A method for identifying limestone associated and granite associated hainan dragon tree germplasm resources

Abstract

The present application relates to the technical field of molecular marker, and specifically provides a method for identifying limestone associated and granite associated Hainan dragon tree germplasm resources. The identification method is to detect specific SNP sites by using the amplification primer pair provided by the present application, and to distinguish the two habitat types of Hainan dragon tree according to SNP polymorphism. The amplification primer pair comprises a forward primer 5'AAAGAACTCAACCAAAATCC 3' and a reverse primer 5'TTCCTCGTTCTGACATTCCA 3', the limestone associated Hainan dragon tree has a base mutation of "A" at the 148th site of the amplification fragment, and the granite associated Hainan dragon tree has a base mutation of "G" at the 148th site of the amplification fragment. The method is simple, fast and accurate, and provides technical support for the classification and identification of related Hainan dragon tree resources and molecular breeding selection.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and plant molecular breeding, and particularly relates to a method for identifying limestone-associated and granite-associated Hainan dragon blood tree germplasm resources. Background Art

[0002] Dracaena hainanensis, found only in Hainan, China, is one of the two primary basal species of Dracaena hainanensis, and a prized ornamental plant in my country. Studying Dracaena hainanensis in different habitats (limestone-associated and granite-associated) is crucial for studying its conservation genetics and adaptive evolution. Therefore, there is an urgent need to develop a rapid, precise, and efficient method for accurately identifying and typing Dracaena hainanensis germplasm resources, thereby enhancing fundamental research on endangered species mechanisms and conservation genetics. Summary of the Invention

[0003] In order to overcome some of the defects in the existing technology, the present invention performed chloroplast whole genome sequencing and comparative analysis on one germplasm of Hainan Dragon Blood Tree, one of the limestone-associated and granite-associated types, screened out single-base variation sites that can be used to identify Hainan Dragon Blood Tree in these two habitat types, and developed SNP markers, as well as detection primers and methods.

[0004] The purpose of the present invention is to provide chloroplast genome SNP sites for identifying limestone-associated and granite-associated Hainan Dracaena germplasm resources, as well as specific primers and identification methods for identifying limestone-associated and granite-associated Hainan Dracaena germplasm resources.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The first aspect of the present invention provides a specific primer pair for identifying limestone-associated and granite-associated Hainan Dracaena germplasm resources;

[0007] The specific primer pair includes a forward primer and a reverse primer;

[0008] The sequence of the forward primer was: 5′AAAGAACTCAACCAAAATCC3′;

[0009] The sequence of the reverse primer was: 5′TTCCTCGTTCTGACATTCCA3′;

[0010] In the PCR amplification product of the limestone-associated Hainan Dracaena, a base mutation occurred to "A" at the 148th position of the amplified fragment; in the PCR amplification product of the granite-associated Hainan Dracaena, a base mutation occurred to "G" at the 148th position of the amplified fragment.

[0011] The second aspect of the present application provides a method for identifying or assisting in identifying limestone-associated and granite-associated Hainan dragon tree germplasm resources, comprising the following steps:

[0012] S1, extracting total genomic DNA of the Hainan dragon tree germplasm material to be tested;

[0013] S2, using the sample DNA extracted in step S1 as an amplification template, using the SNP-specific primer pair to perform PCR amplification on the sample DNA to be tested, and obtaining a PCR amplification product;

[0014] S3, PCR amplification product detection: the PCR amplification product is subjected to electrophoresis on a 1% agarose gel, and is subjected to electrophoresis at 100V in 1xTBE buffer for 40 min, the agarose gel contains 8% Goldview nucleic acid dye, the running gel result is photographed in a gel imaging system, 5000 bp DNA is used as a marker, the amplification product has only one band, and the band size is 422 bp, that is, the target band;

[0015] S4, PCR amplification product sequencing: the PCR amplification product is sequenced by Sanger first-generation conventional sequencing, at the 148th site of the amplification product, the germplasm base is "A" for limestone-associated Hainan dragon tree, and the germplasm base is "G" for granite-associated Hainan dragon tree.

[0016] Further, in step S2, the PCR reaction system of 30 μL is used: ddH2O 10.0 μL, 2xTaq PCR Master Mix 15.0 μL, total genomic DNA 1.0 μL, forward primer 2.0 μL, and reverse primer 2.0 μL.

[0017] PCR reaction amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 30 sec, 35 cycles; finally, 72℃ extension for 10 min, and 4℃ storage.

[0018] The present application has the following beneficial effects:

[0019] Compared with the nuclear genome sequence information, the chloroplast genome sequence information is more conservative, and the accuracy of the specific molecular marker technology developed based on the variation sites is higher, is not affected by environmental factors, does not need to be flowering or fruiting, only needs a small amount of fresh tissue sample, or a tissue sample dried by silica gel, and thus accurate and efficient identification of plant germplasm resources can be realized. By selecting one representative germplasm material from each of limestone associated type and granite associated type Hainan dragon tree germplasm resources, chloroplast whole genome sequencing and comparative analysis are carried out, and a chloroplast SNP marker is successfully developed. Based on the detection system of the marker, limestone associated type and granite associated type Hainan dragon tree germplasm resources can be quickly and accurately distinguished and identified. The technology provides strong technical support for carrying out basic research work such as endangered mechanism and conservation genetics of Hainan dragon tree, and has important application value in exploring the origin and evolution of Hainan dragon tree resources and promoting molecular breeding research field. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 It is an electrophoretogram of the LH-2 primer amplification product in the embodiment.

[0021] Figure 2 It is a peak chart result of part of bases in the LH-2 marker site sequencing;

[0022] Figure 3 It is a phylogenetic tree diagram obtained by UPGMA clustering analysis of Hainan dragon tree germplasm from different habitats. DETAILED DESCRIPTION

[0023] The specific embodiments of the present application are described below to facilitate those skilled in the art to understand the present application, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application defined and determined by the appended claims, and all the inventions utilizing the concept of the present application are within the scope of protection.

[0024] Example 1: Molecular identification of limestone associated type and granite associated type Hainan dragon tree

[0025] 1. Select experimental materials

[0026] Take 11 samples of limestone associated type Hainan dragon tree from Ruxianling in Dongfang City and Bawangling in Changjiang County of Hainan Province; take 21 samples of granite associated type Hainan dragon tree from Nanshan, Yalongwan in Sanya City and Changhuadaling in Changjiang County of Hainan Province (Table 1). The samples are used for SNP specific marker verification.

[0027] 2. SNP marker detection

[0028] 2.1 The total DNA of the above experimental materials, Dracaena hainanensis, was extracted using the modified CTAB method;

[0029] 2.2 Using the DNA of the Dracaena hainanensis sample extracted in step 2.1 as the amplification template and the developed specific labeled primer LH-2 as the amplification primer, PCR amplification was performed;

[0030] The LH-2 comprises:

[0031] Forward primer (SEQ ID NO. 1): 5′AAAGAACTCAACCAAAATCC3′;

[0032] Reverse primer (SEQ ID NO. 2): 5′TTCCTCGTTCTGACATTCCA3′;

[0033] 2.3 PCR reaction system: The volume was 30 μL, including 10.0 μL of ddH2O, 15.0 μL of 2× Taq PCR Master Mix, 1.0 μL of genomic DNA (~20 ng), 2.0 μL of LH-1 forward primer, and 2.0 μL of LH-1 reverse primer. The reaction amplification procedure was as follows: initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec; and a final extension at 72°C for 10 min. The DNA was then stored at 4°C.

[0034] The PCR amplification products were electrophoresed on a 1.5% agarose gel (containing 8% Goldview nucleic acid dye) in 1× TBE buffer at 240 V for 7 min. The gel run was photographed and recorded using a gel imaging system.

[0035] 2.4 The above PCR products were sequenced using the conventional Sanger sequencing method. The sequence of the PCR amplification product of the limestone-associated Dracaena hainanensis is shown in SEQ ID NO. 3; the sequence of the PCR amplification product of the granite-associated Dracaena hainanensis is shown in SEQ ID NO. 4.

[0036] SEQ ID NO. 3: AATTTTCTAATCTACAAGAATGAAATGTTTGTTATGCTTAATATCTTTAGTTTAATCTGTATCTGTCTTAATTCCATCCTTTATTCGAGTAGTTTTTTCTTCGCTAAATTGCCCGAGGCTTATGCCTTTTTCAATCCAATCGTAGATATTATGCCTGTCATACCTGTACTATTTTTTCTATTAGCTTTTGTTTGGCAAGCTGCTGTAAGTTTTCGATAAAATTTTTAATACTCTGCAAAATTCATGATTTATTCGAAAAAAAAATTCTAAAATAAAAATTGATAAGATCAGATAAGTTTTACATTAGGAACCCCCGATTCAAAAATAGAAATTCTTGTATATTGAATTGAATAACCACGGTGATAAATTTGGATCAACTTAT.

[0037] SEQ ID NO. 4: AATTTTCTAATCTACAAGAATGAAATGTTTGTTATGCTTAATATCTTTAGTTTAATCTGTATCTGTCTTAATTCCATCCTTTATTCGAGTAGTTTTTTCTTCGCTAAATTGCCCGAGGCTTATGCCTTTTTCAATCCAATCGTAGATGTTATGCCTGTCATACCTGTACTATTTTTTCTATTAGCTTTTGTTTGGCAAGCTGCTGTAAGTTTTCGATAAAATTTTTAATACTCTGCAAAATTCATGATTTATTCGAAAAAAAAATTCTAAAATAAAAATTGATAAGATCAGATAAGTTTTACATTAGGAACCCCCGATTCAAAAATAGAAATTCTTGTATATTGAATTGAATAACCACGGTGATAAATTTGGATCAACTTAT.

[0038] 3. Identification results: analyze the sequencing results, find out the SNPs described above, and identify the limestone associated type and granite associated type of Hainan dragon tree germplasm materials. The detection results are shown in Table 1, Figure 1 , Figure 2 and Figure 3 .

[0039] Table 1 Specific SNP analysis table for identifying different Hainan dragon tree species resources

[0040]

[0041] Table 1 clearly shows that the primer LH-2 amplifies the 148th position of the target fragment in the 32 test materials, which is SNP 1. If the test germplasm material has a sequence of "A" base at SNP 1, it is a limestone-associated Hainan Dracaena; if the sequence of SNP 1 is "G" base, it is a granite-associated Hainan Dracaena.

[0042] Depend on Figure 1 and Figure 2 It can be clearly shown that: The results show that the length of the chloroplast gene fragment amplified by primer LH-2 is 422bp (attached Figure 1 The chloroplast gene fragment amplified by primer LH-2 has a SNP site (SNP1). If the target fragment SNP1 is an "A" base sequence, the accession can be accurately identified as a limestone-associated type of Dracaena hainanensis. If SNP 1 is a "G" base sequence, the accession can be accurately identified as a granite-associated type of Dracaena hainanensis.

[0043] Figure 3 The UPGMA cluster tree analysis results were obtained using the UPGMA clustering method to construct a cluster tree for 32 samples. Limestone-associated Dracaena hainanensis (EX) clustered into Cluster 1, while granite-associated Dracaena hainanensis (DX) clustered into Cluster 2. The results demonstrate that this method is effective in distinguishing between limestone- and granite-associated Dracaena hainanensis germplasm resources, and that the developed LH-2-specific SNP marker is effective, accurate, and reliable.

[0044] Specific embodiments are used in the present invention to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core ideas. At the same time, for those skilled in the art, according to the ideas of the present invention, there may be changes in the specific implementation methods and application scopes. In summary, the contents of this specification should not be understood as limiting the present invention.

Claims

1. A SNP-specific primer pair for identifying limestone-associated and granite-associated Hainan Dracaena germplasm resources, characterized in that: The specific primer pair includes a forward primer and a reverse primer; The sequence of the forward primer was: 5′AAAGAACTCAACCAAAATCC3′; The sequence of the reverse primer is: 5'TTCCTCGTTCTGACATTCCA3'.

Images