Molecular marker and probe group related to disease resistance of apple brown spot and application of molecular marker and probe group

By developing SNP and InDel markers for Apple Brown Spot disease resistance, combined with Illumina sequencing and probe sets, the problems of high cost and low efficiency in apple breeding were solved, and high accuracy and efficient breeding effects were achieved.

CN120519618AActive Publication Date: 2025-08-22CHINA AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510825527.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2025-08-22
Estimated Expiration
2045-06-19

AI Technical Summary

Technical Problem

The prior art is costly and unstable in preventing and treating apple brown spots. Traditional breeding methods take a long time and are difficult to accurately predict the properties of new varieties. It is necessary to develop more effective molecular markers to improve breeding efficiency and accuracy.

Method used

Seven molecular markers of apple brown spot resistance, including 4 SNP markers and 3 InDel markers, were developed. They were genotyping by Illumina sequencing, and accurate prediction and breeding of apple brown spot resistance were combined with probe sets.

Benefits of technology

High accuracy prediction of apple brown spot disease resistance is achieved, and new ways to screen and breed excellent disease resistance germplasm, reducing costs and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519618A_ABST
    Figure CN120519618A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of molecular genetic breeding, and particularly relates to a group of molecular markers related to disease resistance of apple brown blotch, a probe group and application, the molecular markers comprise four SNP markers and three InDel markers, through combination of the two molecular markers, four disease resistance grades of high brown blotch resistance, brown blotch resistance, moderate brown blotch infection and brown blotch infection can be accurately divided, and the disease resistance of the apple brown blotch is greatly improved. Therefore, auxiliary selection is provided for apple breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular genetic breeding, and in particular relates to a group of molecular markers, probe sets and applications related to apple brown spot disease resistance. Background Art

[0002] Apple brown spot is a fungal disease caused by the sexual form of the pathogen, Diplodia inaequalis, and the asexual form, Diplodia inaequalis. This pathogen primarily harms apple leaves, but also fruit, often manifesting as necrotic spots on leaves, causing premature leaf drop and significantly impacting apple yield and quality. Apple brown spot has become the most widespread and devastating early leaf drop disease in apple production, and in recent years has caused significant economic losses to the apple industry worldwide.

[0003] Currently, production primarily relies on a combination of chemical control and agricultural measures. Chemical control involves spraying protective fungicides such as propineb and mancozeb in mid-to-late April of the same year. Agricultural management measures include winter orchard cleaning to thoroughly remove diseased leaves, increasing the use of organic fertilizers, appropriately reducing the use of nitrogen fertilizers, focusing on pruning, and improving ventilation and light conditions in orchards. However, existing control methods suffer from high costs and inconsistent effectiveness. Therefore, improving the disease resistance of cultivated varieties and breeding resistant varieties are the most effective control methods.

[0004] Traditional apple breeding methods typically require a long time and significant resources, and it is difficult to accurately predict the performance of new varieties. However, molecular marker-assisted breeding can improve breeding efficiency, shorten the breeding cycle, reduce costs, and enhance the accuracy and stability of varieties. Therefore, the development of relevant molecular markers is crucial for disease-resistant apple breeding. Resistance to apple brown spot disease is a quantitative trait controlled by multiple genes, including a major gene with significant influence. In a study of the genetic analysis and molecular markers of apple brown spot disease resistance, a population of hybrid seeds of Hongyu and Jinguan served as a segregating population, and 17 pairs of SSR primers were screened from 144 pairs that showed polymorphism between resistance and susceptibility. RAPD markers for apple brown spot disease resistance genes were also identified using Qinguan, Fuji, and their hybrid F generations as test materials. One RAPD marker, S428-854, was linked to the resistance gene. Therefore, to provide more molecular markers for apple brown spot disease resistance, further development of additional molecular markers is needed. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides a molecular marker, a probe set and applications related to apple brown spot disease resistance.

[0006] The specific technical solutions of the present invention are as follows.

[0007] A group of molecular markers for apple brown spot resistance, the molecular markers comprising a SNP marker group and an InDel marker group; The SNP group includes 4 SNP markers, and the 4 SNP markers include SNP1 to SNP4; the nucleotide sequences of SNP1 to SNP4 are SEQ ID NO.1 to SEQ ID NO.4, respectively; Among them, the SNP1 is a C-to-T mutation at 24618204bp on apple chromosome 0; the SNP2 is an A-to-T mutation or a G-to-T mutation at 13924744bp on apple chromosome 8; the SNP3 is a C-to-A mutation at 27163218bp on apple chromosome 10; the SNP4 is an A-to-G mutation at 12662946bp on apple chromosome 17; The InDel marker group includes three InDel markers, including InDel1 to InDel3; the nucleotide sequences of InDel1 to InDel3 are SEQ ID NO.5 to SEQ ID NO.7, respectively; Among them, the InDel1 is a C or AT insertion at the 117948680bp position of the apple No. 11 stain; the InDel2 is an AG presence or absence at the 7739098bp position of the apple No. 14 stain; and the InDel3 is a TA presence or absence at the 11163770bp position of the apple No. 14 stain.

[0008] The present invention developed four SNP markers and three InDel markers related to apple brown spot disease resistance, totaling seven major effect markers. Experiments found that the use of the above seven major effect markers of apple brown spot disease resistance can effectively and accurately predict apple brown spot disease resistance, and obtain four disease resistance grades: high resistance to brown spot disease, disease-resistant brown spot disease, moderately susceptible to brown spot disease, and susceptible to brown spot disease. The Pearson correlation coefficient r between the disease resistance grade value and the measured brown spot disease leaf drop rate is 0.539, indicating that the test results are highly accurate, providing a new method for the screening and breeding of excellent disease-resistant germplasm.

[0009] The second aspect of the present invention provides a probe set for amplifying the molecular marker, wherein the probe sequence of Chr00_24618204 is shown as SEQ ID NO.8; The probe sequence of SNP1 is shown in SEQ ID NO.8; The probe sequence of SNP2 is shown in SEQ ID NO.9; The probe sequence of SNP3 is shown in SEQ ID NO.10; The probe sequence of SNP4 is shown in SEQ ID NO.11; The probe sequence of InDel1 is shown in SEQ ID NO.12; The probe sequence of InDel2 is shown in SEQ ID NO.13; The probe sequence of InDel3 is shown in SEQ ID NO.14.

[0010] The third aspect of the present invention provides a kit comprising the probe set.

[0011] The fourth aspect of the present invention provides the use of the probe set in apple breeding.

[0012] The fifth aspect of the present invention provides the use of the probe set in identifying resistance to apple brown spot disease.

[0013] The sixth aspect of the present invention provides the use of the kit in identifying resistance to apple brown spot disease.

[0014] The seventh aspect of the present invention provides the use of the kit in apple breeding.

[0015] An eighth aspect of the present invention provides a method for identifying resistance to apple brown spot disease, comprising the following steps: The target sequence was captured using the probe set, and after genotyping by Illumina sequencing, the disease resistance of the tested samples to apple brown spot disease was determined according to the following criteria: When the genotype at 27163218bp of chromosome 10 is CT and TT, the genotype at 7739098bp of chromosome 14 is delAG / delAG, the genotype at 11163770bp of chromosome 14 is TA / delTA and delTA / delTA, and the genotype at 12662946bp of chromosome 17 is any of AG, it is judged to be highly resistant to apple brown spot disease; If the genotype of the 24618204bp on chromosome 0 is CT and TT, the genotype of the 13924744bp on chromosome 8 is AT, TT, GT, and the genotype of the 7739098bp on chromosome 14 is AG or delAG, the strain is considered resistant to apple brown spot. If the genotype of 7948680bp on chromosome 11 is C / insAT, it is determined to be susceptible to apple brown spot disease; Plants in other cases were moderately susceptible to brown spot disease.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The present invention has developed seven major molecular markers associated with apple brown spot resistance, including four SNP markers and three InDel markers. These markers are suitable for marker-assisted selection of apple brown spot resistance in breeding materials at the seedling stage, molecular-assisted evaluation of apple brown spot resistance in apple germplasm resources, and screening of superior disease-resistant germplasm and design of breeding programs. Furthermore, the detection accuracy is high and the cost is low. Using the seven major markers for apple brown spot resistance, apple brown spot resistance can be effectively predicted, yielding four resistance grades: highly resistant to brown spot, resistant to brown spot, moderately susceptible to brown spot, and susceptible to brown spot. The Pearson correlation coefficient r between the resistance grade and the measured brown spot leaf drop rate is 0.539, indicating high prediction accuracy. This provides a new approach for screening and breeding superior disease-resistant germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The results of marker-assisted prediction should be performed for seven molecular markers related to apple brown spot resistance. DETAILED DESCRIPTION

[0018] In order to make those skilled in the art better understand the technical solution of the present invention and be able to implement it, the present invention is further described below in conjunction with specific examples and accompanying drawings. In the description of the present invention, unless otherwise specified, the reagents used are all commercially available and the methods used are all conventional techniques in the art.

[0019] In the following examples, the classification criteria for highly resistant to apple brown spot, resistant to apple brown spot, susceptible to apple brown spot, and moderately susceptible to apple brown spot are as follows: High resistance to apple brown spot disease means that the disease index is less than 5%, that is, the number of lesions is extremely small and the degree of leaf infection is very low.

[0020] Resistance to apple brown spot disease means that the disease index is between 5% and 20%, indicating a certain degree of disease resistance, but not as good as highly resistant varieties.

[0021] Moderate susceptibility to brown spot disease refers to a disease index between 20% and 50%, indicating a certain degree of sensitivity to brown spot disease, but not high susceptibility.

[0022] Susceptibility to apple brown spot disease means that the disease index is greater than 50%, indicating that the apple is highly sensitive to brown spot disease and the leaves are seriously infected.

[0023] 1. Phenotypic identification of apple brown spot disease resistance.

[0024] Using 4,792 hybrid lines from four hybrid populations (Purple Pearl × Red Fuji, Purple Pearl × Golden Crown, Red Jade × Golden Crown, and Red Jade × Tsugaru) and 361 germplasm accessions, we investigated field resistance to apple brown leaf spot for four consecutive years. Field leaf drop caused by brown leaf spot was used as an indicator of resistance.

[0025] Conidia of brown spot disease were collected from diseased leaves in the field, and spore suspensions were prepared. The spores were inoculated in vitro with detached leaves of 361 apple germplasm resources. Disease resistance was identified using incidence rate and lesion area as detection indicators.

[0026] (2) Discovery of mutation sites associated with resistance to apple brown spot disease.

[0027] BSA-seq was used to identify QTLs associated with brown spot resistance in hybrid populations, resulting in a total of 83 QTLs for apple brown spot resistance across four populations. A genome-wide association study of brown spot resistance was conducted using 253 apple germplasm accessions, locating 36 significant association intervals for apple brown spot resistance.

[0028] (3) Development of molecular markers for apple brown spot resistance.

[0029] Based on variant type, gene expression, and functional annotation, molecular markers were developed by selecting variant loci at candidate genes within each QTL and GWAS interval associated with apple brown spot resistance. A total of 206 single-nucleotide polymorphisms (SNPs) and indels (InDel) molecular markers were designed, distributed across 17 chromosomes. The markers were identified using the GenoBaits strategy, with target sequences captured using DNA probes, followed by marker genotyping using Illumina second-generation resequencing.

[0030] (4) Estimation of genotype effect values ​​of apple brown spot resistance markers and screening of major effect markers.

[0031] The 206 molecular markers were used to train a training population of 1506 individual plants from the four hybrid combinations and apple germplasm resources. Genotyping for these 206 markers was performed using the GenoBaits strategy. The genotypic and marker effects of each marker on resistance to apple brown spot in the training population were estimated. Markers with large marker effects were selected, resulting in the identification of 10 SNP or InDel markers with marker effect values ​​greater than 20.00. Then, the genotype combination effect values ​​of the 10 SNP or InDel markers with larger effect values ​​were estimated. Through this estimation step, 3 redundant markers were deleted, and finally 4 SNPs and 3 InDel markers were determined as the main effect markers of apple brown spot resistance, namely Chr00_24618204, Chr08_13924744, Chr10_27163218, Chr11_7948680, Chr14_7739098, Chr14_11163770 and Chr17_12662946. Among them, Chr00_24618204, Chr08_13924744, Chr10_27163218, Chr11_7948680 are SNP markers, and Chr14_7739098, Chr14_11163770 and Chr17_12662946 are InDel markers.

[0032] The flanking sequence information of the SNP and InDel markers is as follows. The non-variant base (before) and the variant base (after) are indicated in square brackets "[ ]", and the two are separated by " / ".

[0033] The nucleotide sequence of SNP1: Chr00_24618204 is shown in SEQ ID NO.1.

[0034] SEQ ID NO.1: AGAGTTCAACTTCAATTCTACTACCTACTCGGTGAGCAGGCCATTGACGTTGCCAGGTTTGAAAGGCCACACAGAGTCTGTGCATTGTGACCCTACTAGTTCGCGAACGGAGTATATCGTTCACCTGGGGGGTTCAGACTTTTGCCTTGTCCAGACTGCCATGGAGAGCTGCAGAAGTGATTGTCAACCACTGTGGGTCAC[C / T]CACGTTCCGAATCGTCATTGCAAGTGGAGGAGGAAGCTATATCGAGACCTTGCATTCGACGCCATGTGATGTGGACATCAGCGGGGCTAGTTTCCGTATTAGGTATAGCTTCGCAAAGTAAGTTGCTTTGTTCTTTTTCTTCTTCCCTATTTTTTCAATGCCATTAGTTATACGATTTCTTTTTAATTTTATGACTCAGA。

[0035] SNP2: The nucleotide sequence of Chr08_13924744 is shown in SEQ ID NO.2.

[0036] SEQ ID NO.2: TCTCTCTCTCACTTCCTCCCTCCCATCTATGAAGTTCCGGGGCACCCAGAGGACACCCAACCTAGGTTCGGCAAACCATGGGTGTGCGAGCTCAGGTCCGGCCACCTCCAGCCGTTTCACTACTAATCACAGGTAGCAACCTCTTCATTTTGTCTTTACCTTCAATTTCCTAGTTAGATCGTAGGGTATATGGGAGTTTT[A / T]CCAACAACCGGAGCACGGAAGGCTCCGGACTCCTTCCCCGGTGAGGAATGGGTCAGTGACCCAAGTCGAGTGAACCTAGGCCATTTGGGCCGTATATAGAACTCGGGCCCTAAGCCCATTTAAACCCAACCCAAAACCCTTAGAGGCTTTGGCCTTCGGGCCATGTGAACCTAGGCCCAAGCCCAGAGAACCTAGACCCA; or TCTCTCTCTCACTTCCTCCCTCCCATCTATGAAGTTCCGGGGCACCCAGAGGACACCCAACCTAGGTTCGGCAAACCATGGGTGTGCGAGCTCAGGTCCGGCCACCTCCAGCCGTTTCACTACTAATCACAGGTAGCAACCTCTTCATTTTGTCTTTACCTTCAATTTCCTAGTTAGATCGTAGGGTATATGGGAGTTTT[G / T]CCAACAACCGGAGCACGGAAGGCTCCGGACTCCTTCCCCGGTGAGGAATGGGTCAGTGACCCAAGTCGAGTGAACCTAGGCCATTTGGGCCGTATATAGAACTCGGGCCCTAAGCCCATTTAAACCCAACCCAAAACCCTTAGAGGCTTTGGCCTTCGGGCCATGTGAACCTAGGCCCAAGCCCAGAGAACCTAGACCCA。

[0037] SNP3: The nucleotide sequence of Chr10_27163218 is shown in SEQ ID NO.3.

[0038] SEQ ID NO.3: TGTATGTCTGTAAATAGTTTAACTACTTATTATATTGTCACTTGGTTTTATGGTGATTTCAATTTCTTTATGGTATTTGATCGAGCAAGTTATTCCATGTGTGAACCTTGACGTTCTCTACGCCACCTATTTTCTGATATCCATGTATTGGGCTTGAAAATTCATTCATGTGAGAAGATGTGTTGAGAGTATGAACCCTT[C / A]GTAAAATTTGCCAATTAATTTTATAAGATACCTCAAATTATTCAAAATATATTAATTTTATGGGATACTTCAAATTCTTCAACAATATTAAACCATATGATGCATTGTAAAACAATTACTAAAAGAAAGTTCGAAGTACACACCTAACATAGTGGCGGAGCTACTAAGGGACCAGTATGGTCCCTGGTCCATACTGCCTT。

[0039] SNP4: The nucleotide sequence of Chr17_12662946 is shown in SEQ ID NO.4.

[0040] SEQ ID NO.4: ATGGATGCATCAAAGCTGAAGAAAGAGTTCCCTGAACTGCTTCCGATTAAGGAATCGCTGATTAAATACGTGTTTGAACCCAACAAGAAAACATTTGCAGGTGGAGCAGCAATTTAAGAGTCTCATGAAGTGGACCTCGATACCGATCCTATACATTTATTTATTTATTTTTCTTGTGGGAAATCGCTAGGGGTTTAGTT[A / G]TTCTCATGTTGTGATTCCATCAGTGTCTGTGATAGCTTAGGTTAATTTCATAAGTTGGTGCTATTGGTTCTGGTTTGGCTATTGTGATATAAGAAGCTTTGGAATTGCTTCGGAAATATTTGAAGGGTCTACTGTAAGTTGGGGCATCGTAATTTTCAGATATGTAATAAATTAATTATTTTTATTTATACAAGTTCTTT。

[0041] InDel1: The nucleotide sequence of Chr11_7948680 is shown in SEQ ID NO.5.

[0042] SEQ ID NO.5: TTTTTTTAGGAAAGCATTCCAACTGTTTTTCTAGAAAGTATTTGGATTTTTTATATCCCGAATCAAAGTGTGAATGTCCCTTAGAAGCGTGGCATGCTCGTTTTGATCAGGAGCGGGGTGGACAACTTCAGCCGGTGCTTGCGTCTGCGGCGGCACCTTGTGAGTTGCAGTATGTTGTGGATCTGCCGCCTGCAGTAGTG[C / insAT]CTCGTTATCCACATTAAAAACGTAATTGATGAATTCAAGGAGATCCATTCTATCTTGTAATTATTCTCAAAAATATATCTAGCAAAAGAACCTATGGACATACATGTTTCTTACAAAAGCAGTAAAAAAATATGCACTAAATTTGAACGTCGTAGATCTTAGAAATATAGTAAACTTTGTATGGTCAATGGCAATGAAGG。

[0043] InDel2: The nucleotide sequence of Chr14_7739098 is shown in SEQ ID NO.6.

[0044] SEQ ID NO.6: TACCTTTCTGGTTGTGCCACTGCCACGAACCACTTGCCTTCGCAAAGCTTCGCACTCGAACTCGTCCAACAGATCCTCCGCATCAAGGAACACATCTTTAAGTTGTTGTAGCCAACTGCGTAGGTCACCGTTACGTGCTTGCTTCTCTTGGGCATCCACGAGCGTCTTTGATTATGGACACGGTGCGTCCAAGTTTCTGC[AG / delAG]ATCCGCTTGAACACCCCACGCCAAGCAAATCTCCTCAGAAGCAATGGAGCTGAGCCTTTCAATGAGTTTGGCTGCCAACGGAAATGCAAGCTCGGCCATCTTTCTTTCTTTCTTTCTTGATGAGGTGAGTGCAGGGGAATTGAGATAGTATGAATAATGATGATGATGCTTCCTTATGATAACTAGTATAATGGCCAAG。

[0045] The nucleotide sequence of InDel3: Chr14_11163770 is shown in SEQ ID NO.7.

[0046] SEQ ID NO.7: GATGATATCGGAGTGAAAAAGGTTTGCATTTTGTTTTTCTTTGACATGTACATATGATGTCTCTCGATGTTATTGGCCTATATTGTGTAATATTCACCGGAACAGATTCGGTCACGCGTGGGAATTCGCCCAAATTTACTCTTCTTGGCAGTTGGAGATATGTGATGAATTGCGGCCTTCAGTGCCCTGGTTTTCGTGTG[T A / delTA]TGTAAAAATCGAGTTTTGGAACAAGGGAGCGATTTTCGCACACTTTTTCGACTTCTACACTCGCCTTAATCGAGCGAGGAATTTCAAGTCCCAAGAGATTTAAAGCCGTATGGTTATTTTCTAATTCCCAAGGGAGTTGGACTTGGAAGATAAGGCAACGTTTGCCTATCAGGGCGGATAAGGCAACACTCGCCTCACT.

[0047] The GenoBaits probe sequence information corresponding to the four major SNPs and three InDel markers is as follows: The probe sequence of SNP1 is shown in SEQ ID NO.8: TTCACCTGGGGGGTTCAGACTTTTGCCTTGTCCAGACTGCCATGGAGAGCTGCAGAAGTGATTGTCAACCACTGTGGGTCACCACGTTCCGAATCGTCATTGCAAGTGGA.

[0048] The probe sequence of SNP2 is shown in SEQ ID NO.9: ACTACTAATCACAGGTAGCAACCTCTTCATTTTGTCTTTTACCTTCAATTTCCTAGTTAGATCGTAGGGTATATGGGAGTTTTACCAACAACCGGAGCACGGAAGGCTCCG.

[0049] The probe sequence of SNP13 is shown in SEQ ID NO.10: TACGCCACCTATTTTCTGATATCCATGTATTGGGCTTGAAAATTCATTCATGTGAGAAGATGTGTTGAGAGTATGAACCCTTCGTAAAATTTGCCAATTAATTTTATAAG.

[0050] The probe sequence of SNP4 is shown in SEQ ID NO.11: AGTCTCATGAAGTGGACCTCGATACCGATCCTATACATTTATTTATTTATTTTTCTTGTGGGAAATCGCTAGGGGTTTAGTTATTCTCATGTTGTGATTCCATCAGTGTC.

[0051] The probe sequence of InDel1: is shown in SEQ ID NO.12: AGGAGCGGGTGGACAACTTCAGCCGGGTGCTTGCGTCTGCGGCGGCACCTTGTGAGTTGCAGTATGTTGTGGATCTGCCGCCTGCAGTAGTGCCTCGTTATCCACATTAA.

[0052] The probe sequence of InDel2: is shown in SEQ ID NO.13: TAGCCAACTGCGTAGGTCACCGTTACGTGCTTGCTTCTCTTGGGCATCCACGAGCGTCTTTGATTATGGACACGGTGCGTCCAAGTTTCTGCAGATCCGCTTGAACACCC.

[0053] The probe sequence of InDel3: is shown in SEQ ID NO.14: TGGGAATTCGCCCAAATTTACTCTTCTTGGCAGTTGGAGATATGTGATGAATTGCGGCTTTCAGTGCCCTGGTTTTCGTGTGTATGTAAAAATCGAGTTTTGGAACAAGG.

[0054] (5) Marker-assisted selection method for apple brown spot disease resistance The genotype distribution and resistance allelic variation of the above seven major markers for apple brown spot resistance are as follows: Chr00_24618204 has three genotypes, namely CC, CT and TT. When the genotype is CT and TT, it means that the apple variety is dominantly resistant to brown spot disease.

[0055] Chr08_13924744 has six genotypes, namely AA, AG, AT, TT, GT and GG. When the genotype is AT, TT, or GT, it means that the apple variety is dominantly resistant to brown spot disease.

[0056] Chr10_27163218 has three genotypes, namely CC, CA and CT. When the genotype is CA, it means that the apple variety is dominant and highly resistant to brown spot disease.

[0057] There are four genotypes at Chr11_7948680, namely CC, CT, TT and C / insAT. When the genotype is C / insAT, it means that the apple variety has dominant brown spot disease.

[0058] There are 7 genotypes at Chr14_7739098, namely AA, AG, AT, GG, TT, delAG and AG / delAG. When the genotype is delAG / delAG, it means that the apple variety is additively highly resistant to brown spot disease, and when the genotype is AG / delAG, it means that the apple variety is resistant to apple brown spot disease.

[0059] There are a total of 6 genotypes at Chr14_11163770, namely CC, TC, TT, TA, TA / delTA and delTA. When the genotype is TA / delTA and delTA / delAG, it means that the apple variety is dominant and highly resistant to brown spot disease.

[0060] There are five genotypes at Chr17_12662946, namely AA, AG, AT, TT and ATTCTCATG / delATTCTCATG. When the genotype is AG, it means that the apple variety is dominant and highly resistant to brown spot disease.

[0061] The seven apple brown spot disease resistance markers mentioned above have complementary epistatic effects. Based on their non-allelic interactions, the following criteria were used to determine and select apple brown spot disease resistance in apple germplasm resources or hybrid progenies: 1) When the genotype at 27163218bp of chromosome 10 is CT and TT, or the genotype at 7739098bp of chromosome 14 is delAG / delAG, or the genotype at 11163770bp of chromosome 14 is TA / delTA and delTA, or the genotype at 12662946bp of chromosome 17 is AG, the germplasm resources or hybrid offspring show high resistance to apple brown spot disease.

[0062] 2) After excluding the above-mentioned individuals with high resistance to apple brown spot disease, when the genotype of the 24618204bp of chromosome 0 is CT and TT, or the genotype of the 13924744bp of chromosome 8 is AT, TT, GT or any one of the genotypes, or the 7739098bp of chromosome 14 is AG / delAG, their germplasm resources or hybrid offspring show resistance to apple brown spot disease.

[0063] 3) After excluding the above-mentioned individuals with high resistance to brown spot disease and those resistant to brown spot disease, when the genotype of chromosome 11 at 7948680bp is C / insAT, its germplasm resources or hybrid offspring are susceptible to apple brown spot disease.

[0064] 4) After excluding the above-mentioned plants with high resistance to brown spot disease, resistance to brown spot disease, and susceptible to brown spot disease, the remaining plants showed moderate susceptibility to brown spot disease.

[0065] Specific implementation plan (1) DNA extraction, library construction, and target site capture sequencing Genomic DNA was extracted from leaves of the test material. The genome was accurately quantified using the Qubit® dsDNA HS Assay Kit. Enzyme digestion and DNA library construction were performed using the GenoBaits® DNA Library Prep Kit for ILM, and adapters were added using the GenoBaits® Barcode for ILM Kits. Molecular hybridization and target site capture were then performed using the GenoBaits® DNA Hybridization Kit for ILM, using GenoBaits® DNA probes corresponding to the seven major markers for apple brown spot disease.

[0066] (2) Target site sequencing and marker genotyping The captured target library was sequenced using an Illumina sequencer using the PE150 strategy at a sequencing depth of 1000× to 1200×. Sequencing reads were analyzed and genotyped using the GDDH13.1 reference genome.

[0067] (3) Marker-assisted apple brown spot disease resistance Based on the genotyping data of the seven major effect markers, the resistance of the tested materials to apple brown spot disease was judged according to the following criteria: 1) When the genotype at 27163218 bp of chromosome 10 is CT or TT, or the genotype at 7739098 bp of chromosome 14 is delAG / delAG, or the genotype at 11163770 bp of chromosome 14 is TA / delTA or delTA / delTA, or the genotype at 12662946 bp of chromosome 17 is AG, the germplasm or hybrid offspring show high resistance to apple brown spot disease, which is recorded as HR.

[0068] 2) After excluding the above-mentioned individuals with high resistance to brown spot disease, if the genotype of the 24618204bp of chromosome 0 is CT and TT, or the genotype of the 13924744bp of chromosome 8 is AT, TT, GT, or the genotype of the 7739098bp of chromosome 14 is AG / delAG, then the germplasm resources or hybrid offspring show resistance to apple brown spot disease and are recorded as R.

[0069] 3) After excluding the above-mentioned individuals with high resistance to brown spot disease and those resistant to brown spot disease, when the genotype of 7948680bp on chromosome 11 is C / insAT, its germplasm resources or hybrid offspring are susceptible to apple brown spot disease and are recorded as S.

[0070] 4) After excluding the above-mentioned plants with high resistance to brown spot disease, resistance to brown spot disease, and susceptible to brown spot disease, the remaining plants showed moderate susceptibility to brown spot disease and were recorded as MS.

[0071] Four apple varieties, including high resistance to apple brown spot, resistance to apple brown spot, susceptible to apple brown spot, and moderately susceptible to apple brown spot, totaling 1506 accessions were selected. The four SNP markers and three InDel markers were used to detect the resistance of the 1506 accessions. The resistance of the 1506 accessions was also tested according to the genotyping criteria of the seven major effect markers. The specific test results are as follows: Figure 1As shown, the Pearson correlation coefficient between the disease resistance grade and the measured brown spot leaf drop rate is r=0.539 (n=1055). Comparing the test results with the actual brown spot disease resistance, it was found that when the test result genotype is any one of CT, TT, delAG / delAG, TA / delTA, delTA / delTA, and AG, the corresponding actual apple disease resistance is all highly resistant to apple brown spot disease. When the test result genotype is any one of CT, TT, AT, TT, GT, and AG / delAG, the corresponding actual apple disease resistance is all resistant to apple brown spot disease. When the test result genotype is C / insAT, the corresponding actual apple disease resistance is all susceptible to apple brown spot disease. Plants in other cases are moderately susceptible to brown spot disease. The above results show that the test results of the present invention are consistent with the actual test results and the actual apple brown spot disease resistance, indicating that the method of the present invention can accurately determine the brown spot disease resistance grade of apples.

[0072] Although preferred embodiments of the present invention have been described, additional changes and modifications to these embodiments may occur to those skilled in the art once the basic inventive concepts become known.

[0073] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.

Claims

1. A set of molecular markers for apple brown spot resistance, characterized in that: The molecular markers are a SNP marker group and an InDel marker group; The SNP group includes 4 SNP markers, and the 4 SNP markers include SNP1 to SNP4; the nucleotide sequences of SNP1 to SNP4 are SEQ ID NO.1 to SEQ ID NO.4, respectively; Among them, the SNP1 is a C-to-T mutation at 24618204bp on apple chromosome 0; the SNP2 is an A-to-T mutation or a G-to-T mutation at 13924744bp on apple chromosome 8; the SNP3 is a C-to-A mutation at 27163218bp on apple chromosome 10; the SNP4 is an A-to-G mutation at 12662946bp on apple chromosome 17; The InDel marker group includes three InDel markers, including InDel1 to InDel3; the nucleotide sequences of InDel1 to InDel3 are SEQ ID NO.5 to SEQ ID NO.7, respectively; Among them, the InDel1 is a C or AT insertion at the 117948680bp position of the apple No. 11 stain; the InDel2 is an AG presence or absence at the 7739098bp position of the apple No. 14 stain; and the InDel3 is a TA presence or absence at the 11163770bp position of the apple No. 14 stain.

2. A probe set for amplifying the molecular marker according to claim 1, characterized in that: The probe sequence of SNP1 is shown in SEQ ID NO.8; The probe sequence of SNP2 is shown in SEQ ID NO.9; The probe sequence of SNP3 is shown in SEQ ID NO.10; The probe sequence of SNP4 is shown in SEQ ID NO.11; The probe sequence of InDel1 is shown in SEQ ID NO.12; The probe sequence of InDel2 is shown in SEQ ID NO.13; The probe sequence of InDel3 is shown in SEQ ID NO.

14.

3. A kit, characterized in that The kit comprises the probe set according to claim 2.

4. Use of the probe set according to claim 2 in apple breeding.

5. Use of the probe set according to claim 2 in identifying resistance to apple brown spot disease.

6. Use of the kit according to claim 3 in identifying resistance to apple brown spot disease.

7. Use of the kit according to claim 3 in apple breeding.

8. A method for identifying resistance to apple brown spot disease, characterized in that: The following steps are involved: The target sequence is captured using the probe set described in claim 2, and after genotyping by Illumina sequencing, the disease resistance of the test sample to apple brown spot disease is determined according to the following standards: When the genotype at 27163218bp of chromosome 10 is CT and TT, the genotype at 7739098bp of chromosome 14 is delAG / delAG, the genotype at 11163770bp of chromosome 14 is TA / delTA and delTA / delTA, and the genotype at 12662946bp of chromosome 17 is any of AG, it is judged to be highly resistant to apple brown spot disease; When the genotype of the 24618204bp of chromosome 0 is CT and TT, the genotype of the 13924744bp of chromosome 8 is AT, TT, GT, and the genotype of the 7739098bp of chromosome 14 is any one of AG / delAG, the apple is judged to be resistant to apple brown spot disease; When the genotype of 7948680bp on chromosome 11 is C / insAT, it is determined to be susceptible to apple brown spot disease; Plants in other cases were moderately susceptible to brown spot disease.

Citation Information

Patent Citations

  • Specific amplification primer for detecting marssonina coronaria and detection method

    CN101892308A

  • Loofah brown spot-resistant gene segments or gene markers and application

    CN104560963A

  • LAMP amplification primer and application thereof in apple tree brown spot detection

    CN116334297A

  • Structural variation marker in apple scab resistance breeding and application thereof

    CN119842956A