. Therefore, establishing a technical system for efficient and accurate identification of melon varieties has become one of the most pressing challenges in melon breeding and production.
[0003] SNPs are DNA sequence polymorphisms caused by single nucleotide variations at the chromosomal genome level, including single-base transitions, transversions, insertions, and deletions. They are widely used in population genetics analysis, construction of genetic linkage maps and fingerprints, and marker-assisted breeding. To date, there are few reports on the use of KASP molecular markers for variety identification in melons, and there is no dedicated high-throughput KASP molecular marker technology system. Summary of the Invention
[0004] The purpose of the present invention is to provide a set of KASP primer combinations for melon variety identification and applications thereof.
[0005] The present invention claims protection for the use of 24 SNP sites in the melon genome in any of the following applications:
[0006] (1) preparing a melon SNP site detection kit;
[0007] (2) Identify the consistency of melon varieties;
[0008] (3) construct DNA fingerprints of melon germplasm resources or varieties;
[0009] The physical locations of the 24 SNP sites were determined based on the comparison of the whole genome sequence of melon, which is in Genome assembly USDA_Cmelo_AY_1.0 and has an NCBI database number of GCF_025177605.1. The 24 SNP sites are:
[0010] CMSNP19 is located at position 12828503 on chromosome 1, and its deoxynucleotides are G or A;
[0011] CMSNP17 is located at position 23681586 on chromosome 1, and its deoxynucleotides are C or T;
[0012] CMSNP74 is located at position 690732 on chromosome 2, and its deoxynucleotides are T or C;
[0013] CMSNP77 is located at position 25058034 on chromosome 2, and its deoxynucleotides are G or A;
[0014] CMSNP96 is located at position 16292381 on chromosome 3, and its deoxynucleotides are C or T;
[0015] CMSNP88 is located at position 30497735 on chromosome 3, and its deoxynucleotides are C or T;
[0016] CMSNP137 is located at position 10512232 on chromosome 4, and its deoxynucleotides are C or T;
[0017] CMSNP134 is located at position 17230948 on chromosome 4, and its deoxynucleotides are C or T;
[0018] CMSNP197 is located at position 9430409 on chromosome 5, and its deoxynucleotides are C or G;
[0019] CMSNP184 is located at position 30,089,894 on chromosome 5, and its deoxynucleotides are T or A;
[0020] CMSNP211 is located at position 1379693 on chromosome 6, and its deoxynucleotides are A or G;
[0021] CMSNP219 is located at position 27577707 on chromosome 6, and its deoxynucleotides are T or C;
[0022] CMSNP221 is located at position 11121168 on chromosome 7, and its deoxynucleotides are T or G;
[0023] CMSNP239 is located at position 28717805 on chromosome 7, and its deoxynucleotides are G or A;
[0024] CMSNP259 is located at position 4090484 on chromosome 8, and its deoxynucleotides are T or A;
[0025] CMSNP251 is located at position 33140704 on chromosome 8, and its deoxynucleotides are A or G;
[0026] CMSNP262 is located at position 17757721 on chromosome 9, and its deoxynucleotides are T or C;
[0027] CMSNP273 is located at position 24355761 on chromosome 9, and its deoxynucleotides are A or G;
[0028] CMSNP281 is located at position 5631284 on chromosome 10, and its deoxynucleotides are T or C;
[0029] CMSNP298 is located at position 1441832 on chromosome 10, and its deoxynucleotides are G or A;
[0030] CMSNP319 is located at position 9316645 on chromosome 11, and its deoxynucleotides are T or C;
[0031] CMSNP317 is located at position 19763051 on chromosome 11, and its deoxynucleotides are C or T;
[0032] CMSNP464 is located at position 13426296 on chromosome 12, and its deoxynucleotides are C or A;
[0033] CMSNP462 is located at position 20937209 on chromosome 12, and its deoxynucleotides are T or G.
[0034] The present invention claims a set of KASP primers, wherein the primers are KASP primers for detecting the above-mentioned 24 SNP sites;
[0035] The KASP primers corresponding to each SNP site to be tested include two forward primers and one reverse primer; the two forward primers are respectively denoted as forward primer 1 and forward primer 2; forward primer 1 is obtained by connecting a fluorescent tag sequence to the 5' end of specific primer 1, and forward primer 2 is obtained by connecting another fluorescent tag sequence to the 5' end of specific primer 2;
[0036] The specific primer 1 for detecting CMSNP19 consists of nucleotides 22 and later of SEQ ID No. 1, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 2, and the reverse primer consists of nucleotides shown in SEQ ID No. 3;
[0037] The specific primer 1 for detecting CMSNP17 consists of nucleotides 22 and later of SEQ ID No. 4, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 5, and the reverse primer consists of nucleotides shown in SEQ ID No. 6;
[0038] The specific primer 1 for detecting CMSNP74 consists of nucleotides 22 and later of SEQ ID No. 7, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 8, and the reverse primer consists of nucleotides shown in SEQ ID No. 9;
[0039] The specific primer 1 for detecting CMSNP77 consists of nucleotides 22 and later of SEQ ID No. 10, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 11, and the reverse primer consists of nucleotides shown in SEQ ID No. 12;
[0040] The specific primer 1 for detecting CMSNP96 consists of nucleotides 22 and later of SEQ ID No. 13, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 14, and the reverse primer consists of nucleotides shown in SEQ ID No. 15;
[0041] The specific primer 1 for detecting CMSNP88 consists of nucleotides 22 and later of SEQ ID No. 16, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 17, and the reverse primer consists of nucleotides shown in SEQ ID No. 18;
[0042] The specific primer 1 for detecting CMSNP137 consists of nucleotides 22 and later of SEQ ID No. 19, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 20, and the reverse primer consists of nucleotides shown in SEQ ID No. 21;
[0043] The specific primer 1 for detecting CMSNP134 consists of nucleotides 22 and later of SEQ ID No. 22, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 23, and the reverse primer consists of nucleotides shown in SEQ ID No. 24;
[0044] The specific primer 1 for detecting CMSNP197 consists of nucleotides 22 and later of SEQ ID No. 25, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 26, and the reverse primer consists of nucleotides shown in SEQ ID No. 27;
[0045] The specific primer 1 for detecting CMSNP184 consists of nucleotides 22 and later of SEQ ID No. 28, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 29, and the reverse primer consists of nucleotides shown in SEQ ID No. 30;
[0046] The specific primer 1 for detecting CMSNP211 consists of nucleotides 22 and later of SEQ ID No.31, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.32, and the reverse primer consists of nucleotides shown in SEQ ID No.33;
[0047] The specific primer 1 for detecting CMSNP219 consists of nucleotides 22 and later of SEQ ID No.34, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.35, and the reverse primer consists of nucleotides shown in SEQ ID No.36;
[0048] The specific primer 1 for detecting CMSNP221 consists of nucleotides 22 and later of SEQ ID No.37, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.38, and the reverse primer consists of nucleotides shown in SEQ ID No.39;
[0049] The specific primer 1 for detecting CMSNP239 consists of nucleotides 22 and later of SEQ ID No.40, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.41, and the reverse primer consists of the nucleotides shown in SEQ ID No.42;
[0050] The specific primer 1 for detecting CMSNP259 consists of nucleotides 22 and later of SEQ ID No.43, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.44, and the reverse primer consists of nucleotides shown in SEQ ID No.45;
[0051] The specific primer 1 for detecting CMSNP251 consists of nucleotides 22 and later of SEQ ID No.46, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.47, and the reverse primer consists of nucleotides shown in SEQ ID No.48;
[0052] The specific primer 1 for detecting CMSNP262 consists of nucleotides 22 and later of SEQ ID No.49, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.50, and the reverse primer consists of nucleotides shown in SEQ ID No.51;
[0053] The specific primer 1 for detecting CMSNP273 consists of nucleotides 22 and later of SEQ ID No.52, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.53, and the reverse primer consists of nucleotides shown in SEQ ID No.54;
[0054] The specific primer 1 for detecting CMSNP281 consists of nucleotides 22 and later of SEQ ID No. 55, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 56, and the reverse primer consists of nucleotides shown in SEQ ID No. 57;
[0055] The specific primer 1 for detecting CMSNP298 consists of nucleotides 22 and later of SEQ ID No.58, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.59, and the reverse primer consists of nucleotides shown in SEQ ID No.60;
[0056] The specific primer 1 for detecting CMSNP319 consists of nucleotides 22 and later of SEQ ID No.61, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.62, and the reverse primer consists of nucleotides shown in SEQ ID No.63;
[0057] The specific primer 1 for detecting CMSNP317 consists of nucleotides 22 and later of SEQ ID No. 64, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 65, and the reverse primer consists of nucleotides shown in SEQ ID No. 66;
[0058] The specific primer 1 for detecting CMSNP464 consists of nucleotides 22 and thereafter of SEQ ID No. 67, the specific primer 2 consists of nucleotides 22 and thereafter of SEQ ID No. 68, and the reverse primer consists of nucleotides shown in SEQ ID No. 69;
[0059] The specific primer 1 for detecting CMSNP462 consists of nucleotides 22 and later of SEQ ID No. 70, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 71, and the reverse primer consists of the nucleotides shown in SEQ ID No. 72.
[0060] Furthermore, in the forward primer 1, the fluorescent tag sequence connected to the 5' end is a VIC tag sequence; and / or in the forward primer 2, the fluorescent tag sequence connected to the 5' end is a FAM tag sequence.
[0061] Furthermore, the VIC tag sequence is shown as 1st to 21st positions of SEQ ID No. 1; and / or the FAM tag sequence is shown as 1st to 21st positions of SEQ ID No. 2
[0062] The present invention also claims a kit containing the above-mentioned set of KASP primers.
[0063] The use of the above-mentioned set of KASP primers or the above-mentioned kit in any of the following applications should also fall within the scope of protection of the present invention:
[0064] (1) preparing a melon SNP site detection kit;
[0065] (2) Identify the consistency of melon varieties;
[0066] (3) Construct DNA fingerprints of melon germplasm resources or varieties.
[0067] The present invention provides a method for constructing a DNA fingerprint map of melon germplasm resources or varieties, comprising: detecting the genotypes of the above-mentioned 24 SNP sites in the genomes of different melon varieties, and recording the genotypes of the 24 SNP sites in the genomes of each melon variety respectively, to obtain a DNA fingerprint map of the melon germplasm resources or varieties.
[0068] The present invention provides a method for identifying melon germplasm resources or varieties, which detects the genotype of the above-mentioned 24 SNP sites in the genome of the melon to be tested and compares them with the DNA fingerprint maps of melon germplasm resources or varieties of different varieties. If the genotype of the melon to be tested is completely consistent with the fingerprint map comparison result of a certain melon, the melon to be tested is of that variety.
[0069] The present invention provides a method for identifying consistency of melon varieties, comprising the following steps: obtaining the genotype of the melon to be tested at the above-mentioned 24 SNP sites, that is, the fingerprint of the melon to be tested; if the number of difference sites is ≥2 after comparing the fingerprints of two melons to be tested, the two melons to be tested are different varieties; if the number of difference sites is <2, the two melons to be tested are similar varieties.
[0070] Experiments conducted in the present invention have demonstrated that the melon KASP primer combination developed in the present invention can be used to identify melon varieties to be tested, making the operation of distinguishing the authenticity of varieties accurate and convenient. The KASP primer combination covers the entire melon genome and has a unique amplification stable point, making it highly representative. The method provides stable and reliable detection results, is simple and rapid to operate, and can achieve scaled and standardized detection. BRIEF DESCRIPTION OF THE DRAWINGS
[0071] Figure 1 This is an example of the KASP molecular marker typing diagram for 48 melon varieties;
[0072] Figure 2 This is the genetic clustering diagram of 48 melon varieties. DETAILED DESCRIPTION
[0073] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0074] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0075] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged. SUMMARY OF THE INVENTION
[0077] The present invention firstly protects the use of a substance for detecting genotypes of 24 SNP sites in the identification of muskmelon varieties;
[0078] The 24 SNP sites are shown in Table 1 below:
[0079] Table 1. Information of 24 SNP sites
[0080]
[0081] The above positions refer to the melon genome version: Genome assembly USDA_Cmelo_AY_1.0, and the NCBI database number is GCF_025177605.1.
[0082] In an embodiment of the present invention, the substance for detecting the genotype of 24 SNP sites is a primer combination; the primer combination consists of 24 specific primer groups;
[0083] Primer set 1 consists of the single-stranded DNA molecules shown in sequences 1-3 of the sequence listing;
[0084] Primer set 2 consists of single-stranded DNA molecules represented by sequences 4-6 in the sequence listing;
[0085] Primer set 3 consists of single-stranded DNA molecules represented by sequences 7-9 in the sequence listing;
[0086] Primer set 4 consists of the single-stranded DNA molecules shown in sequences 10-12 of the sequence listing;
[0087] Primer set 5 consists of the single-stranded DNA molecules shown in sequences 13-15 of the sequence listing;
[0088] Primer set 6 consists of the single-stranded DNA molecules shown in sequences 16-18 of the sequence listing;
[0089] Primer set 7 consists of the single-stranded DNA molecules shown in sequences 19-21 of the sequence listing;
[0090] Primer set 8 consists of the single-stranded DNA molecules shown in sequences 22-24 of the sequence listing;
[0091] Primer set 9 consists of the single-stranded DNA molecules shown in sequences 25-27 of the sequence listing;
[0092] Primer set 10 consists of the single-stranded DNA molecules shown in sequences 28-30 of the sequence listing;
[0093] Primer set 11 consists of the single-stranded DNA molecules shown in sequences 31-33 of the sequence listing;
[0094] Primer set 12 consists of the single-stranded DNA molecules shown in sequences 34-36 of the sequence listing;
[0095] Primer set 13 consists of the single-stranded DNA molecules shown in sequences 37-39 of the sequence listing;
[0096] Primer set 14 consists of the single-stranded DNA molecules shown in sequences 40-42 of the sequence listing;
[0097] Primer set 15 consists of the single-stranded DNA molecules shown in sequences 43-45 of the sequence listing;
[0098] Primer set 16 consists of the single-stranded DNA molecules shown in sequences 46-48 of the sequence listing;
[0099] Primer set 17 consists of the single-stranded DNA molecules shown in sequences 49-51 of the sequence listing;
[0100] Primer set 18 consists of the single-stranded DNA molecules shown in sequences 52-54 of the sequence listing;
[0101] Primer set 19 consists of the single-stranded DNA molecules shown in sequences 55-57 of the sequence listing;
[0102] Primer set 20 consists of the single-stranded DNA molecules shown in sequences 58-60 of the sequence listing;
[0103] Primer set 21 consists of the single-stranded DNA molecules shown in sequences 61-63 of the sequence listing;
[0104] Primer set 22 consists of the single-stranded DNA molecules shown in sequences 64-66 of the sequence listing;
[0105] Primer set 23 consists of the single-stranded DNA molecules shown in sequences 67-69 of the sequence listing;
[0106] Primer set 24 consists of single-stranded DNA molecules represented by sequences 70 to 72 in the sequence listing.
[0107] The present invention also protects a primer combination consisting of single-stranded DNA molecules shown in sequence 1 to sequence 72 in the sequence listing.
[0108] In the primer combination, the concentration of each primer is the same.
[0109] The primer combination is used for identifying melon varieties.
[0110] The present invention also protects a method for constructing a DNA fingerprint library of melon varieties, comprising the following steps: obtaining the genotypes of 48 melon varieties at the 24 SNP sites described in Table 1, i.e., a fingerprint library of these 48 melon varieties; and comparing the fingerprint of a melon to be tested with the aforementioned melon fingerprint library. If the fingerprint of the melon to be tested is completely consistent with the comparison result of a particular melon in the aforementioned melon fingerprint library, the melon to be tested is that particular melon variety. The information of these 48 melon varieties is shown in Table 2:
[0111] Table 2. Information on 48 melon varieties
[0112] Variety number Variety name Variety type Affiliated company or unit Variety number Variety name Variety type Affiliated company or unit Cm_01 1788(1)-1 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_25 Red Honey Crisp No. 3 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_02 1712(1)-1 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_26 Red Honey Crisp No. 4 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_03 1829(1)-2 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_27 Red Honey Crisp No. 5 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_04 1651(1)-2 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_28 Red honey fragrance hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_05 832(1)-3 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_29 Qingwang No. 1 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_06 1593(1)-1 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_30 Qingwang No. 2 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_07 1823(1)-1 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_31 Qingwang No. 3 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_08 1574(1)-2 hybrids Ningxia Zhongqing Agricultural Science and Technology Co., Ltd. Cm_32 Youth Network No. 5 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_09 160501 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_33 Green flesh reticulate hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_10 160502 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_34 Golden Orange-2 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_11 160503 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_35 Big Red Skin No. 1 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_12 160504 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_36 Green Jadeite hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_13 160505 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_37 Green Emerald 2 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_14 160506 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_38 Green Jade 3 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_15 1806 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_39 17234 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_16 1809 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_40 Bai Yuxiang hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_17 Crispy Lamb Horn hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_41 18594 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_18 Eight-angled cucumber hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_42 Baiyuxiang No. 3 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_19 Yulu No. 2 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_43 Snow Sheep No. 1 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_20 Yulu No. 3 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_44 Flower Sheep No. 1-1 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_21 Three-color honey hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_45 18618 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_22 White Honey Crisp hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_46 18619 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_23 Red Honey Crisp hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_47 18413 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_24 Red Honey Crisp No. 2 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd. Cm_48 18629 hybrids Shenzhou Lvpeng Agricultural Technology Co., Ltd.
[0113] In any of the above methods, the "obtaining the genotypes of 48 melon varieties at the 24 SNP sites described in Table 1" or "fingerprints of the melons to be tested" is achieved by the following detection method:
[0114] The method comprises the following steps: using the 24 primer sets to PCR amplify the genomic DNA of melon to obtain genotype results. The PCR amplification can be performed using a fluorescent quantitative PCR instrument AB-Q6 Flex or an ArrayTape platform from Douglas Scientific.
[0115] The reaction system (5 μL) for detection using the AB-Q6 Flex fluorescence quantitative PCR instrument (Thermo Fisher Scientific (China) Co., Ltd.) was as follows: 1.0 μL of genomic DNA (50 ng / μL), 0.7 μL of primer mix (each primer in the primer mix was 100 pmol / L), 2.5 μL of 2× KASP Mix (Aigene Technology (Shanghai) Co., Ltd., Cat. No. 1536), and 1.43 μL of ddH2O. The reaction program was: 1 cycle of pre-denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 20 s and annealing at 55°C for 60 s. The sample table was edited, the run was executed, and the data were saved according to the instrument manual.
[0116] The reaction system (1.6 μL) for detection using the ArrayTape platform consisted of 0.8 μL of genomic DNA (50 ng / μL) + 0.03 μL of primer mix (each primer in the primer mix was 100 pmol / L) + 0.8 μL of 2× KASP Mix (Aigene Technology (Shanghai) Co., Ltd., Cat. No. 1536). The reaction procedure was: 1 cycle of pre-denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 20 s and annealing at 55°C for 60 s. The protocol was run and data were saved according to the ArrayTape platform instrument manual.
[0117] The present invention also protects a method for identifying consistency of melon varieties, comprising the following steps: obtaining the genotype of the melon to be tested at the above-mentioned 24 SNP sites, that is, the fingerprint of the melon to be tested; if after comparing the fingerprints of two melons to be tested, the number of difference sites is ≥2, then the two melons to be tested are different varieties; if the number of difference sites is <2, then the two melons to be tested are similar varieties.
[0118] Example 1. Screening of KASP primer combinations
[0119] A large number of sequence and functional analyses were performed on the melon genome, and 24 SNP sites were screened (Table 1) (physical coordinates refer to the melon genome version: Genome assembly USDA_Cmelo_AY_1.0, NCBI database number: GCF_025177605.1). KASP primers were designed for these sites, and more than 200 designed primer pairs were screened to select primers with stable amplification effects and clear typing. The KASP primer combinations for melon variety identification were obtained, as shown in Table 3. The typing diagrams of the materials shown in Table 2 were amplified and detected using the primers shown in Table 3. Figure 1 .
[0120] Table 3. Information of 24 pairs of KASP primers
[0121]
[0122]
[0123] In Table 3, the bold font is the VIC linker sequence; the underlined “ GAAGGTGACCAAGTTCATGCT " is the FAM linker sequence.
[0124] Example 2: Identification and application of muskmelon varieties
[0125] 1. Construction of melon DNA fingerprint library
[0126] 1. The genomic DNA of 48 young leaves of melon (Table 1) was extracted using the CTAB method.
[0127] 2. Perform PCR amplification on 48 test melon samples using the 24 primer sets listed in Table 3 (all 24 primer sets in the same reaction system) to determine the genotypes of the 24 SNPs. This can be done using a fluorescent quantitative PCR instrument (AB-Q6 Flex) or the Douglas Scientific ArrayTape platform.
[0128] The reaction system (5 μL) for detection using a fluorescent quantitative PCR instrument, AB-Q6 Flex (Thermo Fisher Scientific (China) Co., Ltd.), was as follows: 1.0 μL of genomic DNA (50 ng / μL) + 0.7 μL of primer mix (the concentration of each primer in the primer set of Example 1 in the primer mix was 100 pmol / L) + 2.5 μL of 2× KASP Mix (Aijixi Technology (Shanghai) Co., Ltd., Cat. No. 1536) + 1.43 μL of ddH₂O. The reaction program was: 1 cycle of pre-denaturation at 95°C for 10 min; 40 cycles of denaturation at 95°C for 20 s and annealing at 55°C for 60 s. The sample table was edited, the run program was executed, and the data was saved according to the instrument manual for the fluorescent quantitative PCR instrument, which was used for the analysis.
[0129] The reaction system (1.6 μL) for detection using the ArrayTape platform consisted of: 0.8 μL of genomic DNA (50 ng / μL) + 0.03 μL of primer mix (the concentration of each primer in the primer set of Example 1 in the primer mix was 100 pmol / L) + 0.8 μL of 2× KASP Mix (Aigene Technology (Shanghai) Co., Ltd., Catalog No. 1536). The reaction procedure was: 1 cycle of pre-denaturation at 95°C for 10 min; 40 cycles of denaturation at 95°C for 20 s and annealing at 55°C for 60 s. The program was run and data was saved according to the ArrayTape platform instrument operating manual.
[0130] Data recording: In the data obtained using the above two detection platforms, the genotype data of homozygous sites are recorded as Allele1 / Allele1 or Allele2 / Allele2, and the genotype data of heterozygous sites are recorded as Allele1 / Allele2, where Allele1 and Allele2 are the two alleles at the variant site respectively; the genotype data of the deletion site is recorded as 0; for example, the genotype of the sample at a certain site is Allele1 / Allele2, the allele base of the site is A / C, Allele1 represents base A, and the genotype at this site is recorded as A / C.
[0131] The genotypes of the 48 tested melons at 24 SNP loci are shown in Table 4.
[0132] Table 4. Genotypes of 48 melon varieties
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139] 3. Cluster analysis of the DNA fingerprints of the 96 varieties was performed using the Adegenet, Poppr, Ape, Phangorn, and Hierfstat packages of R (V 3.5.1) software and the tree format files were exported. Cluster mapping was performed using the Evolview online software (https: / / www.evolgenius.info / evolview / #login). Figure 2 As shown (the numbers in the figure correspond to those in Table 2). The results showed that the 24 pairs of KASP core primer combinations completely distinguished the 48 melon varieties.
[0140] 2. Methods for identifying species of samples to be tested
[0141] 1. Three groups of blind melon samples were randomly selected as test samples. The first group, numbered TEST01, TEST02, and TEST03, was used for variety identification; the second group, numbered TEST04 and TEST05, was used for consistency comparison; and the third group, numbered TEST06 and TEST07, was used for consistency comparison. Genomic DNA from the seven melon samples was first extracted using the CTAB method.
[0142] 2. PCR was performed using the method described in step 1 to obtain the genotype data of the sample at the 24 SNP sites. The results are shown in Table 5.
[0143] Table 5. Genotypes of 7 melon samples tested
[0144]
[0145] 3. According to the results of step 2, determine the melon variety to be tested. The determination method is as follows:
[0146] (1) Use the Adegenet, Poppr, Ape, Phangorn, and Hierfstat packages of R (V 3.5.1) software to compare the DNA fingerprint of the sample to be tested with the DNA fingerprint library of 96 melon varieties obtained in step 1. If the DNA fingerprint of the sample to be tested is the DNA fingerprint of a variety in the DNA fingerprint library, then the sample to be tested is or is a candidate for that variety.
[0147] The melon sample TEST01 to be tested was compared with the DNA fingerprint database of step one, and the result was that the DNA fingerprint of TEST01 was the same as that of "Yangjiaocui", and the sample TEST01 to be tested was considered to be the "Yangjiaocui" variety; the melon sample TEST02 to be tested was compared with the DNA fingerprint database of step one, and the result was that the DNA fingerprint of TEST02 was the same as that of "Yulu 2", and the sample TEST02 to be tested was considered to be the "Yulu 2" variety; the melon sample TEST03 to be tested was compared with the DNA fingerprint database of step one, and the result was that the DNA fingerprint of TEST03 was the same as that of "Huayang 1hao-1", and the sample TEST01 to be tested was considered to be the "Huayang 1hao-1" variety.
[0148] (2) Compare the fingerprints of different samples to be tested. When the number of difference sites between samples is ≥2, they are judged as "different varieties"; when the number of difference sites between samples is <2, they are judged as "similar varieties".
[0149] The fingerprints of the melon samples TEST04 and TEST05 were compared, and the results showed that the number of effective detection sites of the two samples was 24, and the number of difference sites was 20. Therefore, the melon samples TEST04 and TEST05 were judged to be different varieties; the fingerprints of the melon samples TEST06 and TEST07 were compared, and the results showed that the number of effective detection sites of the two samples was 24, and the number of difference sites was 0. Therefore, the melon samples TEST06 and TEST07 were judged to be similar varieties.
[0150] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
Claims
1. Application of 24 SNPs in the melon genome in any of the following: (1) preparing a melon SNP site detection kit; (2) Identify the consistency of melon varieties; (3) construct DNA fingerprints of melon germplasm resources or varieties; The physical locations of the 24 SNP sites were determined based on the comparison of the whole genome sequence of melon, which is in Genome assembly USDA_Cmelo_AY_1.0 and has an NCBI database number of GCF_025177605.
1. The 24 SNP sites are: CMSNP19 is located at position 12828503 on chromosome 1, and its deoxynucleotides are G or A; CMSNP17 is located at position 23681586 on chromosome 1, and its deoxynucleotides are C or T; CMSNP74 is located at position 690732 on chromosome 2, and its deoxynucleotides are T or C; CMSNP77 is located at position 25058034 on chromosome 2, and its deoxynucleotides are G or A; CMSNP96 is located at position 16292381 on chromosome 3, and its deoxynucleotides are C or T; CMSNP88 is located at position 30497735 on chromosome 3, and its deoxynucleotides are C or T; CMSNP137 is located at position 10512232 on chromosome 4, and its deoxynucleotides are C or T; CMSNP134 is located at position 17230948 on chromosome 4, and its deoxynucleotides are C or T; CMSNP197 is located at position 9430409 on chromosome 5, and its deoxynucleotides are C or G; CMSNP184 is located at position 30,089,894 on chromosome 5, and its deoxynucleotides are T or A; CMSNP211 is located at position 1379693 on chromosome 6, and its deoxynucleotides are A or G; CMSNP219 is located at position 27577707 on chromosome 6, and its deoxynucleotides are T or C; CMSNP221 is located at position 11121168 on chromosome 7, and its deoxynucleotides are T or G; CMSNP239 is located at position 28717805 on chromosome 7, and its deoxynucleotides are G or A; CMSNP259 is located at position 4090484 on chromosome 8, and its deoxynucleotides are T or A; CMSNP251 is located at position 33140704 on chromosome 8, and its deoxynucleotides are A or G; CMSNP262 is located at position 17757721 on chromosome 9, and its deoxynucleotides are T or C; CMSNP273 is located at position 24355761 on chromosome 9, and its deoxynucleotides are A or G; CMSNP281 is located at position 5631284 on chromosome 10, and its deoxynucleotides are T or C; CMSNP298 is located at position 1441832 on chromosome 10, and its deoxynucleotides are G or A; CMSNP319 is located at position 9316645 on chromosome 11, and its deoxynucleotides are T or C; CMSNP317 is located at position 19763051 on chromosome 11, and its deoxynucleotides are C or T; CMSNP464 is located at position 13426296 on chromosome 12, and its deoxynucleotides are C or A; CMSNP462 is located at position 20937209 on chromosome 12, and its deoxynucleotides are T or G.
2. A set of KASP primers for detecting the 24 SNP sites described in claim 1; The KASP primers corresponding to each SNP site to be tested include two forward primers and one reverse primer; the two forward primers are respectively denoted as forward primer 1 and forward primer 2; forward primer 1 is obtained by connecting a fluorescent tag sequence to the 5' end of specific primer 1, and forward primer 2 is obtained by connecting another fluorescent tag sequence to the 5' end of specific primer 2; The specific primer 1 for detecting CMSNP19 consists of nucleotides 22 and later of SEQ ID No. 1, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 2, and the reverse primer consists of nucleotides shown in SEQ ID No. 3; The specific primer 1 for detecting CMSNP17 consists of nucleotides 22 and later of SEQ ID No. 4, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 5, and the reverse primer consists of nucleotides shown in SEQ ID No. 6; The specific primer 1 for detecting CMSNP74 consists of nucleotides 22 and later of SEQ ID No. 7, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 8, and the reverse primer consists of nucleotides shown in SEQ ID No. 9; The specific primer 1 for detecting CMSNP77 consists of nucleotides 22 and later of SEQ ID No. 10, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 11, and the reverse primer consists of nucleotides shown in SEQ ID No. 12; The specific primer 1 for detecting CMSNP96 consists of nucleotides 22 and later of SEQ ID No. 13, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 14, and the reverse primer consists of nucleotides shown in SEQ ID No. 15; The specific primer 1 for detecting CMSNP88 consists of nucleotides 22 and later of SEQ ID No. 16, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 17, and the reverse primer consists of nucleotides shown in SEQ ID No. 18; The specific primer 1 for detecting CMSNP137 consists of nucleotides 22 and later of SEQ ID No. 19, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 20, and the reverse primer consists of nucleotides shown in SEQ ID No. 21; The specific primer 1 for detecting CMSNP134 consists of nucleotides 22 and later of SEQ ID No. 22, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 23, and the reverse primer consists of nucleotides shown in SEQ ID No. 24; The specific primer 1 for detecting CMSNP197 consists of nucleotides 22 and later of SEQ ID No. 25, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 26, and the reverse primer consists of nucleotides shown in SEQ ID No. 27; The specific primer 1 for detecting CMSNP184 consists of nucleotides 22 and later of SEQ ID No. 28, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 29, and the reverse primer consists of nucleotides shown in SEQ ID No. 30; The specific primer 1 for detecting CMSNP211 consists of nucleotides 22 and later of SEQ ID No.31, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.32, and the reverse primer consists of nucleotides shown in SEQ ID No.33; The specific primer 1 for detecting CMSNP219 consists of nucleotides 22 and later of SEQ ID No.34, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.35, and the reverse primer consists of nucleotides shown in SEQ ID No.36; The specific primer 1 for detecting CMSNP221 consists of nucleotides 22 and later of SEQ ID No.37, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.38, and the reverse primer consists of nucleotides shown in SEQ ID No.39; The specific primer 1 for detecting CMSNP239 consists of nucleotides 22 and later of SEQ ID No.40, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.41, and the reverse primer consists of the nucleotides shown in SEQ ID No.42; The specific primer 1 for detecting CMSNP259 consists of nucleotides 22 and later of SEQ ID No.43, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.44, and the reverse primer consists of nucleotides shown in SEQ ID No.45; The specific primer 1 for detecting CMSNP251 consists of nucleotides 22 and later of SEQ ID No.46, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.47, and the reverse primer consists of nucleotides shown in SEQ ID No.48; The specific primer 1 for detecting CMSNP262 consists of nucleotides 22 and later of SEQ ID No.49, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.50, and the reverse primer consists of nucleotides shown in SEQ ID No.51; The specific primer 1 for detecting CMSNP273 consists of nucleotides 22 and later of SEQ ID No.52, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.53, and the reverse primer consists of nucleotides shown in SEQ ID No.54; The specific primer 1 for detecting CMSNP281 consists of nucleotides 22 and later of SEQ ID No. 55, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 56, and the reverse primer consists of nucleotides shown in SEQ ID No. 57; The specific primer 1 for detecting CMSNP298 consists of nucleotides 22 and later of SEQ ID No.58, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.59, and the reverse primer consists of nucleotides shown in SEQ ID No.60; The specific primer 1 for detecting CMSNP319 consists of nucleotides 22 and later of SEQ ID No.61, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No.62, and the reverse primer consists of nucleotides shown in SEQ ID No.63; The specific primer 1 for detecting CMSNP317 consists of nucleotides 22 and later of SEQ ID No. 64, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 65, and the reverse primer consists of nucleotides shown in SEQ ID No. 66; The specific primer 1 for detecting CMSNP464 consists of nucleotides 22 and thereafter of SEQ ID No. 67, the specific primer 2 consists of nucleotides 22 and thereafter of SEQ ID No. 68, and the reverse primer consists of nucleotides shown in SEQ ID No. 69; The specific primer 1 for detecting CMSNP462 consists of nucleotides 22 and later of SEQ ID No. 70, the specific primer 2 consists of nucleotides 22 and later of SEQ ID No. 71, and the reverse primer consists of the nucleotides shown in SEQ ID No.
72.
3. The set of KASP primers according to claim 2, characterized in that: In the forward primer 1, the fluorescent tag sequence connected to the 5' end is a VIC tag sequence; and / or in the forward primer 2, the fluorescent tag sequence connected to the 5' end is a FAM tag sequence.
4. The set of KASP primers according to claim 3, characterized in that: The VIC tag sequence is shown as positions 1-21 of SEQ ID No. 1; and / or the FAM tag sequence is shown as positions 1-21 of SEQ ID No.
2.
5. A kit comprising the set of KASP primers according to any one of claims 2 to 4.
6. Use of the set of KASP primers according to any one of claims 2 to 4 or the kit according to claim 5 in any of the following: (1) preparing a melon SNP site detection kit; (2) Identify the consistency of melon varieties; (3) Construct DNA fingerprints of melon germplasm resources or varieties.
7. A method for constructing DNA fingerprints of melon germplasm resources or varieties, characterized in that: include: The genotypes of the 24 SNP sites in claim 1 are detected in the genomes of different varieties of melons, and the genotypes of the 24 SNP sites in the genome of each variety of melon are recorded respectively to obtain a DNA fingerprint of melon germplasm resources or varieties.
8. A method for identifying melon germplasm resources or varieties, characterized in that: The genotype of the 24 SNP sites described in claim 1 in the genome of the melon to be tested is detected and compared with the genotypes of different varieties of melons in the melon germplasm resources or variety DNA fingerprint map described in claim 7. If the genotype of the melon to be tested is completely consistent with the comparison result of a certain variety of melon in the above-mentioned melon fingerprint map, the melon to be tested is the melon of that variety.
9. A method for identifying consistency of melon varieties, comprising the following steps: obtaining the genotype of the melon to be tested at the 24 SNP sites described in claim 1, namely, the fingerprint of the melon to be tested; if the number of difference sites after comparing the fingerprints of two melons to be tested is ≥2, the two melons to be tested are different varieties; if the number of difference sites is <2, the two melons to be tested are similar varieties.